Article pubs.acs.org/JAFC
Carrot Juice Fermented with Lactobacillus plantarum NCU116 Ameliorates Type 2 Diabetes in Rats Chuan Li,† Qiao Ding,† Shao-Ping Nie,* Yan-Song Zhang, Tao Xiong, and Ming-Yong Xie* State Key Laboratory of Food Science and Technology, Nanchang University, 235 Nanjing East Road, Nanchang, Jiangxi 330047, People’s Republic of China S Supporting Information *
ABSTRACT: The effect of carrot juice fermented with Lactobacillus plantarum NCU116 on high-fat and low-dose streptozotocin (STZ)-induced type 2 diabetes in rats was studied. Rats were randomly divided into five groups: non-diabetes mellitus (NDM), untreated diabetes mellitus (DM), DM plus L. plantarum NCU116 (NCU), DM plus fermented carrot juice with L. plantarum NCU116 (FCJ), and DM plus non-fermented carrot juice (NFCJ). Treatments of NCU and FCJ for 5 weeks were found to favorably regulate blood glucose, hormones, and lipid metabolism in the diabetic rats, accompanied by an increase in short-chain fatty acid (SCFA) in the colon. In addition, NCU and FCJ had restored the antioxidant capacity and morphology of the pancreas and kidney and upregulated mRNA of low-density lipoprotein (LDL) receptor, cholesterol 7α-hydroxylase (CYP7A1), glucose transporter-4 (GLUT-4), peroxisome proliferator-activated receptor-α (PPAR-α), and peroxisome proliferator-activated receptor-γ (PPAR-γ). These results have for the first time demonstrated that L. plantarum NCU116 and the fermented carrot juice had the potential ability to ameliorate type 2 diabetes in rats. KEYWORDS: Lactobacillus plantarum NCU116, carrot juice, antidiabetic effect, blood glucose, type 2 diabetes, oxidative stress
■
to exhibit nutritional and health-promoting benefits,16 it is necessary to explore the mechanism of the beneficial effects. Therefore, in the present study, we investigated the effects of L. plantarum NCU116 and its fermented carrot juice on high-fat and low-dose streptozotocin (STZ)-induced type 2 diabetes in rats.
INTRODUCTION Type 2 diabetes mellitus (T2DM) is a group of metabolic diseases characterized by hyperglycemia as a result of insulin resistance and relative insulin deficiency.1 The chronic hyperglycemia of diabetes can cause many complications, including dysfunction of eyes, kidneys, nerves, heart, and blood vessels.2 T2DM is a result of genetic and environmental interactions, and several risk factors have been identified, such as age, diet, sedentary lifestyle, and obesity.3,4 In the past few decades, this disorder has rapidly increased worldwide. A number of antidiabetic agents, such as biguanides, thiazolidinediones, and α-glucosidase inhibitors, can control blood glucose levels. However, the use of them has adverse effects and causes secondary failure, including flatulence, abdominal discomfort, and sometimes diarrhea.5,6 Recently, interest has been drawn toward the possible role of the intestinal microbiota as a potential novel contributor to the increased prevalence of T2DM.7,8 As an important part of intestinal microbiota, probiotics are live microorganisms that are primarily used to improve health benefits on the host when consumed in appropriate amounts.9,10 In addition, recent studies have shown that probiotics could not only have beneficial effects on gastrointestinal health but also improve certain metabolic disorders, such as T2DM, but the mechanism has not yet been fully understood.11 We have recently reported that Lactobacillus plantarum NCU116 isolated from pickled vegetables had several bioactivities, such as cholesterol lowering in a high-fat and high-cholesterol diet rat model.12−14 As one of the most popular vegetable juices, carrot juice represents a valuable natural source of β-carotene. Vegetable juices are available in either fermented or non-fermented form.15 Because indigenously fermented vegetables with probiotics have been shown © XXXX American Chemical Society
■
MATERIALS AND METHODS
