Carnosic Acid Prevents 6-Hydroxydopamine ... - ACS Publications

CA (purity 91%), 6-OHDA, l-buthionine sulfoximine (BSO), sodium bicarbonate, sodium pyruvate, dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazol-2-yl)-...
0 downloads 0 Views 396KB Size
Download PDF
Article pubs.acs.org/crt

Carnosic Acid Prevents 6‑Hydroxydopamine-Induced Cell Death in SH-SY5Y Cells via Mediation of Glutathione Synthesis Jing-Hsien Chen,†,# Hsin-Ping Ou,‡ Chia-Yuan Lin,§ Fung-Ju Lin,§ Chi-Rei Wu,∥ Shu-Wei Chang,⊥,# and Chia-Wen Tsai*,§ †

Department of Nutrition, Chung Shan Medical University, Taichung, Taiwan Department of Health Food, Chung Chou University of Science and Technology, Changua, Taiwan § Department of Nutrition, China Medical University, Taichung, Taiwan ∥ The School of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, College of Pharmacy, China Medical University, Taichung, Taiwan ⊥ Department of Medicinal Botanicals and Health Care, Dayeh University, Changhua, Taiwan ‡

S Supporting Information *

ABSTRACT: Understanding the neuroprotective effects of the rosemary phenolic diterpene carnosic acid (CA) has attracted increasing attention. We explored the mechanism by which CA modulates the neurotoxic effects of 6-hydroxydopamine (6-OHDA) in SH-SY5Y cells. Cells were pretreated with CA for 12 h followed by treatment with 100 μM 6-OHDA for 12 or 24 h. Cell viability determined by the 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolim bromide (MTT) assay indicated that 0.1 to 1 μM CA dose-dependently attenuated the cell death induced by 6-OHDA, whereas the effect of 3−5 μM CA was weaker. CA at 1 μM suppressed the 6-OHDA-induced nuclear condensation, reactive oxygen species generation, and cleavage of caspase 3 and PARP. Immunoblots showed that the phosphorylation of c-Jun NH2-terminal kinase (JNK) and p38 by 6-OHDA was reduced in the presence of CA. Incubation of cells with CA resulted in significant increases in the total glutathione (GSH) level and the protein expression of the γ-glutamylcysteine ligase catalytic subunit and modifier subunit. L-Buthionine-sulfoximine, an inhibitor of GSH synthesis, attenuated the effect of CA on cell death and apoptosis. Treatment with CA also led to an increase in nuclear factor erythroid-2 related factor 2 (Nrf2) activation, antioxidant response element (ARE)-luciferase reporter activity, and DNA binding to the ARE. Silencing of Nrf2 expression alleviated the reversal of p38 and JNK1/2 activation by CA. These results suggest that the attenuation of 6-OHDAinduced apoptosis by CA is associated with the Nrf2-driven synthesis of GSH, which in turn down-regulates the JNK and p38 signaling pathways. The CA compound may be a promising candidate for neuroprotection in Parkinson’s disease.

■

INTRODUCTION Parkinson’s disease (PD) is a neurodegenerative disorder with a selective loss of dopaminergic neurons in the substantia nigra (SN).1,2 Recent studies have suggested that reactive oxygen species (ROS) may play an important role in the dopaminergic neuronal cell death in PD.3,4 Excessive ROS production or low antioxidant levels lead to damage to cellular proteins, lipids, and DNA. The dopaminergic neurons are more susceptible to oxidative damage because of the auto-oxidation and enzymatic oxidation of dopamine.5 Human post-mortem analysis has revealed increased lipid peroxidation and iron levels along with decreased glutathione levels in the SN of PD patients.6,7 Therefore, modulation of intracellular ROS may provide a new approach in the prevention and treatment of PD. 6-Hydroxydopamine (6-OHDA), a potent neurotoxin, causes injury to dopaminergic neurons in animal and cell models of PD. Several studies have suggested that 6-OHDA generates excessive ROS and promotes mitochondrial dysfunction.8−10 © 2012 American Chemical Society

The mitogen-activated protein kinase (MAPK) signal pathways mediated by the generated ROS are thought to play a critical role in apoptotic neuronal cell death. Exposure of SH-SY5Y neuroblastoma cells to 6-OHDA results in increased phosphorylated c-Jun N-terminal kinase (JNK) and p38 associated with the release of cytochrome c and activation of caspase 3.11,12 Inhibition of the JNK and p38 pathways has been shown to block cell death and the cleavage of caspases. Activation of the JNK and p38 pathways is also observed in dopaminergic neurons from post-mortem PD brains.13 Glutathione (GSH) is an important antioxidant and redox modulator that is present in neurons and astrocytes.14,15 GSH plays an important role in protecting cells from the toxic effects of ROS and participates in detoxification.16,17 Many studies have indicated that GSH depletion leads to oxidative stress, Received: April 17, 2012 Published: August 15, 2012 1893

