Calcium Supplementation Alleviates High-Fat Diet-Induced Estrous

Jun 10, 2019 - Obesity has been demonstrated as a disruptor of female fertility. Our previous study showed the antiobesity effects of calcium on HFD-f...
0 downloads 0 Views 4MB Size
Download PDF
Article Cite This: J. Agric. Food Chem. 2019, 67, 7073−7081

pubs.acs.org/JAFC

Calcium Supplementation Alleviates High-Fat Diet-Induced Estrous Cycle Irregularity and Subfertility Associated with Concomitantly Enhanced Thermogenesis of Brown Adipose Tissue and Browning of White Adipose Tissue

Downloaded via BUFFALO STATE on July 17, 2019 at 08:15:17 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Fenglin Zhang,†,‡ Han Su,†,‡ Min Song,†,‡ Jisong Zheng,†,‡ Fangfang Liu,†,‡ Cong Yuan,†,‡ Qin Fu,†,‡ Shuang Chen,†,‡ Xiaotong Zhu,†,‡ Lina Wang,†,‡ Ping Gao,†,‡ Gang Shu,†,‡ Qingyan Jiang,†,‡ and Songbo Wang*,†,‡ †

Guangdong Provincial Key Laboratory of Animal Nutrition Control, College of Animal Science, and ‡National Engineering Research Center for Breeding Swine Industry and ALLTECH-SCAU Animal Nutrition Control Research Alliance, South China Agricultural University, Guangzhou 510642, People’s Republic of China ABSTRACT: Obesity has been demonstrated as a disruptor of female fertility. Our previous study showed the antiobesity effects of calcium on HFD-fed male mice. However, the role of calcium in alleviating reproductive dysfunction of HFD-fed female mice remains unclear. Here, we found that HFD led to estrus cycle irregularity (longer cycle duration and shorter estrus period) and subfertility (longer conception time, lower fertility index, and less implantations) in mice. However, the HFDinduced reproductive abnormality was alleviated by calcium supplementation. Additionally, calcium supplementation enhanced activation/thermogenesis of BAT and browning of WAT in HFD-fed mice. Consequently, the abnormality of energy metabolism and glucose homeostasis induced by HFD were improved by calcium supplementation, with elevated metabolic rates and core temperature. In conclusion, these data showed that calcium supplementation alleviated HFD-induced estrous cycle irregularity and subfertility associated with concomitantly enhanced BAT thermogenesis and WAT browning, suggesting the potential application of calcium in improving obesity-related reproductive disorders. KEYWORDS: calcium, estrous cycle irregularity, subfertility, BAT thermogenesis, WAT browning, HFD-fed mice

■

INTRODUCTION Obesity has been a serious public health concern all over the world and a major risk factor associated with metabolic syndromes such as diabetes, hypertension, cardiovascular disease, and cancer.1 Beyond that, obesity also leads to various female reproductive problems such as subfertility,2−4 compromised ovarian function, 3,5 polycystic ovary syndrome (PCOS),6,7 irregular estrous cycle,8 and impaired oocyte development.9,10 Therefore, prevention of obesity contributes to protect against obesity-related metabolic and reproductive disorders. Obesity results from the imbalance between energy intake and energy expenditure, which leads to an excessive accumulation of adipose tissue. Classically, mammals have two types of adipose tissue, white adipose tissue (WAT) and brown adipose tissue (BAT).11 WAT is the main site of metabolic energy storage and adipokines secretion,12 and excessive WAT deposition is linked with metabolic disorders.13 In contrast, BAT dissipates energy in the form of heat due to its numerous mitochondria and abundant uncoupling protein 1 (UCP1).14 Recently, the beige or brite adipocyte, so-called browning of WAT, has been found to possess morphological features and thermogenic abilities similar to those of classic brown adipocyte.15−17 Accumulating evidence has suggested that activation of BAT and browning of WAT are a potential therapeutic strategy for fighting against obesity.18−21 In addition, it has been demonstrated that enhanced BAT activity © 2019 American Chemical Society

is involved in rescuing subfertility or PCOS induced by obesity.22−25 BAT activation and WAT browning are regulated by transcriptional regulators such as PR domain zinc-finger protein 16 (PRDM16), peroxisome proliferator-activated receptor coactivator 1α (PGC-1α),16,26 and various secreted mediators.19,27 In addition, some nutritional agents such as resveratrol,28,29 phytol,30,31 rutin,24 and retinoic acid32 participate in stimulating BAT activation and browning of WAT. Therefore, activating the BAT or promoting the browning of WAT through nutritional interventions are attractive strategies for preventing or treating obesity-linked reproductive dysfunctions. As one of the nutrients and an important mineral element in the diet, calcium ion serves as an intracellular second messenger and regulates many cellular processes, including cell proliferation,33 differentiation,34,35 and bone formation.36 Furthermore, our recent study37 and other reports38−41 have demonstrated that dietary calcium supplementation elicits beneficial effects on body weight/fat reduction and glucose homeostasis in mice and human. However, the effect of Received: Revised: Accepted: Published: 7073

April 28, 2019 June 9, 2019 June 10, 2019 June 10, 2019 DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081

Article

Journal of Agricultural and Food Chemistry Table 1. Primer Sequences Used for Real-Time Quantitative PCR gene

forward (5′-3′)

reverse (5′-3′)

amplification length (bp)

β-actin UCP1 PRDM16 PGC1α Cidea Elovl3

GGTCATCACTATTGGCAACGAG ACTGCCACACCTCCAGTCATT CAGCACGGTGAAGCCATTC CCCTGCCATTGTTAAGACC ATCACAACTGGCCTGGTTACG GATGGTTCTGGGCACCATCTT

GAGGTCTTTACGGATGTCAACG CTTTGCCTCACTCAGGATTGG GCGTGCATCCGCTTGTG TGCTGCTGTTCCTGTTTTC TACTACCCGGTGTCCATTTCT CGTTGTTGTGTGGCATCCTT