Carrot Preparation and Fermentation. Fresh carrots (purchased from a local supermarket in Nanchang, China) were washed and ground into juice. Freshly prepared carrot juice was pasteurized at 80 °C for 20 min to reduce the microbial population below the detection limit. The resulting juice was cooled; glucose was then added to a final concentration of 8% (v/v) and stored at 4 °C before use. L. plantarum NCU116 strain was cultured in MRS broth at 37 °C for 18 h to reach a concentration of 109 colony forming units (CFU)/ mL. Cells were harvested by collecting cell pellets after centrifugation at 1000g for 10 min. The cell pellets were washed and resuspended in saline to produce suspensions of approximately 106 CFU/mL for starter inoculation. A total of 1 L of carrot juice was inoculated with L. plantarum NCU116 (4%, v/v) starter inoculation. The inoculated juice was fermented at 37 °C for 24 h statically. Non-inoculated juice incubated under the same experimental conditions was used as a control. Both fermented carrot juice (FCJ) and non-fermented carrot juice (NFCJ) were adjusted to pH 6.5 using sodium bicarbonate, so that both juices had the same pH. The FCJ contained approximately 109 CFU/mL of L. plantarum NCU116, and the strain was not found in the NFCJ. Experimental Animals. Male Wistar rats with the body weights of 120−150 g were obtained from Cavens Laboratory Animal Co., Ltd. Received: July 31, 2014 Revised: October 22, 2014 Accepted: October 22, 2014
A
dx.doi.org/10.1021/jf503681r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
Table 1. Sequences of the Primers Used for PCRa gene
forward (5′−3′)
reverse (5′−3′)
LDL receptor CYP7A1 GLUT-4 PPAR-α PPAR-γ β-actin
CAGCTCTGTGTGAACCTGGA CACCATTCCTGCAACCTTTT GACATTTGGCGGAGCCTAAC GGTCATACTCGCAGGAAA TCAGGGCTGCCAGTTTCG TGTTGTCCCTGTATGCCTCT
TTCTTCAGGTTCGGGATCAG GTACCGGCAGGTCATTCAGT TAACTCCAGCAGGGTGACACAG AGCAAATTATAGCAGCCAC GCTTTTGGCATACTCTGTGATCTC TAATGTCACGCACGATTTCC
a LDL receptor, low-density lipoprotein receptor; CYP7A1, cholesterol 7α-hydroxylase; GLUT-4, glucose transporter-4; PPAR-α, peroxisome proliferator-activated receptor-α; and PPAR-γ, peroxisome proliferator-activated receptor-γ.
[certificate number SCXK (Su) 2011-0003, Changzhou, China]. All animals were housed under the conditions of 23 ± 1 °C and 12/12 h of light/dark cycle with ad libitum food and water for 1 week before commencement of the animal experiment. All animals used in this study were cared for in accordance with the Guidelines for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health (NIH Publication 85-23, 1996), and all experimental procedures were approved by the Nanchang University Medical College Animal Care Review Committee. Experimental Design. After acclimation, 10 rats were fed a standard normal chow diet and the others were fed with a high-fat diet. The high-fat diet consists of 66.5% (w/w) normal chow diet, 10% lard, 20% sucrose, 2.5% cholesterol, and 1% sodium cholate.14 After 8 weeks of dietary manipulation, rats fed a high-fat diet were fasted for 12 h and injected with STZ (Sigma Chemical Co., St. Louis, MO) at the dose of 30 mg/kg of body weight into the tail vein to induce type 2 diabetes. Rats fed on a standard normal chow diet received an equivalent volume of vehicle. Hyperglycemia was confirmed by the levels of fasting blood glucose (FBG) higher than 11.1 mmol/L at day 7 after STZ injection. A total of 40 type 2 diabetic rats were randomly divided into four groups (n = 10 in each group) as follows: untreated diabetes mellitus (DM), DM treated with 109 CFU/mL L. plantarum NCU116 (NCU), DM treated with fermented carrot juice with L. plantarum NCU116 (FCJ, 109 CFU/mL), and DM treated with non-fermented carrot juice (NFCJ). A total of 10 rats fed on a standard normal chow diet served as a non-diabetes mellitus group (NDM) and received the same volume of saline. All treatments were conducted with 10 mL/kg of body weight by oral administration once daily over a 5 week period. Measurement of Metabolites in Carrot Juices. β-Carotene,17 short-chain fatty acid (SCFA),18 and other organic acids (citric acid, malic acid, and lactic acid)19 in the carrot juices were measured as described in previous reports. Amino acids in the juices were determined by an amino acid analyzer (L-8900, Hitachi, Japan). Measurements of Blood Glucose, Lipids, and Hormones. At the end of the 5 week experimental period, blood glucose levels in the rats were determined following food deprivation for 12 h