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901

Chemical Research in Toxicology

Article

passages 7 and 13 were used. SH-SY5Y cells were plated on 35-mm plastic tissue culture dishes (Corning, NY) at a density of 1.2 × 106 cells per dish or on 60-mm plastic tissue culture dishes at a density of 2.5 × 106 cells per dish, and the dishes were incubated until 80% confluence was reached. SH-SY5Y cells were incubated with 0.1, 0.5, 1, 3, or 5 μM of CA for 12 h and were then treated with 100 μM 6OHDA for the indicated times. Cells treated with 0.3% DMSO alone were used as controls. Cell Viability Assay. SH-SY5Y cells were treated with various concentrations of CA for 12 h and were then treated with 100 μM 6OHDA for an additional 24 h. Briefly, the SH-SY5Y cells were washed with phosphate-buffered saline and incubated with MTT (5 mg/mL) in DMEM medium at 37 °C for 2 h. After the medium was removed, the formazan crystals were dissolved with isopropanol. Absorbance was measured at 570 nm by use of an ELISA reader (Bio Rad, Japan). The value in the control cells was considered to represent 100% viability. Nuclear Staining with Hoechst 33258. SH-SY5Y cells were incubated with different concentrations of CA for 12 h and were then treated with 100 μM 6-OHDA for 18 h. After being washed with phosphate-buffered saline, cells were fixed with 3.7% paraformaldehyde (pH 7.4) solution for 50 min and stained with 5 μg/mL of Hoechst 33258 for 1 h at 25 °C in the dark. Morphological changes were observed by using a fluorescence microscope. The fluorescenc intensity of Hoechst 33258 was analyzed using Image-Pro Plus 6.0 (Media Cybernetics, Inc., Bethesda, MD). Annexin V and propidium iodide (PI) staining. The Annexin V-FITC apoptosis detection kit (Becton Dickinson, San Diego, CA) was used according to the manufacturer’s instructions. Following treatment, cells were harvested by trypsinization and washed with warm phosphate-buffered saline, centrifuged at 1,500g for 5 min at 25 °C, and resuspended in 100 μL of 1× binding buffer (10 mM HEPES/ NaOH (pH 7.4), 140 mM NaCl, and 2.5 mM CaCl2). Then AnnexinV FITC and PI were added for 15 min in the dark and finally 400 μL of 1× binding buffer was added. Samples were then immediately analyzed by use of a flow cytometer (Becton Dickinson, Heidelberg, Germany). Acquisition gates of the cells and a minimum of 10,000 events were collected for each sample. Western Blot Analysis. SH-SY5Y cells were washed with cold phosphate-buffered saline and were then harvested in lysis buffer (25 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 2 mM EDTA, 1 mM PMSF, 1 μg/mL leupeptin, 1 μg/mL aprotinin, and phosphatase inhibitor). Lysates were centrifuged at 14,000g for 20 min at 4 °C. Protein concentrations were measured with a Coomassie plus protein assay reagent kit (Pierce, Rockford, IL). Twelve micrograms of protein from each sample was applied to 12.5% or 7.5% SDS−PAGE gels and was electrophoretically transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA). The nonspecific binding sites on the membranes were blocked at 4 °C overnight with 50 g/L nonfat dry milk in 25 mM Tris/150 mM NaCl buffer, pH 7.4. The blots were then incubated with primary antibodies against caspase 3, cleaved caspase 3, PARP, cleaved PARP, β-tubulin, β-actin, GCLC, GCLM, Nrf2, JNK, p38, phospho-JNK, or phospho-p38 overnight at 4 °C and were subsequently incubated with horseradish peroxidase-conjugated goat antirabbit or goat antimouse IgG. The bands were detected by using an enhanced chemiluminescence kit. ROS Production. Measurement of intracellular ROS production was made by using the peroxide-sensitive fluorescent probe DCF-DA. Cells were treated with different concentrations of CA for 12 h and were then treated with 100 μM 6-OHDA for an additional 0.5 h. DCFDA (10 μM) was added to the cells after exposure to 6-OHDA for 10 min. The cells were then washed twice with phosphate-buffered saline and visualized with a confocal microscope (Leica TCS SP2, Germany). Measurement of GSH levels. Total glutathione was measured by using a glutathione assay kit (Cayman Chemical Co., Ann Arbor, MI, USA) according to the manufacturer’s instructions. Cells were washed twice with cold phosphate-buffered saline followed by scraping from the dishes with 300 μL MES buffer (0.4 M 2-(N-morpholino)ethanesulponic acid, 0.1 M phosphate, and 2 mM EDTA, pH 6.0). The

inhibition of mitochondrial complex I, ubiquitin-proteasome dysfunction, and ultimately neuronal cell death.18,19 A lower GSH content is present in the SN of PD patients, and the degree of PD severity is correlated with the GSH loss.20 γGlutamylcysteine ligase (γ-GCL, also known as γ-glutamylcysteine synthetase) is the rate-limiting enzyme for GSH synthesis. The γ-GCL enzyme is composed of a GCL catalytic subunit (GCLC) and a GCL modifier subunit (GCLM).21 Induction of γ-GCL expression is associated with an increase in nuclear factor erythroid-2 related factor (Nrf2) binding to the antioxidant responsive element (ARE).22,23 In vivo and in vitro studies have indicated that the Nrf2-ARE activation is associated with neuroprotective effects.24 Numerous bioactive plant compounds, such as phenolic phytochemicals, are associated with a lower risk of neurodegenerative disorders.25,26 Carnosic acid (CA), a rosemary (Rosmarinus of f icinalis) phenolic diterpene, has multiple biological properties, such as antiinflammatory, antioxidative, neuroprotective, and anticarcinogenic activities.27−29 Additional studies have shown that CA inhibits lipid peroxidation30 and protects red cells against oxidative hemolysis.31 Recently, interest has been growing in the physiologic properties of CA, not only because of its action in antioxidation but also because of its possible neuroprotective effects. Park et al. indicated that CA attenuates dieldrin-induced apoptotic molecules and down-regulates the production of brain-derived neurotrophic factor.32 Moreover, CA protects cortical neurons from glutamate and the brain from middle cerebral artery occlusion/reperfusion injury.29 Although CA is an excellent candidate for treatment of neurodegenerative disorders, its protection of 6-OHDA-induced neurotoxicity remains unclear. Therefore, we examined the protective mechanisms of CA on 6-OHDA-induced apoptosis in SH-SY5Y neuronal cells.

■

MATERIALS AND METHODS

Materials. CA (purity 91%), 6-OHDA, L-buthionine sulfoximine (BSO), sodium bicarbonate, sodium pyruvate, dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolim bromide (MTT), Hoechst 33258 stain solution, triton X-100, Tween 20, βtubulin, β-actin, and N-acetylcysteine (NAC) were purchased from Sigma Chemical Company (St. Louis, MO). DMEM medium, Lglutamine, nonessential amino acids, trypsin-EDTA, and penicillin− streptomycin solution were obtained from Gibco Laboratory (Gaithersburg, MD). FBS was from Hyclone (Logan, UT). Caspase 3, cleaved caspase 3, PARP, and cleaved PARP antibody were purchased from Cell Signaling Technology (Beverly, MA). GCLC was purchased from Abcam (Cambridge, UK). GCLM, Nrf2, JNK, p38, phospho-JNK, and phospho-p38 were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Goat antirabbit IgG, goat antimouse IgG, and enhanced chemiluminescence kits were purchased from Perkin-Elmer Life Science (Boston, MA). 2,7-Dichlorodihydrofluorescein diacetate (DCF-DA) was purchased from Molecular Probes Inc. (Eugene, OR). Isopropanol and paraformaldehyde were obtained from Merck Chemical Company (Germany). Glycine, acrylamide, and Tris were from United Sates Biological (Swampscott, MA). Cell Culture and Treatment. The human dopaminergic neuron cell line SH-SY5Y was obtained from American Type Culture Collection (ATCC, Manassas, VA). The cells are derived from human neuroblastoma and possess many characteristics of substantia nigra neurons. This cell line has been used extensively to study the death of dopaminergic neurons.33−35 The cells were grown in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 1.5 g/L sodium bicarbonate, 0.1 mM nonessential amino acids, 1.0 mM sodium pyruvate, 1 × 105 unit/L penicillin, and 100 mg/L streptomycin at 37 °C under a humidified atmosphere of 95% air and 5% CO2. CA and 6OHDA were dissolved in DMSO. For all studies, cells between 1894