142 123 87 161 136 73

h, with free access to food and water. Images were determined using an infrared digital thermographic camera (E60: Compact Infrared Thermal Imaging Camera; FLIR), and the interscapular BAT (iBAT) temperature was analyzed using FLIR Quick Report software (FLIR ResearchIR Max 3.4; FLIR). Meanwhile, the core body temperature (rectal temperature) of mice was measured using a rectal probe connected to a digital thermometer (BAT-12, Physitemp, Yellow Spring Instruments). Oral Glucose Tolerance Test (OGTT) and Intraperitoneal Insulin Tolerance Test (ITT). After the mice were fed 18 weeks, the glucose homeostasis was assessed by OGTT and ITT. For OGTT, the mice were fasted overnight (20:00 to 08:00) and were gavaged the glucose (10% glucose solution, 1 g glucose/kg body weight). The blood glucose concentration was measured at various time points of 0, 30, 60, 90, and 120 min post gavage by using an Yuwell glucometer (Jiangsu Yuyue Medical Equipment & Supply Company, Jiangsu, China). For ITT, the 4 h-fasted mice were injected with insulin (1 U/ kg) intraperitoneally, and the blood glucose was detected as depiction in OGTT. Estrus Cycle Analysis and Reproductive Performance. After the mice were treated for 15 weeks, the estrous cycle of mice was determined once a day by cytological examination of vaginal smears obtained for 8 days continuously. The stages of estrus (E), proestrus (P), metestrus (M), and diestrus (D) were assessed on the basis of the cell types observed in vaginal smears. Mostly nucleated and some cornified epithelial cells were present at the proestrus stage; mostly cornified epithelial cells were observed at the estrous stage; both cornified epithelial cells and leukocytes were present at the metestrus stage; and primarily leukocytes were visible at the diestrus stage. Female mice selected for reproductive outcome studies were transferred to a mating cage and cohabited with proven fertility male mice (1:1). Mating was confirmed by the presence of a vaginal plug each morning during cohabitation. The conception time was defined as the number of days after initiation of cohabitation required for each pair to mate and was recorded for each female. In addition, mating index (number of sperm-positive females/number of cohabitated females × 100), fertility index (number of pregnant females/number of cohabitated females × 100), and fecundity index (number of pregnant females/number of sperm-positive females ×100) were calculated. The day on which evidence of copulation was identified was termed day 0.5 of gestation. On day 18.5 of pregnancy, mice were sacrificed and the total number of implantations was counted. Hematoxylin and Eosin (H&E) and Immunohistochemistry (IHC) Staining. The paraffin-embedded iWAT sections (5 μm) were stained with hematoxylin and eosin (H&E) staining or used for UCP1 IHC staining as previously described.29 The images were acquired using an EVOS XL Core cell imaging system (Life technologies). Real-Time Quantitative PCR. The mRNA expression of brown adipocytes marker genes such as UCP1, PRDM16, PGC1α, cell death-inducing DFFA-like effector A (Cidea), and elongation of very long-chain fatty acids protein 3 (Elovl3) in the BAT was examined by real-time quantitative as previously described.30 Primer sequences (with their respective PCR fragment lengths) were shown in Table 1. Western Blot Analysis. Western blot was conducted as previously described.31 Primary antibodies used include UCP1 (1:2000), PGC1α (1:2000), pyruvate dehydrogenase (PDH) (1:2000), cytochrome c (Cyto C) (1:2000), and β-actin (1:5000). The primary antibodies were purchased from Cell Signaling (Danvers, MA). Immunoreactive proteins in the membrane were scanned by the

calcium on reproductive performance in female mice fed HFD and the underlying mechanism remain unclear. Thus, the objective of this study is to investigate whether calcium supplementation can alleviate the estrous cycle irregularity and subfertility induced by HFD and explore the contribution of BAT thermogenesis and WAT browning in this process. Our results indicate that calcium supplementation alleviates HFD-induced estrous cycle irregularity and subfertility associated with concomitantly enhanced thermogenesis of BAT and browning of WAT.

■

MATERIALS AND METHODS

Animals and Experiment Design. All animal experiments were conducted with the permission number of SYXK (Guangdong) 20140136, and animal care procedures were performed in accordance with the guidelines for the care and use of animals approved by The Animal Ethics Committee of South China Agricultural University. Experiment 1, 36 C57BL/6J female mice (8-week-old) purchased from Guangdong Medical Laboratory Animal Center were housed in environmentally controlled rooms on a 12-h light−dark cycle (light from 08:00 to 20:00) with free access to water and food and were randomly divided into three groups: control group, HFD group, and HFD+Ca2+ group (n = 12). The control group was fed standard rodent chow diet (10% energy from fat). The HFD group and HFD +Ca2+group were fed a HFD (60% energy from fat) without or with 0.6% (w/w) calcium in drinking water, respectively. Body weight and food intake were measured weekly. Experiment 1 lasted for 20 weeks. After being treated for different times (as indicated in the corresponding methods), the mice were used for various examinations, including body composition, body temperature, metabolic rate, estrous cycle, and glucose homeostasis test. At the end of treatment, the mice were sacrificed by carbon dioxide anesthesia. The blood was collected and incubated at 37 °C for 1 h and then centrifuged at 3000 rpm for 20 min. The serum then was collected and stored at −20 °C for further determination of follicle stimulating hormone (FSH) using ELISA kits (NanJing Jian Cheng Bioengineering Institute). Meanwhile, the inguinal WAT (iWAT), visceral WAT (vWAT), and interscapular BAT (iBAT) were collected, weighed, and used for further analysis. Experiment 2, 18 C57BL/6J female mice (8-week-old) were also randomly divided into three groups, which are the same as those in experiment 1. After being treated for 20 weeks, the mice were mated with proven fertility male mice, and the pregnancy outcomes were investigated. Body Composition, Locomotor Activity, and Basal Metabolic Rate. After treatment for 12 weeks, the body fat content and body fat distribution were determined by using Small Animal Body Composition Analysis and Imaging System NMR Analyzer (MesoQMR23-060H, Niumag Corp., Shanghai, China). In addition, the locomotor activity of mice was measured by the open-field test (50 × 50 × 50 cm arena) for 5 min as previously reported.42 After treatment for 13 weeks, the basal/resting metabolic rates of mice were monitored for 24 h in a home cage by CLAMS (Promethion Metabolic Screening Systems, Sable systems International, North Las Vegas, NV). The metabolic parameters such as heat production and O2 consumption were analyzed. Infrared Thermography and Core Temperature. After being treated for 14 weeks, the mice were exposed to 25 or 4 °C for up to 4 7074

DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081

Article

Journal of Agricultural and Food Chemistry

Figure 1. Calcium supplementation reduced body weight and fat content. Effects of calcium supplementation on average weekly food intake (A), energy intake (B), water intake (C), body weight (D), fat content (E), and fat distribution (F). iWAT, vWAT, and BAT index in mice of control, HFD, and HFD+Ca2+ groups (G). Different lowercase letters indicate significant differences among groups (one-way ANOVA, with Tukey’s test, P < 0.05).

Figure 2. Calcium supplementation alleviated estrus cycle irregularity in HFD mice. (A) Detailed and representative data of vaginal cytology from control, HFD, and HFD+Ca2+ mice. E, estrus; P, proestrus; M, metestrus; D, diestrus. (B) Estrous cycle assessment in different groups. (C) Percentage time spent in each stage. (D) Effects of calcium supplementation on the levels of serum FSH. Different lowercase letters indicate significant differences among groups (one-way ANOVA, with Tukey’s test, P < 0.05).

7075

DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081

Article

Journal of Agricultural and Food Chemistry FluorChem M Fluorescent Imaging System (ProteinSimple, Santa Clara, CA). Densitometry analysis was perform using image J software, and the band density was normalized to the β-actin expression. Statistical Analysis. All data are expressed as means ± standard error of the mean (SEM). Statistical analysis was performed using Sigmaplot 14 (Systat Software, Inc., San Jose, CA). Differences between means were determined using one-way ANOVA with Tukey’s test, and a confidence level of P < 0.05 was statistically significant.

of HFD-fed female mice (Figure 2C), suggesting that the estrus cycle was almostly restored in HFD-fed female mice supplemented with calcium. An abnormal estrus cycle is always accompanied with altered serum gonadotropin concentration. Accordingly, our result demonstrated that the serum level of FSH was significantly decreased in the female mice of HFD group. Notably, calcium supplementation restored the serum FSH concentration to a relative normal level (Figure 2D). Together, these results highlighted that calcium supplementation alleviated estrus cycle irregularity induced by HFD in female mice. Calcium Supplementation Ameliorated Subfertility in Female Mice Fed with HFD. The pregnancy outcome of mice was assessed by determining the end points such as mating index, conception time, fertility and fecundity index, and number of implantations. As shown in Table 2, although

■

RESULTS Calcium Supplementation Reduced Body Weight Accompanied by a Decrease in Body Fat Content and WAT Mass. First, we investigated the effects of calcium supplementation on body weight and fat deposit in female mice fed HFD. The result demonstrated that the average weekly food intake of mice in the HFD and HFD+Ca2+ groups was significantly lower than that of control mice (Figure 1A). However, there was no difference of average weekly energy intake among the three groups (Figure 1B). The average weekly water intake of mice in the HFD+Ca2+ group was significantly lower than that of mice in the HFD group (Figure 1C). The body weight of female mice fed HFD was significantly increased as compared to that of female mice in the control group. However, the elevated body weight of HFDfed mice was remarkably decreased by calcium supplementation in water (Figure 1D). Meanwhile, QMR results revealed that calcium supplementation led to a significant reduction in body fat content of HFD-fed female mice (Figure 1E and F). Consistently, the HFD-induced increases in iWAT index and vWAT index were also markedly reduced by calcium supplementation (Figure 1G). As for the iBAT index, there was no difference between the HFD and HFD+Ca2+ groups. Taken together, these data showed that calcium supplementation in water significantly decreased body weight, fat content, and WAT mass in female mice fed HFD. Calcium Supplementation Alleviated Estrus Cycle Irregularity Induced by HFD in Female Mice. The assessment of estrus cycle is one of the key indexes in reproductive performance. Thus, we assessed the estrus cycle of the female mice by collecting vaginal cytology for 8 consecutive days. The detailed and representative data of vaginal cytology were shown in Figure 2A. As compared to the regular estrus cycle (4−5 days) of female mice in the control group, the estrus cycle of female mice in the HFD group is delayed up to 8 days. However, to a considerable extent, calcium supplementation could rescue the irregular estrus cycle of HFD-fed female mice by reducing the elongated time to normal days (Figure 2A). In addition, the number of female mice with normal estrus cycle or abnormal estrus cycle was counted and shown in Figure 2B. There are 9 out of 10 female mice in the control group that displayed a normal estrus cycle. On the contrary, most mice (7 out of 10) in the HFD group exhibited an irregular estrus cycle. Surprisingly, most HFD-fed female mice supplemented with calcium had a normal estrus cycle (7 out of 10). Furthermore, the duration spent in the different phases of the estrus cycle was analyzed. The results showed that the female mice of HFD group had significantly fewer days in estrus (E) and significantly more days in diestrus (D) than that of female mice in the control group (Figure 2C). However, the HFD-fed female mice supplemented with calcium cycled comparably to the control mice, with significantly more days in E and fewer days in D than that