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901

Chemical Research in Toxicology

Article

supernatant was centrifuged at 10000 g for 15 min at 4 °C. Absorbance was detected at 405 nm by using a microplate reader (Bio Rad, Japan). Plasmids, transfection, and luciferase assays. SH-SY5Y cells were plated at a density of 1.2 × 106 cells on 35-mm plastic tissue culture dishes, and the dishes were incubated until 70% confluence was reached. A p2xARE/Luc fragment containing tandem repeats of double-stranded oligonucleotides spanning the Nrf2 binding site, 5′TGACTCAGCA-3′, as previously described by Kataoka et al.,36 was introduced into the pGL3 promoter plasmid (Promega, Madison, WI). Cells were transfected for 5 h with 0.2 μg of the p2xARE/Luc vectors and 0.2 μg of β-galactosidase plasmid by using nanofectin reagent (PAA, Austria) in OPTI-MEM medium. After transfection, cells were changed to DMEM medium and treated with CA for 12 h. Cells were then washed twice with cold PBS, scraped with lysis buffer (Promega, Madison, WI), and centrifuged at 14000g for 5 min. The supernatant was collected for the measurement of luciferase and β-galactosidase by using a Luciferase Assay Kit (Promega, Madison, WI) according to the manufacturer’s instructions. The luciferase activity of each sample was corrected on the basis of β-galactosidase activity, which was measured at 420 nm with O-nitrophenyl-β-D-galactopyranoside as a substrate. The value of cells in the control was set at 1. Transient Transfection of Small RNA Interference. Cells were plated on 35-mm plastic tissue culture dishes at a density of 1.2 × 106 cells per dish. When 70% to 80% confluence was reached, for Nrf2 siRNA transfection, the cells were transfected with Nrf2 siRNA (75 nM) or nontargeting control siRNA by using the DharmaFECT siRNA transfection reagent according to the manufacturer’s instructions (all from Thermo Fisher Scientific, Lafayette, CO) for 24 h. The sense sequences of these Nrf2 siRNA were as follows: (1) 5′-UAAAGUGGCUGCUCAGAAU-3′, (2) 5′-GAGUUACAGUGUCUUAAUA-3′, (3) 5′-UGGAGUAAGUCGAGAAGUA-3′, and (4) 5′-CACCUUAUAUCUCGAAGUU-3′. The cells were pretreated with 1 μM CA for 12 h and then treated with 100 μM 6-OHDA for 1 h. The activation of Nrf2 was measured by Western blotting. For phosphorylation of JNK1/2 and p38, CA was added to the medium for 12 h, followed by exposure to 6-OHDA for an additional 3 h. Preparation of Nuclear Extract. SH-SY5Y cells were treated with CA for 1, 3, 6, or 9 h and were then washed twice with cold PBS followed by scraping from the dishes with PBS. Cell homogenates were centrifuged at 2000g for 5 min. The supernatant was discarded, and the cell pellet was allowed to swell on ice for 15 min after the addition of 200 μL of hypotonic buffer containing 10 mmol/L HEPES, 10 mmol/L KCl, 1 mmol/L MgCl2, 1 mmol/L EDTA, 0.5 mmol/L DTT, 4 μg/mL leupeptin, 20 μg/mL aprotinin, 0.5% Nonidet P-40, and 0.2 mmol/L phenylmethylsulfonyl fluoride. After centrifugation at 6000g for 15 min, pellets containing crude nuclei were resuspended in 50 μL of hypertonic buffer containing 10 mmol/L HEPES, 400 mmol/ L KCl, 1 mmol/L MgCl2, 1 mmol/L EDTA, 0.5 mmol/L DTT, 4 μg/ mL leupeptin, 20 μg/mL aprotinin, 10% glycerol, and 0.2 mmol/L phenylmethylsulfonyl fluoride and incubated for an additional 30 min. The nuclear extracts were then obtained by centrifugation at 10000g for 15 min and were frozen at −80 °C. Electromobility Gel Shift Assay. The Light-Shift Chemiluminescent electromobility gel shift assay (EMSA) kit (Pierce Chemical Company, Rockford, IL) and synthetic biotin-labeled double-stranded human GCLC ARE oligonucleotide (forward, 5′GCGCGCGCACCGCCTCCCCGTGACTCAGCGCTTTGTGCG3′; reverse, 5′-CGCACAAAGCGCTGAGTCACGGGGAGGCGGTGCGCGCGC-3′) were used to measure whether CA modified the binding activity of the ARE with nuclear proteins. Unlabeled double-stranded ARE (200 ng) was used to confirm specific binding. Five micrograms of nuclear protein, poly(dI-dC), and biotinlabeled double-stranded ARE oligonucleotide were mixed with the binding buffer to a final volume of 20 μL and were incubated at room temperature for 30 min. The nuclear protein−DNA complex was separated by electrophoresis on a 6% Tris-boric acid−EDTA− polyacrylamide gel and was then electrotransferred to a Hybond-N+ nylon membrane (GE Healthcare, Buckinghamshire, UK). The membrane was treated with streptavidin-horseradish peroxidase, and

the nuclear protein−DNA bands were developed by using an enhanced chemiluminescence kit. Statistical Analysis. Statistical analysis was performed with commercially available software (SAS Institute Inc., Cary, NC). Statistical significance was made by one-way ANOVA followed by Tukey’s post hoc test. Values of P < 0.05 were considered statistically significant.

■

RESULTS Neuroprotective Effects of CA in SH-SY5Y Cells. A cell viability assay, performed by the MTT method, showed that CA at concentrations up to 10 μM was not toxic to SH-SY5Y cells (data not shown). Treatment with 100 μM 6-OHDA decreased the viability of cells by 47% (Figure 1A). To examine

Figure 1. Protective effect of carnosic acid (CA) against 6hydroxydopamine (6-OHDA)-induced toxicity in SH-SY5Y cells. (A) Cell viability was measured by the 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolim bromide (MTT) assay. Cells were pretreated with 0.1, 0.5, 1, 3, or 5 μM CA for 12 h and were then treated with 100 μM 6-OHDA for an additional 24 h. (B) Nuclei were visualized with Hoechst 33258 staining. Nuclear morphology was visualized by a fluorescence microscope (200×). Cells were pretreated with 0.5, 1, and 3 μM CA for 12 h and were then treated with 100 μM 6-OHDA for 18 h. Arrows indicate apoptotic cells. One representative image out of three independent experiments is shown.

whether CA had a neuroprotective effect against 6-OHDAinduced cell death, SH-SY5Y cells were pretreated with 0.1, 0.5, 1, 3, and 5 μM CA for 12 h and were then exposed to 100 μM 6-OHDA for 24 h. The results showed that CA in concentrations from 0.1 to 1 μM dose-dependently attenuated the 6-OHDA-induced cell death, whereas the effect of CA began to decrease at concentrations above 3 μM. Pretreatment with 1 μM CA increased the percentage of viable cells to about 45%, as compared with that of the 6-OHDA-treated group. The IC50 value of 6-OHDA for cell viability in the absence and presence of 1 μM CA was approximately 100 μM and 186 μM, respectively (see Figure S1 in Supporting Information). 1895

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901

Chemical Research in Toxicology

Article

inhibited 6-OHDA-induced apoptosis. CA at 1 μM decreased the apoptotic population by 34% compared with that of the 6OHDA-treated group. Reduction of ROS Generation by CA. The antioxidant activity of CA was further evaluated by using the fluorescent dye DCF-DA. These results indicated that 6-OHDA caused a 2.3-fold increase in ROS formation compared with that in the control cells (Figure 3). Pretreatment of cells with CA at a

Moreover, treatment cells with 4 mM MPP+ for 24 h decreased the viability of cells by 38%. Pretreatment with 1 μM CA increased the percentage of viable cells to about 32%, as compared with that of the MPP+-treated group (see Figure S2 in Supporting Information). Phase-contrast imaging revealed morphological changes consistent with cell viability as described. Exposure of cells to 6-OHDA significantly increased nuclear condensation and apoptotic bodies (Figure 1B). These apoptotic nuclear characteristics were reduced in cells incubated with 1 μM CA. In addition, immunoblotting showed that 6-OHDA treatment increased the ratio of caspase 3 and PARP in SHSY5Y cells (Figure 2A). This increase in the ratio of caspase