Table 2. Effect of Calcium Supplementation on Fertility and Pregnancy Outcomea parameter no. of cohabitated females no. of sperm-positive females mating index (%) conception time (days) no. of pregnant females fertility index (%) fecundity index (%) no. of implantations/ mouse

control

HFD

HFD+Ca2+

6

6

6

6

6

6

100(6/6) 2.50 ± 0.58 a

100(6/6) 8.00 ± 1.52 b

100(6/6) 3.16 ± 0.84 a

5 83.33(5/6) 83.33(5/6) 9.40 ± 0.68 a

4 66.67(4/6) 66.67(4/6) 5.25 ± 0.48 b

5 83.33(5/6) 83.33(5/6) 7.20 ± 0.58 a

Data are expressed as the mean ± SEM. Different lowercase letters indicate significant differences among groups (one-way ANOVA, with Tukey’s test, P < 0.05).

a

the mating index of mice in the three groups was 100%, the conception time was considerably different among the three groups. The conception time of HFD-fed female mice was significantly longer than that of control female mice. However, the prolonged conception time of HFD-fed female mice was significantly shortened and almost restored to that of control female mice by calcium supplementation. In addition, the reduction of fertility index and fecundity index induced by HFD was reversed in calcium-supplemented female mice. Moreover, the decrease in the number of implantations induced by HFD was, to a large extent, recovered by calcium supplementation. Hence, these findings indicated that the HFD-induced subfertility of female mice could be ameliorated by calcium supplementation. Calcium Supplementation Improved the Metabolic Abnormality in HFD-Fed Female Mice. To investigate the possible contribution of metabolism to the amelioration of HFD-induced irregular estrus cycle and subfertility by calcium supplementation, we examined the metabolic state of mice in different groups. In the first place, the energy metabolism was assessed by analyzing the locomotor activity of female mice with the open-field test, and detecting the basal/resting metabolic rate of female mice in the CLAMS metabolic chambers. The result of the open-field test demonstrated that the total distance moved of female mice was comparable in the three groups (Figure 3A), suggesting that there is no significant difference of the locomotor activity of mice among these three 7076

DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081

Article

Journal of Agricultural and Food Chemistry

Figure 3. Effect of calcium supplementation on metabolic performance. (A) The open-field experiment reflected locomotor activity. (B) Effect of calcium supplementation on body core temperature. (C−F) Effect of calcium supplementation on O2 consumption and energy expenditure. Different lowercase letters indicate significant differences among groups (one-way ANOVA, with Tukey’s test, P < 0.05).

Figure 4. Effect of calcium supplementation on glucose homeostasis. (A) OGTT was performed in overnight-fasted mice, and the blood glucose concentration was measured. (B) The area under the curve (AUC) of OGTT. (C) ITT was performed in 4 h-fasted mice, and blood glucose was detected. (D) The AUC of ITT. Different lowercase letters indicate significant differences among groups (one-way ANOVA, with Tukey’s test, P < 0.05).

7077

DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081

Article

Journal of Agricultural and Food Chemistry

Figure 5. Effect of calcium supplementation on BAT thermogenesis. (A and B) The BAT skin temperature and its thermogenesis. (C) Effect of calcium on the relative mRNA expression of brown adipocytes marker genes (UCP1, PRDM16, PGC1α, Cidea, and Elovl3). (D and E) Effect of calcium on the relative protein expression of brown adipocytes marker genes (Cyto C, UCP1, PDH, and PGC1α). Different lowercase letters indicate significant differences among groups (one-way ANOVA, with Tukey’s test, P < 0.05).

groups. In contrast, the findings of basal metabolic rate showed that HFD led to a significant decrease in O2 consumption (Figure 3C,D) and heat production (Figure 3E,F) of female mice. More importantly, the HFD-induced reduction of O2 consumption and heat production were almostly recovered by calcium supplementation, suggesting that calcium supplementation was able to elevate whole-body energy expenditure of female mice fed HFD. Accordingly, the calcium supplementation resulted in a higher core/rectal temperature than that of HFD-fed female mice (Figure 3B). Collectively, these data suggested that calcium supplementation enhanced energy expenditure and thermogenesis and increased core temperature in female mice fed HFD. In addition, we examined the effect of calcium supplementation on glucose homeostasis. The result of OGTT demonstrated that calcium-treated mice had significantly lower blood glucose concentrations (Figure 4A) and smaller area under the curve (AUC) (Figure 4B) than that of HFD-fed female mice, indicating the improved glucose tolerance in calcium-supplemented female mice. Meanwhile, the ITT revealed that insulin tolerance was also improved by calcium supplementation, with the lower AUC than that of HFD-fed mice (Figure 4C and D). Taken together, these results indicated that calcium supplementation improved the metabolic abnormality in HFD-fed female mice. Calcium Supplementation Increased BAT Thermogenesis in Female Mice Fed with HFD. Increased body energy expenditure may result from enhanced BAT activity and thermogenesis. Therefore, we explored whether calcium supplementation was able to increase BAT thermogenesis in female mice fed HFD. BAT thermogenesis was assessed by measuring the iBAT temperature using infrared thermography. As shown in Figure 5A and B, iBAT temperature in HFD-fed female mice was similar to that of control female mice at 25 or 4 °C. However, calcium supplementation dramatically increased iBAT thermogenesis, with higher temperature than that of female mice in control and HFD groups. In parallel to

the calcium-stimulated BAT thermogenesis, the mRNA expression of UCP1 and other brown adipocytes marker genes, including PRDM16, PGC1α, Cidea, and Elovl3, was significantly boosted by calcium supplementation in female mice fed HFD (Figure 5C). Moreover, calcium supplementation significantly increased the protein expression of thermogenic genes such as UCP1, PGC1α, PDH, and Cyto C, which were remarkably decreased in HFD-fed female mice (Figure 5D,E). Taken together, these results suggested that calcium supplementation increased BAT thermogenesis through enhancing the expression of thermogenic genes in female mice fed HFD. Calcium Supplementation Stimulated Browning of iWAT in Female Mice Fed with HFD. Browning of WAT also contributes to increase thermogenesis. Thus, we investigated the effect of calcium supplementation on the browning of iWAT. The results of H&E and IHC staining showed that HFD resulted in larger adipocytes size and fewer UCP1 positive staining than that of control female mice. However, as compared to the HFD group, calcium supplementation induced enhanced UCP1 positive staining in iWAT (Figure 6A). In agreement, the UCP1 protein expression in iWAT of calcium- supplementation female mice was significantly higher than that of HFD-fed female mice (Figure 6B,C). In addition, calcium supplementation significantly increased the protein expression of brown adipocytes marker genes such as PGC1α, PDH, and Cyto C in HFD-fed female mice (Figure 6B,C). Collectively, these results provided evidence that calcium supplementation increased the browning of iWAT in HFD-fed female mice.

■

DISCUSSION In this article, we determined that calcium supplementation alleviated HFD-induced estrous cycle irregularity and subfertility, which was associated with concomitantly enhanced thermogenesis of BAT and browning of WAT. Recently, we demonstrated the body weight/fat-lowering effects of calcium 7078

DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081

Article

Journal of Agricultural and Food Chemistry

inflammatory cytokine4 and the decreased BAT thermogenesis24 might also be involved in HFD-induced irregular estrous cycle. On the basis of the antiobesity effects of calcium supplementation on HFD-fed female mice, we wondered whether calcium supplementation could rescue the estrous cycle irregularity and subfertility induced by HFD. Interestingly, our findings revealed that that calcium supplementation could, to a large extent, normalize the abnormal estrous cycle of HFD-fed female mice. In addition, the HFD-induced longer conception time, lower fertility and fecundity index, and less implantations were considerably reversed by calcium supplementation. Furthermore, the decreased serum FSH levels induced by HFD were largely restored to normal/control levels. Taken together, these results highlighted that calcium supplementation could alleviate the irregular estrous cycles and subfertility in the HFD-fed female mice. We further explored the underlying mechanism by which calcium supplementation modulated metabolic and reproductive disorders. Although it has been implicated that enhancement of adipogenesis,37 increase of fat oxidation and fecal fat excretion,51 elevation of adipose tissue apoptosis,44 and gut microbiota38,43 might be involved in calcium induced body weight/fat reduction, the contribution of BAT thermogenesis and WAT browning to calcium-improved metabolic and reproductive disorders remains largely unknown. It was reported that dietary calcium supplementation in adult rats reverted BAT dysfunction programmed by overfeeding.52 In line with previous report, our results demonstrated that calcium supplementation increased iBAT activation/thermogenesis and temperature in HFD-fed female mice, with enhanced mRNA/protein expression of brown adipocyte markers. In addition, BAT transplantation25 and BAT activation53 have been implicated in ameliorating dehydroepiandrosterone (DHEA)-induced acyclicity and infertility. These data highlighted the important role of BAT activation/thermogenesis calcium-improved metabolic and reproductive disorders. Browning of WAT also contributes to increase thermogenesis. Notably, we observed that calcium supplementation increased the browning of iWAT in female mice fed with HFD, along with elevated protein expression of brown adipocyte markers. Accordingly, calcium supplementation led to enhanced whole-body energy metabolism, with increased basal metabolic rate (O2 consumption and heat production) and core temperature. However, calcium supplementation had no effects on locomotor activity of HFD-fed female mice, suggesting that the enhanced whole-body energy metabolism was mainly attributed to BAT activation and WAT browning. Furthermore, it has been indicated that BAT activation and/or WAT browning contribute to improve glucose homeostasis.15,19,30 In agreement, we found that the impaired glucose homeostasis (as in glucose tolerance and insulin tolerance representation) induced by HFD was improved by calcium supplementation. Taken together, these data suggested that calcium supplementation induced alleviation of reproductive disorders such as estrous cycle irregularity and subfertility might be associated with enhanced activation/thermogenesis of BAT and browning of WAT. It should be noted that BAT is a secretory organ and can secret brown adipokines (batokines) to regulate the body’s metabolism.54,55 Thus, in our following studies, the BAT removal or transplantation experiment, and/ or the identification of batokines, which are responsible for the

Figure 6. Effect of calcium supplementation on iWAT thermogenesis. (A) Representative images of H&E staining and UCP1 IHC staining in sections of iWAT of control, HFD, and HFD+Ca2+ mice. Scale bar = 100 μm. (B and C) Effect of calcium on the relative protein expression of brown adipocytes marker genes (Cyto C, UCP1, PDH, and PGC1α). Different lowercase letters indicate significant differences among groups (one-way ANOVA, with Tukey’s test, P < 0.05).

on male mice.37 In agreement with previous results, the present study showed that calcium supplementation reduced body weight, fat content, and WAT mass in female mice fed HFD. Similarly, it has been shown that dietary calcium reduced the body weight/fat gain in the dietary obese mice41,43,44 and human.43,45 In contrast, a recent study demonstrated that increases in dietary calcium from normal requirements did not affect body weight or body composition of rats, but very low amounts of dietary calcium reduced body weight and fat mass.46 In addition, it was reported that increasing dairy calcium intake had no effect on decreasing body weight/fat of adolescent girls.47 The inconsistent effects of calcium on body weight/fat loss might result from the different species/subjects, calcium intake amounts, and calcium intake periods. It should be noted that the water intake was significantly lowered by calcium supplementation in HFD-fed mice, which was similar to the previous report that daily water intake was reduced by calcium supplementation in White Leghorn hens.48 However, the possible underlying mechanisms involved in calciuminduced reduction of water intake need to be further explored. It has been widely appreciated that HFD or obesity always leads to disruption of female fertility,2,49 with irregular estrus cycle,8 compromised ovarian function,3,5 and subfertility.2−4 Similarly, we also found that HFD induced the irregular estrus cycle in female mice, with prolonged time of the cycle. Meanwhile, our results demonstrated that the HFD-fed obese female mice have longer conception time, lower fertility and fecundity index, and less implantations than that of control female mice, verifying that HFD resulted in subfertility in female mice. Irregular estrous is accompanied by altered serum gonadotropin concentration. Accordingly, we observed that the serum level of FSH, a critical gonadotropin involved in estrous cycle, was significantly decreased in HFD-fed female mice. Consistently, it has been reported that overweight women showed lower FSH levels as compared to normal-weight women.50 Besides the lower FSH level, the increased 7079

DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081

Article

Journal of Agricultural and Food Chemistry

(11) Zwick, R. K.; Guerrero-Juarez, C. F.; Horsley, V.; Plikus, M. V. Anatomical, Physiological, and Functional Diversity of Adipose Tissue. Cell Metab. 2018, 27 (1), 68−83. (12) Coelho, M.; Oliveira, T.; Fernandes, R. Biochemistry of adipose tissue: an endocrine organ. Arch. Med. Sci. 2013, 9 (2), 191−200. (13) Rosen, E. D.; Spiegelman, B. M. What we talk about when we talk about fat. Cell 2014, 156 (1−2), 20−44. (14) Inagaki, T.; Sakai, J.; Kajimura, S. Transcriptional and epigenetic control of brown and beige adipose cell fate and function. Nat. Rev. Mol. Cell Biol. 2017, 18 (8), 527. (15) Kaisanlahti, A.; Glumoff, T. Browning of white fat: agents and implications for beige adipose tissue to type 2 diabetes. J. Physiol. Biochem. 2019, 75, 1. (16) Ikeda, K.; Maretich, P.; Kajimura, S. The Common and Distinct Features of Brown and Beige Adipocytes. Trends Endocrinol. Metab. 2018, 29 (3), 191−200. (17) Wu, J.; Bostrom, P.; Sparks, L. M.; Ye, L.; Choi, J. H.; Giang, A. H.; Khandekar, M.; Virtanen, K. A.; Nuutila, P.; Schaart, G.; Huang, K.; Tu, H.; van Marken Lichtenbelt, W. D.; Hoeks, J.; Enerback, S.; Schrauwen, P.; Spiegelman, B. M. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 2012, 150 (2), 366−76. (18) Moonen, M. P. B.; Nascimento, E. B. M.; van Marken Lichtenbelt, W. D. Human brown adipose tissue: Underestimated target in metabolic disease? Biochim. Biophys. Acta, Mol. Cell Biol. Lipids 2019, 1864 (1), 104−112. (19) Symonds, M. E.; Aldiss, P.; Pope, M.; Budge, H. Recent advances in our understanding of brown and beige adipose tissue: the good fat that keeps you healthy. F1000Research 2018, 7, 1129. (20) Soler-Vazquez, M. C.; Mera, P.; Zagmutt, S.; Serra, D.; Herrero, L. New approaches targeting brown adipose tissue transplantation as a therapy in obesity. Biochem. Pharmacol. 2018, 155, 346−355. (21) Thyagarajan, B.; Foster, M. T. Beiging of white adipose tissue as a therapeutic strategy for weight loss in humans. Hormone molecular biology and clinical investigation 2017, 31 (2), 1 DOI: 10.1515/hmbci2017-0016. (22) Symonds, M. E.; Aldiss, P.; Dellschaft, N.; Law, J.; Fainberg, H. P.; Pope, M.; Sacks, H.; Budge, H. Brown adipose tissue development and function and its impact on reproduction. J. Endocrinol. 2018, 238 (1), R53−R62. (23) Shorakae, S.; Jona, E.; de Courten, B.; Lambert, G. W.; Lambert, E. A.; Phillips, S. E.; Clarke, I. J.; Teede, H. J.; Henry, B. A. Brown adipose tissue thermogenesis in polycystic ovary syndrome. Clin. Endocrinol. 2018, 1 DOI: 10.1111/cen.13913. (24) Yuan, X.; Wei, G.; You, Y.; Huang, Y.; Lee, H. J.; Dong, M.; Lin, J.; Hu, T.; Zhang, H.; Zhang, C.; Zhou, H.; Ye, R.; Qi, X.; Zhai, B.; Huang, W.; Liu, S.; Xie, W.; Liu, Q.; Liu, X.; Cui, C.; Li, D.; Zhan, J.; Cheng, J.; Yuan, Z.; Jin, W. Rutin ameliorates obesity through brown fat activation. FASEB J. 2017, 31 (1), 333−345. (25) Yuan, X.; Hu, T.; Zhao, H.; Huang, Y.; Ye, R.; Lin, J.; Zhang, C.; Zhang, H.; Wei, G.; Zhou, H.; Dong, M.; Zhao, J.; Wang, H.; Liu, Q.; Lee, H. J.; Jin, W.; Chen, Z. J. Brown adipose tissue transplantation ameliorates polycystic ovary syndrome. Proc. Natl. Acad. Sci. U. S. A. 2016, 113 (10), 2708−13. (26) Wang, W.; Seale, P. Control of brown and beige fat development. Nat. Rev. Mol. Cell Biol. 2016, 17 (11), 691−702. (27) Song, N. J.; Chang, S. H.; Li, D. Y.; Villanueva, C. J.; Park, K. W. Induction of thermogenic adipocytes: molecular targets and thermogenic small molecules. Exp. Mol. Med. 2017, 49 (7), e353. (28) Wang, S.; Liang, X.; Yang, Q.; Fu, X.; Zhu, M.; Rodgers, B. D.; Jiang, Q.; Dodson, M. V.; Du, M. Resveratrol enhances brown adipocyte formation and function by activating AMP-activated protein kinase (AMPK) alpha1 in mice fed high-fat diet. Mol. Nutr. Food Res. 2017, 61 (4), 1600746. (29) Wang, S.; Liang, X.; Yang, Q.; Fu, X.; Rogers, C. J.; Zhu, M.; Rodgers, B. D.; Jiang, Q.; Dodson, M. V.; Du, M. Resveratrol induces brown-like adipocyte formation in white fat through activation of AMP-activated protein kinase (AMPK) alpha1. Int. J. Obes. 2015, 39 (6), 967−76.

role of BAT in calcium-alleviated irregular cycles, should be further conduced to elucidate the direct association between BAT activation and calcium-improved phenotypes. In conclusion, our results showed that calcium supplementation reduced body weight and body fat content, and alleviated estrus cycle irregularity and subfertility of HFD-fed female mice. In addition, calcium supplementation enhanced BAT activation/thermogenesis and iWAT browning along with the higher core temperature and metabolic rates. These data provided evidence that calcium supplementation alleviated HFD-induced estrous cycle irregularity and subfertility associated with concomitantly enhanced BAT thermogenesis and WAT browning, suggesting the potential use of calcium in contacting HFD-induced obesity and improving obesityrelated reproductive disorders.