Figure 3. Effect of carnosic acid (CA) on 6-hydroxydopamine (6OHDA)-induced ROS generation in SH-SY5Y cells. Representative pictures were taken by a confocal microscope. Cells were pretreated with 0.1, 0.5, and 1 μM CA for 12 h followed by exposure to 100 μM 6-OHDA for 0.5 h. L-Buthionine-sulfoximine (BSO) was added to the cells for 1 h before CA treatment. The level in control cells was regarded as 1. Values are the means ± SD of three independent experiments. Groups without a common letter differ significantly, p < 0.05.

concentration of 1 μM decreased the intracellular ROS generation by 67% compared with that of the 6-OHDA group. However, this effect was reversed in cells treated with BSO (an inhibitor of GSH synthesis). Reversal of the Activation of p38 MAPK and JNK1/2 by CA. The JNK and p38 signaling pathways have been reported as being necessary for apoptosis in 6-OHDAstimulated SH-SY5Y cells.11,12 In this study, SH-SY5Y cells were pretreated with 1 μM CA for 12 h and then stimulated with 6-OHDA for 0.5, 1, or 3 h. As shown in Figure 4, we found that 6-OHDA induced the phosphorylation of JNK1/2 and p38. The activation of p38 and JNK1/2 was attenuated in the cells treated with CA.

Figure 2. Suppressive effect of carnosic acid (CA) on 6-hydroxydopamine (6-OHDA)-induced apoptosis in SH-SY5Y cells. Cells were pretreated with 0.1, 0.5, 1, 3, or 5 μM CA for 12 h and were then treated with 100 μM 6-OHDA for an additional 12 h. (A) Protein was determined by immunoblot assay. Changes in protein expression were measured by densitometry. Normalization of Western blots was ensured by β-tubulin. The level in control cells was regarded as 1. (B) Cells were treated with 100 μM 6-OHDA for 24 h. Cell distribution was analyzed by using Annexin V-FITC binding and propidium iodide (PI) uptake as described in Materials and Methods. FITC and PI fluorescence were measured by flow cytometry. Values are expressed as the means ± SD of three representative experiments. Groups not sharing a common letter differ significantly, p < 0.05.

3 and PARP was attenuated in cells treated with 0.5 to 1 μM CA; however, the effect of CA began to decrease at concentrations above 3 μM. At a concentration of 1 μM, CA exerted a neuroprotective effect by suppressing the ratio of caspase 3 and PARP by nearly 63%. To further confirm the apoptosis, the cells were examined by flow cytometric analysis using double staining of Annexin VFITC and PI. The result was consistent with that noted on protein expression, the apoptotic cells were observed in SHSY5Y cells treated with 6-OHDA for 24 h (Figure 2B). Cells treatment with 0.5 to 1 μM CA dose-dependently

Figure 4. Carnosic acid (CA) attenuated 6-hydroxydopamine (6OHDA)-induced activation of JNK and p38 in SH-SY5Y cells. Cells were pretreated with 1 μM CA for 12 h and then treated with 100 μM 6-OHDA for the indicated times. Protein was determined by immunoblot assay. One representative immunoblot out of three independent experiments is shown. 1896

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901

Chemical Research in Toxicology

Article

Involvement of GSH in the Neuroprotective Effects of CA. To determine whether CA could cause the elevation of total GSH, cells were treated with 100 μM 6-OHDA or 1 μM CA for the indicated tine. The result indicated that 6-OHDA decreased the GSH level (Figure 5A). Incubation of cells with

0.05). Accompanied by the elevation in total GSH, CA induced the protein levels of GCLC and GCLM (Figure 5B). BSO was tested to demonstrate that GSH is crucial for the suppression of apoptosis by CA. As noted, in the absence of BSO, cell viability was significantly increased in the cells treated with CA (P < 0.05) (Figure 5C). With BSO treatment, the neuroprotective effect of CA was decreased (P < 0.05). Consistent with the change in cell viability, BSO attenuated the CA induced-suppression of the cleavage of caspase 3 and PARP (Figure 5D). Moreover, the induction of cell death and apoptosis by 6-OHDA was attenuated in cells pretreated with the antioxidant N-acetylcysteine (NAC). CA, BSO, or NAC alone, however, did not change the cell viability and protein expression. Involvement of the Nrf2 Pathway in the Neuroprotective Effects of CA. The binding of Nrf2 to the ARE is well-known to up-regulate the transcription of several phase II detoxification enzymes, including γ-GCL and NAD(P)H:quinone oxidoreductase.37 Immunoblotting showed that CA (1 μM) increased Nrf2 nuclear translocation after 1 to 3 h, which then decreased gradually up to 9 h (Figure 6A). CA at the concentration of 3 μM did not induce increased expression of Nrf2, GCLC, and GCLM (see Figure S3 in Supporting Information). Moreover, after transient transfection of 2× ARE reporter into SH-SY5Y cells, CA increased the luciferase activity in a dose-dependent manner (Figure 6B). To demonstrate that the ARE is involved in the induction of γ-GCL expression by CA, we performed EMSA. The DNA binding of the ARE to nuclear proteins reached a maximum at 3 h after CA treatment (Figure 6C). The specificity of the DNA−protein interaction for ARE was demonstrated by a competitive assay with 100-fold excess of unlabeled double-stranded oligonucleotide (cold). To further explore whether the Nrf2 pathway is involved in the reversal of p38 and JNK1/2 activation by CA in SH-SY5Y cells, we used knockdown of Nrf2 by siRNA transfection. Immunoblots showed that CA attenuated 6-OHDA induced the phosphorylation of JNK1/2 and p38 (Figure 6D). Treatment with SH-SY5Y cells with 6-OHDA led to an increase in Nrf2 activation. Preincubation of CA, followed by 6OHDA treatment, induced a marked activation of Nrf2 as compared with 6-OHDA treatment alone. With Nrf2 siRNA, the nuclear Nrf2 level was decreased (vs si-control), which resulted in reducing the reversal of p38 and JNK1/2 activation by CA.

■

Figure 5. Glutathione (GSH) is involved in the neuroprotection of carnosic acid (CA) in SH-SY5Y cells. (A) Cells were treated with 100 μM 6-OHDA for 1 h or 1 μM CA for 6, 12, and 24 h. GSH levels were measured as described in Materials and methods. The level in control cells was regarded as 1. (B) The protein expression of the γ-GCL catalytic subunit (GCLC) and modifier subunit (GCLM) was determined by immunoblot assay. (C) SH-SY5Y cells were incubated with BSO (100 μM) or NAC (1 mM) for 12 h in the presence or absence of 1 μM CA and were then treated with 100 μM 6hydroxydopamine (6-OHDA) for 12 or 24 h. BSO was added to the cells 1 h before CA treatment. Cell viability was measured by the MTT assay. The level in control cells was regarded as 100%. (D) Protein expression was determined by immunoblot assay. One representative immunoblot out of three independent experiments is shown. Values are means ± SD of three independent experiments. Groups not sharing a common letter differ significantly, p < 0.05.