■

AUTHOR INFORMATION

Corresponding Author

*Tel./fax: +862085284901. E-mail: [email protected]. ORCID

Songbo Wang: 0000-0001-9190-9401 Funding

This work was supported by the National Natural Science Foundation of China (31790411, 31672508, 31372397), the National Key Research and Development Program of China (2016YFD0500503, 2017YFD0500501), the Guangdong special support program (2014TQ01N260), and the Innovation team project in universities of Guangdong Province (2017KCXTD002). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Arroyo-Johnson, C.; Mincey, K. D. Obesity Epidemiology Worldwide. Gastroenterology clinics of North America 2016, 45 (4), 571−579. (2) Silvestris, E.; de Pergola, G.; Rosania, R.; Loverro, G. Obesity as disruptor of the female fertility. Reprod. Biol. Endocrinol. 2018, 16 (1), 22. (3) Skaznik-Wikiel, M. E.; Swindle, D. C.; Allshouse, A. A.; Polotsky, A. J.; McManaman, J. L. High-Fat Diet Causes Subfertility and Compromised Ovarian Function Independent of Obesity in Mice. Biol. Reprod. 2016, 94 (5), 108. (4) Skaznik-Wikiel, M. E.; Polotsky, A. J.; McManaman, J. L. Highfat diet causes compromised fertility and increased pro-inflammatory cytokines independent of obesity. Fertil. Steril. 2015, 104 (3), e104. (5) Bazzano, M. V.; Paz, D. A.; Elia, E. M. Obesity alters the ovarian glucidic homeostasis disrupting the reproductive outcome of female rats. J. Nutr. Biochem. 2017, 42, 194−202. (6) Naderpoor, N.; Shorakae, S.; Joham, A.; Boyle, J.; De Courten, B.; Teede, H. J. Obesity and polycystic ovary syndrome. Minerva Endocrinol. 2015, 40, 37−51. (7) Moran, L. J.; Norman, R. J.; Teede, H. J. Metabolic risk in PCOS: phenotype and adiposity impact. Trends Endocrinol. Metab. 2015, 26 (3), 136−43. (8) Ngadjui, E.; Nkeng-Efouet, P. A.; Nguelefack, T. B.; Kamanyi, A.; Watcho, P. High fat diet-induced estrus cycle disruption: effects of Ficus asperifolia. J. Complementary Integr. Med. 2015, 12 (3), 205−15. (9) Leitch, H. G.; Hajkova, P. Eggs sense high-fat diet. Nat. Genet. 2018, 50 (3), 318−319. (10) Gu, L.; Liu, H.; Gu, X.; Boots, C.; Moley, K. H.; Wang, Q. Metabolic control of oocyte development: linking maternal nutrition and reproductive outcomes. Cell. Mol. Life Sci. 2015, 72 (2), 251−71. 7080

DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081

Article

Journal of Agricultural and Food Chemistry (30) Zhang, F.; Ai, W.; Hu, X.; Meng, Y.; Yuan, C.; Su, H.; Wang, L.; Zhu, X.; Gao, P.; Shu, G. Phytol stimulates the browning of white adipocytes through the activation of AMP-activated protein kinase (AMPK) alpha in mice fed high-fat diet. Food Funct. 2018, 9 (4), 2043−2050. (31) Wang, J.; Hu, X.; Ai, W.; Zhang, F.; Yang, K.; Wang, L.; Zhu, X.; Gao, P.; Shu, G.; Jiang, Q.; Wang, S. Phytol increases adipocyte number and glucose tolerance through activation of PI3K/Akt signaling pathway in mice fed high-fat and high-fructose diet. Biochem. Biophys. Res. Commun. 2017, 489 (4), 432−438. (32) Wang, B.; Fu, X.; Liang, X.; Deavila, J. M.; Wang, Z.; Zhao, L.; Tian, Q.; Zhao, J.; Gomez, N. A.; Trombetta, S. C.; Zhu, M. J.; Du, M. Retinoic acid induces white adipose tissue browning by increasing adipose vascularity and inducing beige adipogenesis of PDGFRalpha(+) adipose progenitors. Cell Discovery 2017, 3, 17036. (33) Ye, J.; Ai, W.; Zhang, F.; Zhu, X.; Shu, G.; Wang, L.; Gao, P.; Xi, Q.; Zhang, Y.; Jiang, Q.; Wang, S. Enhanced Proliferation of Porcine Bone Marrow Mesenchymal Stem Cells Induced by Extracellular Calcium is Associated with the Activation of the Calcium-Sensing Receptor and ERK Signaling Pathway. Stem Cells Int. 2016, 2016, 6570671. (34) Goudarzi, F.; Mohammadalipour, A.; Khodadadi, I.; Karimi, S.; Mostoli, R.; Bahabadi, M.; Goodarzi, M. T. The Role of Calcium in Differentiation of Human Adipose-Derived Stem Cells to Adipocytes. Mol. Biotechnol. 2018, 60 (4), 279−289. (35) Pramme-Steinwachs, I.; Jastroch, M.; Ussar, S. Extracellular calcium modulates brown adipocyte differentiation and identity. Sci. Rep. 2017, 7 (1), 8888. (36) Aquino-Martinez, R.; Artigas, N.; Gamez, B.; Rosa, J. L.; Ventura, F. Extracellular calcium promotes bone formation from bone marrow mesenchymal stem cells by amplifying the effects of BMP-2 on SMAD signalling. PLoS One 2017, 12 (5), e0178158. (37) Zhang, F.; Ye, J.; Meng, Y.; Ai, W.; Su, H.; Zheng, J.; Liu, F.; Zhu, X.; Wang, L.; Gao, P.; Shu, G.; Jiang, Q.; Wang, S. Calcium Supplementation Enhanced Adipogenesis and Improved Glucose Homeostasis Through Activation of Camkii and PI3K/Akt Signaling Pathway in Porcine Bone Marrow Mesenchymal Stem Cells (pBMSCs) and Mice Fed High Fat Diet (HFD). Cell. Physiol. Biochem. 2018, 51 (1), 154−172. (38) Gomes, J. M.; Costa, J. A.; Alfenas, R. C. Could the beneficial effects of dietary calcium on obesity and diabetes control be mediated by changes in intestinal microbiota and integrity? Br. J. Nutr. 2015, 114 (11), 1756−65. (39) Gomes, J. M. G.; Costa, J. d. A.; Alfenas, R. d. C. G. Dietary calcium from dairy, body composition and glycaemic control in patients with type 2 diabetes pursuing an energy restricted diet: A parallel group randomised clinical trial. Int. Dairy J. 2017, 73, 50−56. (40) Thomas, A. P.; Dunn, T. N.; Drayton, J. B.; Oort, P. J.; Adams, S. H. A dairy-based high calcium diet improves glucose homeostasis and reduces steatosis in the context of preexisting obesity. Obesity 2013, 21 (3), E229−35. (41) Sun, C.; Wang, L.; Yan, J.; Liu, S. Calcium ameliorates obesity induced by high-fat diet and its potential correlation with p38 MAPK pathway. Mol. Biol. Rep. 2012, 39 (2), 1755−63. (42) Wu, J.; Zhu, C.; Yang, L.; Wang, Z.; Wang, L.; Wang, S.; Gao, P.; Zhang, Y.; Jiang, Q.; Zhu, X.; Shu, G. N-Oleoylglycine-Induced Hyperphagia Is Associated with the Activation of Agouti-Related Protein (AgRP) Neuron by Cannabinoid Receptor Type 1 (CB1R). J. Agric. Food Chem. 2017, 65 (5), 1051−1057. (43) Chaplin, A.; Parra, P.; Laraichi, S.; Serra, F.; Palou, A. Calcium supplementation modulates gut microbiota in a prebiotic manner in dietary obese mice. Mol. Nutr. Food Res. 2016, 60 (2), 468−80. (44) Sergeev, I. N.; Song, Q. High vitamin D and calcium intakes reduce diet-induced obesity in mice by increasing adipose tissue apoptosis. Mol. Nutr. Food Res. 2014, 58 (6), 1342−8. (45) Aguilera Eguia, R.; Jorquera Pino, P. J.; Salgado, C. J.; Flores, C. Calcium supplementation for reducing weight in people with obesity; an overview of systematic reviews. Nutr. Hosp. 2016, 33, 590.

(46) Alomaim, H.; Griffin, P.; Swist, E.; Plouffe, L. J.; Vandeloo, M.; Demonty, I.; Kumar, A.; Bertinato, J. Dietary calcium affects body composition and lipid metabolism in rats. PLoS One 2019, 14 (1), e0210760. (47) Lappe, J. M.; McMahon, D. J.; Laughlin, A.; Hanson, C.; Desmangles, J. C.; Begley, M.; Schwartz, M. The effect of increasing dairy calcium intake of adolescent girls on changes in body fat and weight. Am. J. Clin. Nutr. 2017, 105 (5), 1046−1053. (48) Damron, B. L.; Flunker, L. K. Calcium supplementation of hen drinking water. Poult. Sci. 1995, 74 (5), 784−7. (49) Hohos, N. M.; Skaznik-Wikiel, M. E. High-Fat Diet and Female Fertility. Endocrinology 2017, 158 (8), 2407−2419. (50) De Pergola, G.; Maldera, S.; Tartagni, M.; Pannacciulli, N.; Loverro, G.; Giorgino, R. Inhibitory effect of obesity on gonadotropin, estradiol, and inhibin B levels in fertile women. Obesity 2006, 14 (11), 1954−60. (51) Soares, M. J.; Pathak, K.; Calton, E. K. Calcium and vitamin D in the regulation of energy balance: where do we stand? Int. J. Mol. Sci. 2014, 15 (3), 4938−45. (52) Conceicao, E. P. S.; Moura, E. G.; Oliveira, E.; Guarda, D. S.; Figueiredo, M. S.; Quitete, F. T.; Calvino, C.; Miranda, R. A.; Mathias, P. C. F.; Manhaes, A. C.; Lisboa, P. C. Dietary calcium supplementation in adult rats reverts brown adipose tissue dysfunction programmed by postnatal early overfeeding. J. Nutr. Biochem. 2017, 39, 117−125. (53) Hu, T.; Yuan, X.; Ye, R.; Zhou, H.; Lin, J.; Zhang, C.; Zhang, H.; Wei, G.; Dong, M.; Huang, Y.; Lim, W.; Liu, Q.; Lee, H. J.; Jin, W. Brown adipose tissue activation by rutin ameliorates polycystic ovary syndrome in rat. J. Nutr. Biochem. 2017, 47, 21−28. (54) Villarroya, F.; Cereijo, R.; Villarroya, J.; Giralt, M. Brown adipose tissue as a secretory organ. Nat. Rev. Endocrinol. 2017, 13 (1), 26−35. (55) Villarroya, F.; Gavalda-Navarro, A.; Peyrou, M.; Villarroya, J.; Giralt, M. The Lives and Times of Brown Adipokines. Trends Endocrinol. Metab. 2017, 28 (12), 855−867.

7081

DOI: 10.1021/acs.jafc.9b02663 J. Agric. Food Chem. 2019, 67, 7073−7081