DISCUSSION Oxidative stress has been implicated both in the physiological process of aging and in a variety of neurodegenerative diseases, including PD and Alzheimer’s disease.38 6-OHDA is a hydroxylated analogue of dopamine that is commonly used to generate PD models in vitro and in vivo.5,39 6-OHDA is reported to cause ROS generation, caspase 3 activation, and nuclear condensation in rat PC12 and human SH-SY5Y cells, which leads to typical apoptotic cell death.40−42 The pretreatment of SH-SY5Y cells with sulforaphane has also been shown to prevent the mitochondrial depolarization, caspase 3 activation, and DNA fragmentation elicited by 6-OHDA. This neuroprotective effect is associated with an increase in the total GSH level as well as in phase 2 enzymes.43 Astaxanthin protects dopaminergic neurons from 6-OHDA-induced toxicity via a reduction in ROS production and subsequent attenuation of p38 activation.35 Curcumin I suppresses 6-OHDA-induced apoptosis in SH-SY5Y cells by inhibiting intracellular ROS

CA resulted in increases in the cellular GSH level in a timedependent manner. Twenty-four hours after treatment, the GSH level was 52% greater in cells cultured with CA (P < 1897

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901

Chemical Research in Toxicology

Article

the protective function of CA was dependent on its stimulation of the GSH synthesis system. The cell viability in this study in SH-SY5Y cells shows a biphasic effect of CA. Small concentrations of CA provided some protection against 6-OHDA toxicity, but at high concentrations, this protective effect was reduced. This dual effect has been shown previously in other dietary polyphenols, including fisetin and quercetin.45,46 The hormetic dose− response is characterized by a low-dose stimulation and a high-dose inhibition.47 It is likely that the presence of a small stimulus induces the expression of antioxidant enzymes and other defense mechanisms. However, high dose stimulation may induce negative results via the generation of highly reactive and harmful intermediates with pathological consequences. Phenolic compounds from rosemary, including CA, carnosol, and rosemarinic acid, have biological properties, such as antiinflammatory, antioxidative, antiviral, and anticarcinogenic activities.27,28,30,48 Soler-Rivas et al. indicated that supplementation with rosemary extracts should include an oily matrix and lecithin as a carrier to enhance bioaccessibility.49 The results of accumulated studies indicate that CA is the most abundant antioxidant found in the leaves of rosemary.50,51 The antioxidant activity of CA may be due to its derivatives and digestion products.49,52 CA can be converted into carnosol by air oxidation. However, carnosol is not the metabolite of CA in rat plasma. In the present study, CA protected SH-SY5Y cells against 6-OHDA induced neurotoxicity. CA is much more potent at protecting mouse HT22 neuronal cells against oxidative glutamate toxicity than is carnosol, and this could be attributed to the hydrophilic features of CA owing to its free carbonic acid and catechol hydroxyl moieties.53,54 Moreover, CA prevents dieldrin-induced cytotoxicity by enhancing brainderived neurotrophic factor and repressing apoptotic molecules in SN4741 cells.32 MAPKs control many cellular events, including differentiation, proliferation, and apoptosis.55 In particular, the JNK and p38 pathways are known as potent effectors of apoptosis induced by 6-OHDA.13,40,41 The activation of JNK is observed in the cell death induced by the neurotoxin methamphetamine. Furthermore, the JNK inhibitor SP600125 has been shown to suppress methamphetamine-activated caspase 3.56 Namiki et al. reported that p38 positively contributes to neuronal death in glutamate-induced excitotoxicity. The reduction of p38 phosphorylation may play a role in the neuroprotection.57 Similarly, Gomez-Lazaro et al. provided experimental evidence that p38 signaling activates Bax to engage the mitochondrial apoptosis by 6-OHDA in SH-SY5Y cells.58 The results of the present study showed that the protection of CA against 6-OHDA-induced apoptosis was mediated by a reduction of p38 and JNK phosphorylation, which was dependent on the inhibition of ROS production (Figures 2−4). Consistent with other studies, chrysotoxine and astaxanthin have been shown to attenuate 6-OHDA-induced apoptosis via suppression of p38 activation.11,35 The elevation of JNK phosphorylation by 6-OHDA is prevented by isoborneol, which suggests that inhibition of JNK activity is involved in isoborneol-induced protection in SH-SY5Y cells.12 The binding of Nrf2 to the ARE is well-known to up-regulate the transcription of several phase II detoxification enzymes, including GCL and NAD(P)H:quinone oxidoreductase 1.37 In Figure 6D, 6-OHDA alone seems to increase the Nrf2 expression in si-control cells. The result suggested a possible involvement of ROS in 6-OHDA-mediated up-regulation of

Figure 6. Carnosic acid (CA) induced the activation of Nrf2 and ARE binding in SH-SY5Y cells. (A) Cells were incubated with 1 μM CA for 1, 3, 6, or 9 h. Nuclear Nrf2 was determined by immunoblot assay. PARP was used as the loading control. (B) Cells were transfected with the ARE reporter plasmid and treated with 0.1, 0.5, and 1 μM CA for 20 h. Luciferase activities were determined. The level in control cells was set at 1. Values are means ± SD of three independent experiments. Groups without a common letter differ significantly, p < 0.05. (C) Nuclear extracts were prepared to measure ARE binding activity by electromobility gel shift assay (EMSA). Unlabeled double-stranded ARE (200 ng) was used to confirm specific binding. One representative experiment out of three independent experiments is shown. (D) Cells were transfected with Nrf2 siRNA (si-Nrf2) or nontargeting control siRNA (si-control). The activation of Nrf2, JNK1/2, or p38 was measured by Western blotting.

generation, thereby attenuating p53 phosphorylation and reducing the Bax/Bcl-2 ratio.44 In the present study, we showed that CA attenuated 6-OHDA-induced ROS, which resulted in the suppression of JNK, p38 activation, and apoptosis induced by 6-OHDA in SH-SY5Y cells. Moreover, 1898

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901

Chemical Research in Toxicology

Article

Author Contributions

Nrf2 as self-defense and adaptive cellular response. Lee et al. indicated that ROS generated by 6-OHDA treatment can induce the up-regulation of heme oxygenase-1 expression through the activation of Nrf2 conferring adaptive survival response to 6-OHDA-induced apoptosis in C6 glioma cells.59 Nrf2 is present in the cytoplasm as an inactive complex with the inhibitory protein subunit Keap1. The catechol form of CA slowly oxidizes to the quinone derivative, an electrophilic compound, which serves as a target for nucleophilic attack by GSH or other protein thiols.29 By this reaction, CA reacts with the cysteine thiol of Keap1 protein to form a Keap1-CA adduct and releases the Nrf2 protein from the Keap1/Nrf2 complex.29 In this study, we showed that Nrf2 was significantly translocated into nuclei by CA treatment (Figure 6A). Moreover, the treatment of SH-SY5Y cells with CA increased the GSH level and γ-GCL protein (Figure 5A and B). These findings suggest that Nrf2 has a pivotal role in the increase in GSH synthesis by CA. It is likely that the electrophilic quinone form of CA induced the neuroprotective mechanism in 6OHDA-induced cell death. The accumulated evidence indicates that GSH may prevent 6-OHDA-induced dopaminergic neurodegeneration and play a protective role in dopaminergic neurons.18,19 It has been suggested that activated GSH metabolism may participate in the neuroprotective effects of CA in neuronal HT22 cells.60 In addition, CA increases the level of reduced GSH and protects the brain against middle cerebral artery ischemia/reperfusion in mice.29 The results of the present study indicated that CA increased the GSH level and γ-GCL protein in SH-SY5Y cells (Figure 5A and B). Pretreatment of cells with CA attenuated 6OHDA-induced cell death, ROS generation, activation of caspase 3, and phosphorylation of JNK1/2 or p38 (Figures 1−4). However, exposure of cells to BSO blocked the protection by CA (Figure 5C and D). The reversal of p38 and JNK1/2 activation by CA in SH-SY5Y cells was suppressed by Nrf2 siRNA (Figure 6D). To further examine whether the oxidative stress resulting from GSH depletion was responsible for the induction of apoptosis by 6-OHDA, we tested the effect of the antioxidant NAC. The apoptosis resulting from 6-OHDA treatment was reversed by NAC (Figure 5C and D). These findings suggest that the suppression of ROS generation and apoptosis by CA depends on the GSH synthesis system.

#

These authors contributed equally to this work.

Funding

This study was supported by NSC 100-2320-B-039-005 and CMU98-N1-04. Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS ARE, antioxidant response element; BSO, L-buthionine sulfoximine; CA, carnosic acid; DCF-DA, 2,7-dichlorodihydrofluorescein diacetate; EMSA, electromobility gel shift assay; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; γ-GCL, γ-glutamylcysteine ligase; GCLC, GCL catalytic subunit; GCLM, GCL modifier subunit; GSH, glutathione; JNK, c-Jun NH2-terminal kinase; MAPK, mitogen-activated protein kinase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolim bromide; NAC, N-acetylcysteine; Nrf2, nuclear factor erythroid-2 related factor 2; 6-OHDA, 6-hydroxydopamine; PD, Parkinson’s disease; ROS, reactive oxygen species; siRNA, small interfering RNA; SN, substantia nigra

■

■

CONCLUSIONS Our results suggest that CA attenuates 6-OHDA-induced apoptosis through down-regulation of the JNK and p38 signaling pathways in SH-SY5Y cells. Moreover, this protective effect is associated with the induction of the GSH synthesis system. The CA compound may be a potential candidate for protection against neurodegeneration in Parkinson’s disease.

■

ASSOCIATED CONTENT

* Supporting Information S

Additional data. This material is available free of charge via the Internet at http://pubs.acs.org.

■

REFERENCES

(1) Lotharius, J., and Brundin, P. (2002) Pathogenesis of Parkinson’s disease: dopamine, vesicles and alpha-synuclein. Nat. Rev. Neurosci. 3, 932−942. (2) Dauer, W., and Przedborski, S. (2003) Parkinson’s disease: mechanisms and models. Neuron 39, 889−909. (3) Fernandez-Espejo, E. (2004) Pathogenesis of Parkinson’s disease: prospects of neuroprotective and restorative therapies. Mol. Neurobiol. 29, 15−30. (4) Farooqui, T., and Farooqui, A. A. (2011) Lipid-mediated oxidative stress and inflammation in the pathogenesis of Parkinson’s disease. Parkinsons Dis. 2011, 247467. (5) Blum, D., Torch, S., Lambeng, N., Nissou, M., Benabid, A. L., Sadoul, R., and Verna, J. M. (2001) Molecular pathways involved in the neurotoxicity of 6-OHDA, dopamine and MPTP: contribution to the apoptotic theory in Parkinson’s disease. Prog. Neurobiol. 65, 135− 172. (6) Alam, Z. I., Jenner, A., Daniel, S. E., Lees, A. J., Cairns, N., Marsden, C. D., Jenner, P., and Halliwell, B. (1997) Oxidative DNA damage in the parkinsonian brain: an apparent selective increase in 8hydroxyguanine levels in substantia nigra. J. Neurochem. 69, 1196− 1203. (7) Jenner, P., and Olanow, C. W. (1998) Understanding cell death in Parkinson’s disease. Ann. Neurol. 44, S72−84. (8) Jia, Z., Hallur, S., Zhu, H., Li, Y., and Misra, H. P. (2008) Potent upregulation of glutathione and NAD(P)H:quinone oxidoreductase 1 by alpha-lipoic acid in human neuroblastoma SH-SY5Y cells: protection against neurotoxicant-elicited cytotoxicity. Neurochem. Res. 33, 790−800. (9) Kim, H. G., Ju, M. S., Kim, D. H., Hong, J., Cho, S. H., Cho, K. H., Park, W., Lee, E. H., Kim, S. Y., and Oh, M. S. (2010) Protective effects of Chunghyuldan against ROS-mediated neuronal cell death in models of Parkinson’s disease. Basic Clin. Pharmacol. Toxicol. 107, 958−964. (10) Lee, C. H., Hwang, D. S., Kim, H. G., Oh, H., Park, H., Cho, J. H., Lee, J. M., Jang, J. B., Lee, K. S., and Oh, M. S. (2010) Protective effect of Cyperi rhizoma against 6-hydroxydopamine-induced neuronal damage. J. Med. Food 13, 564−571. (11) Song, J. X., Shaw, P. C., Sze, C. W., Tong, Y., Yao, X. S., Ng, T. B., and Zhang, Y. B. (2010) Chrysotoxine, a novel bibenzyl compound, inhibits 6-hydroxydopamine induced apoptosis in SH-SY5Y cells via mitochondria protection and NF-kappaB modulation. Neurochem. Int. 57, 676−689.

AUTHOR INFORMATION

Corresponding Author

*No. 91, Hsueh-Shih Rd., Taichung 404, Department of Nutrition, China Medical University, Taichung, Taiwan. Tel: +886-4-22053366 ext. 7521. Fax: +886-4-22062891. E-mail: [email protected]. 1899

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901

Chemical Research in Toxicology

Article

(12) Tian, L. L., Zhou, Z., Zhang, Q., Sun, Y. N., Li, C. R., Cheng, C. H., Zhong, Z. Y., and Wang, S. Q. (2007) Protective effect of (±) isoborneol against 6-OHDA-induced apoptosis in SH-SY5Y cells. Cell Physiol. Biochem. 20, 1019−1032. (13) Hu, X., Weng, Z., Chu, C. T., Zhang, L., Cao, G., Gao, Y., Signore, A., Zhu, J., Hastings, T., Greenamyre, J. T., and Chen, J. (2011) Peroxiredoxin-2 protects against 6-hydroxydopamine-induced dopaminergic neurodegeneration via attenuation of the apoptosis signal-regulating kinase (ASK1) signaling cascade. J. Neurosci. 31, 247− 261. (14) Wu, G., Fang, Y. Z., Yang, S., Lupton, J. R., and Turner, N. D. (2004) Glutathione metabolism and its implications for health. J. Nutr. 134, 489−492. (15) Martin, H. L., and Teismann, P. (2009) Glutathione: a review on its role and significance in Parkinson’s disease. FASEB J. 23, 3263− 3272. (16) Meister, A. (1988) Glutathione metabolism and its selective modification. J. Biol. Chem. 263, 17205−17208. (17) Jia, Z., Misra, B. R., Zhu, H., Li, Y., and Misra, H. P. (2009) Upregulation of cellular glutathione by 3H-1,2-dithiole-3-thione as a possible treatment strategy for protecting against acrolein-induced neurocytotoxicity. Neurotoxicology 30, 1−9. (18) Vali, S., Mythri, R. B., Jagatha, B., Padiadpu, J., Ramanujan, K. S., Andersen, J. K., Gorin, F., and Bharath, M. M. (2007) Integrating glutathione metabolism and mitochondrial dysfunction with implications for Parkinson’s disease: a dynamic model. Neuroscience 149, 917− 930. (19) Verma, R., and Nehru, B. (2009) Effect of centrophenoxine against rotenone-induced oxidative stress in an animal model of Parkinson’s disease. Neurochem. Int. 55, 369−375. (20) Riederer, P., Sofic, E., Rausch, W. D., Schmidt, B., Reynolds, G. P., Jellinger, K., and Youdim, M. B. (1989) Transition metals, ferritin, glutathione, and ascorbic acid in parkinsonian brains. J. Neurochem. 52, 515−520. (21) Griffith, O. W. (1982) Mechanism of action, metabolism, and toxicity of buthionine sulfoximine and its higher homologs, potent inhibitors of glutathione synthesis. J. Biol. Chem. 257, 13704−13712. (22) Kay, H. Y., Won Yang, J., Kim, T. H., Lee da, Y., Kang, B., Ryu, J. H., Jeon, R., and Kim, S. G. (2010) Ajoene, a stable garlic byproduct, has an antioxidant effect through Nrf2-mediated glutamatecysteine ligase induction in HepG2 cells and primary hepatocytes. J. Nutr. 140, 1211−1219. (23) Okouchi, M., Okayama, N., Alexander, J. S., and Aw, T. Y. (2006) NRF2-dependent glutamate-L-cysteine ligase catalytic subunit expression mediates insulin protection against hyperglycemia- induced brain endothelial cell apoptosis. Curr. Neurovasc. Res. 3, 249−261. (24) Yang, L., Calingasan, N. Y., Thomas, B., Chaturvedi, R. K., Kiaei, M., Wille, E. J., Liby, K. T., Williams, C., Royce, D., Risingsong, R., Musiek, E. S., Morrow, J. D., Sporn, M., and Beal, M. F. (2009) Neuroprotective effects of the triterpenoid, CDDO methyl amide, a potent inducer of Nrf2-mediated transcription. PLoS One 4, e5757. (25) Chen, L. W., Wang, Y. Q., Wei, L. C., Shi, M., and Chan, Y. S. (2007) Chinese herbs and herbal extracts for neuroprotection of dopaminergic neurons and potential therapeutic treatment of Parkinson’s disease. CNS Neurol. Disord. Drug Targets 6, 273−281. (26) Cho, E. S., Jang, Y. J., Hwang, M. K., Kang, N. J., Lee, K. W., and Lee, H. J. (2009) Attenuation of oxidative neuronal cell death by coffee phenolic phytochemicals. Mutat. Res. 661, 18−24. (27) Russo, A., Lombardo, L., Troncoso, N., Garbarino, J., and Cardile, V. (2009) Rosmarinus officinalis extract inhibits human melanoma cell growth. Nat. Prod. Commun. 4, 1707−1710. (28) Posadas, S. J., Caz, V., Largo, C., De la Gandara, B., Matallanas, B., Reglero, G., and De Miguel, E. (2009) Protective effect of supercritical fluid rosemary extract, Rosmarinus officinalis, on antioxidants of major organs of aged rats. Exp. Gerontol. 44, 383−389. (29) Satoh, T., Kosaka, K., Itoh, K., Kobayashi, A., Yamamoto, M., Shimojo, Y., Kitajima, C., Cui, J., Kamins, J., Okamoto, S., Izumi, M., Shirasawa, T., and Lipton, S. A. (2008) Carnosic acid, a catechol-type electrophilic compound, protects neurons both in vitro and in vivo

through activation of the Keap1/Nrf2 pathway via S-alkylation of targeted cysteines on Keap1. J. Neurochem. 104, 1116−1131. (30) Wijeratne, S. S., and Cuppett, S. L. (2007) Potential of rosemary (Rosemarinus officinalis L.) diterpenes in preventing lipid hydroperoxide-mediated oxidative stress in Caco-2 cells. J. Agric. Food Chem. 55, 1193−1199. (31) Haraguchi, H., Saito, T., Okamura, N., and Yagi, A. (1995) Inhibition of lipid peroxidation and superoxide generation by diterpenoids from Rosmarinus officinalis. Planta. Med. 61, 333−336. (32) Park, J. A., Kim, S., Lee, S. Y., Kim, C. S., Kim do, K., Kim, S. J., and Chun, H. S. (2008) Beneficial effects of carnosic acid on dieldrininduced dopaminergic neuronal cell death. Neuroreport 19, 1301− 1304. (33) Kim, S. Y., Kim, M. Y., Mo, J. S., Park, J. W., and Park, H. S. (2007) SAG protects human neuroblastoma SH-SY5Y cells against 1methyl-4-phenylpyridinium ion (MPP+)-induced cytotoxicity via the downregulation of ROS generation and JNK signaling. Neurosci. Lett. 413, 132−136. (34) Kwon, S. H., Kim, J. A., Hong, S. I., Jung, Y. H., Kim, H. C., Lee, S. Y., and Jang, C. G. (2011) Loganin protects against hydrogen peroxide-induced apoptosis by inhibiting phosphorylation of JNK, p38, and ERK 1/2 MAPKs in SH-SY5Y cells. Neurochem. Int. 58, 533−541. (35) Ikeda, Y., Tsuji, S., Satoh, A., Ishikura, M., Shirasawa, T., and Shimizu, T. (2008) Protective effects of astaxanthin on 6-hydroxydopamine-induced apoptosis in human neuroblastoma SH-SY5Y cells. J. Neurochem. 107, 1730−1740. (36) Kataoka, K., Handa, H., and Nishizawa, M. (2001) Induction of cellular antioxidative stress genes through heterodimeric transcription factor Nrf2/small Maf by antirheumatic gold(I) compounds. J. Biol. Chem. 276, 34074−34081. (37) Xiao, M., Zhou, N. X., Huang, Z. Q., Lu, Y. L., Chen, L. H., Wang, D. J., and Chang, W. L. (2004) The ratio of MMP-2 to TIMP-2 in hilar cholangiocarcinoma: a semi-quantitative study. Hepatobiliary Pancreat. Dis. Int. 3, 599−602. (38) Wang, X., and Michaelis, E. K. (2010) Selective neuronal vulnerability to oxidative stress in the brain. Front Aging Neurosci. 2, 12. (39) Schober, A. (2004) Classic toxin-induced animal models of Parkinson’s disease: 6-OHDA and MPTP. Cell Tissue Res. 318, 215− 224. (40) Gomez-Lazaro, M., Galindo, M. F., Concannon, C. G., Segura, M. F., Fernandez-Gomez, F. J., Llecha, N., Comella, J. X., Prehn, J. H. M., and Jordan, J. (2008) 6-Hydroxydopamine activates the mitochondrial apoptosis pathway through p38 MAPK-mediated, p53-independent activation of Bax and PUMA. J. Neurochem. 104, 1599−1612. (41) Ouyang, M., and Shen, X. (2006) Critical role of ASK1 in the 6hydroxydopamine-induced apoptosis in human neuroblastoma SHSY5Y cells. J. Neurochem. 97, 234−244. (42) Kim, M. K., Kim, S. C., Kang, J. I., Hyun, J. H., Boo, H. J., Eun, S. Y., Park, D. B., Yoo, E. S., Kang, H. K., and Kang, J. H. (2011) 6Hydroxydopamine-induced PC12 cell death is mediated by MEF2D down-regulation. Neurochem. Res. 36, 223−231. (43) Tarozzi, A., Morroni, F., Merlicco, A., Hrelia, S., Angeloni, C., Cantelli-Forti, G., and Hrelia, P. (2009) Sulforaphane as an inducer of glutathione prevents oxidative stress-induced cell death in a dopaminergic-like neuroblastoma cell line. J. Neurochem. 111, 1161− 1171. (44) Jaisin, Y., Thampithak, A., Meesarapee, B., Ratanachamnong, P., Suksamrarn, A., Phivthong-Ngam, L., Phumala-Morales, N., Chongthammakun, S., Govitrapong, P., and Sanvarinda, Y. (2011) Curcumin I protects the dopaminergic cell line SH-SY5Y from 6hydroxydopamine-induced neurotoxicity through attenuation of p53mediated apoptosis. Neurosci. Lett. 489, 192−196. (45) Chaturvedi, R. K., Shukla, S., Seth, K., Chauhan, S., Sinha, C., Shukla, Y., and Agrawal, A. K. (2006) Neuroprotective and neurorescue effect of black tea extract in 6-hydroxydopamine-lesioned rat model of Parkinson’s disease. Neurobiol. Dis. 22, 421−434. (46) Watjen, W., Michels, G., Steffan, B., Niering, P., Chovolou, Y., Kampkotter, A., Tran-Thi, Q. H., Proksch, P., and Kahl, R. (2005) 1900

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901

Chemical Research in Toxicology

Article

Low concentrations of flavonoids are protective in rat H4IIE cells whereas high concentrations cause DNA damage and apoptosis. J. Nutr. 135, 525−531. (47) Calabrese, E. J., Staudenmayer, J. W., and Stanek, E. J. (2006) Drug development and hormesis: changing conceptual understanding of the dose response creates new challenges and opportunities for more effective drugs. Curr. Opin. Drug Discovery Dev. 9, 117−123. (48) Aruoma, O. I., Spencer, J. P., Rossi, R., Aeschbach, R., Khan, A., Mahmood, N., Munoz, A., Murcia, A., Butler, J., and Halliwell, B. (1996) An evaluation of the antioxidant and antiviral action of extracts of rosemary and Provencal herbs. Food Chem. Toxicol. 34, 449−456. (49) Soler-Rivas, C., Marin, F. R., Santoyo, S., Garcia-Risco, M. R., Senorans, F. J., and Reglero, G. (2010) Testing and enhancing the in vitro bioaccessibility and bioavailability of Rosmarinus officinalis extracts with a high level of antioxidant abietanes. J. Agric. Food Chem. 58, 1144−1152. (50) Chang, C. H., Chyau, C. C., Hsieh, C. L., Wu, Y. Y., Ker, Y. B., Tsen, H. Y., and Peng, R. Y. (2008) Relevance of phenolic diterpene constituents to antioxidant activity of supercritical CO(2) extract from the leaves of rosemary. Nat. Prod. Res. 22, 76−90. (51) Aruoma, O. I., Halliwell, B., Aeschbach, R., and Loligers, J. (1992) Antioxidant and pro-oxidant properties of active rosemary constituents: carnosol and carnosic acid. Xenobiotica 22, 257−268. (52) Yan, H., Wang, L., Li, X., Yu, C., Zhang, K., Jiang, Y., Wu, L., Lu, W., and Tu, P. (2009) High-performance liquid chromatography method for determination of carnosic acid in rat plasma and its application to pharmacokinetic study. Biomed. Chromatogr. 23, 776− 781. (53) Satoh, T., Izumi, M., Inukai, Y., Tsutsumi, Y., Nakayama, N., Kosaka, K., Shimojo, Y., Kitajima, C., Itoh, K., Yokoi, T., and Shirasawa, T. (2008) Carnosic acid protects neuronal HT22 Cells through activation of the antioxidant-responsive element in free carboxylic acid- and catechol hydroxyl moieties-dependent manners. Neurosci. Lett. 434, 260−265. (54) Tamaki, Y., Tabuchi, T., Takahashi, T., Kosaka, K., and Satoh, T. (2010) Activated glutathione metabolism participates in protective effects of carnosic acid against oxidative stress in neuronal HT22 cells. Planta Med. 76, 683−688. (55) Raman, M., Chen, W., and Cobb, M. H. (2007) Differential regulation and properties of MAPKs. Oncogene 26, 3100−3112. (56) Wang, S. F., Yen, J. C., Yin, P. H., Chi, C. W., and Lee, H. C. (2008) Involvement of oxidative stress-activated JNK signaling in the methamphetamine-induced cell death of human SH-SY5Y cells. Toxicology 246, 234−241. (57) Namiki, K., Nakamura, A., Furuya, M., Mizuhashi, S., Matsuo, Y., Tokuhara, N., Sudo, T., Hama, H., Kuwaki, T., Yano, S., Kimura, S., and Kasuya, Y. (2007) Involvement of p38alpha in kainate-induced seizure and neuronal cell damage. J. Recept. Signal Transduct. Res. 27, 99−111. (58) Gomez-Lazaro, M., Galindo, M. F., Concannon, C. G., Segura, M. F., Fernandez-Gomez, F. J., Llecha, N., Comella, J. X., Prehn, J. H., and Jordan, J. (2008) 6-Hydroxydopamine activates the mitochondrial apoptosis pathway through p38 MAPK-mediated, p53-independent activation of Bax and PUMA. J. Neurochem. 104, 1599−1612. (59) Lee, C., Park, G. H., and Jang, J. H. (2011) Cellular antioxidant adaptive survival response to 6-hydroxydopamine-induced nitrosative cell death in C6 glioma cells. Toxicology 283, 118−128. (60) Tamaki, Y., Tabuchi, T., Takahashi, T., Kosaka, K., and Satoh, T. (2010) Activated glutathione metabolism participates in protective effects of carnosic acid against oxidative stress in neuronal HT22 cells. Planta Med. 76, 683−688.

1901

dx.doi.org/10.1021/tx300171u | Chem. Res. Toxicol. 2012, 25, 1893−1901