by AccuChek Performa (Roche Diagnostics, Mannheim, Germany). Then, the rats were humanly anesthetized with chloral hydrate via peritoneal injection. Blood samples were obtained by cardiac puncture and centrifuged at 1000g for 10 min, and the serum was recovered for further analyses. Samples of liver, pancreas, kidney, skeletal muscle, and feces in colon were quickly removed and stored at −80 °C until use. Levels of serum lipids, including total cholesterol (TC), highdensity lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triacylglycerols (TG), as well as hormones, including serum insulin, leptin, and glucagon, were measured by a radioimmunoassay method, as described previously.13 Contents of glucagon-like peptide (GLP)-1 and peptide tyrosine-tyrosine (PYY) were determined by enzyme-linked immunosorbent assay (ELISA) kits (Xinyu Biotech Co., Shanghai, China). Determination of Serum Oxidative Stress and Kidney Function. Activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and catalase (CAT) and levels of malondialdehyde (MDA), total antioxidant capacity (T-AOC), uric acid, creatinine, and urea nitrogen were determined using commercial kits
(Jiancheng Bioengineering, Nanjing, China) according to the instructions of the manufacturer. Determination of SCFA in Colonic Feces. SCFA of colonic feces were measured as described in a previous report.18 Histopathological Examination. The pancreas and kidney samples were collected from the animals under anaesthetized conditions, and a portion of the samples was fixed in 10% buffered formalin, dehydrated through graded alcohol, and embedded in paraffin wax. Sections with 5 μm thickness were mounted on slides. The samples were stained with hematoxylin and eosin after deparaffinization. The stained slides were mounted in neutral balsam and covered with coverslips. Histopathological changes were observed with a Nikon Ti series inverted microscope equipped with bright-field high-quality objectives. Images were acquired by a digital camera (Nikon Digital Sight DS-Fi1c) and image acquisition software. Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) Analyses of Gene Expression. Total RNA was extracted from the liver and skeletal muscle, and cDNA was obtained by reverse transcription using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Vilnius, Lithuania) according to the instructions of the manufacturer. The PCR reactions were performed by a 7900HT fast real-time PCR system (Applied Biosystems, Foster City, CA) using SYBR Premix Ex Taq (Takara, Kusatsu, Japan). Data analysis was carried out using the 2−ΔΔCT method. The housekeeping gene, β-actin, was used for normalization. The sequences of the primers (Invitrogen China, Ltd., Beijing, China) used for RT-qPCR are shown in Table 1. Statistical Analysis. Results were expressed as the mean ± standard error of mean (SEM), and the data were analyzed by SPSS 17.0 software (SPSS, Inc., Chicago, IL). One-way analysis of variance (ANOVA) with Duncan’s multiple range test was used to compare the differences among various groups. A value of p < 0.05 was considered to be statistically significant.
■
RESULTS Metabolite Composition in Carrot Juices. The metabolite concentrations in NFCJ and FCJ are shown in Table 2. In Table 2. Metabolite Composition in Carrot Juicesa parameter
NFCJ
acetic acid (mmol/L) propionic acid (mmol/L) butyric acid (mmol/L) SCFA (mmol/L) citric acid (mmol/L) malic acid (mmol/L) lactic acid (mmol/L) β-carotene (μmol/L) amino acids (mmol/L)
8.99 ± 0.41 0.31 ± 0.02 ND 9.30 ± 0.42 1.28 ± 0.02 26.11 ± 0.08 3.59 ± 0.05 89.22 ± 1.30 84.94 ± 5.14
FCJ 18.58 0.47 0.25 19.29 1.46 12.54 68.88 79.72 107.31
± ± ± ± ± ± ± ± ±
0.66 0.03 0.02 0.67 0.01 0.06 0.06 0.74 9.03
a
FCJ, fermented carrot juice with L. plantarum NCU116; NFCJ, nonfermented carrot juice; and ND, not detected. SCFA = acetic acid + propionic acid + butyric acid. Data are expressed as the mean ± SEM (n = 6).
B
dx.doi.org/10.1021/jf503681r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
Table 3. Effect of NCU and FCJ Treatments on Levels of Blood Glucose, Hormones, and Serum Lipids in Diabetic Ratsa parameter FBG (mmol/L) insulin (μIU/mL) glucagon (pg/mL) leptin (ng/mL) GLP-1 (pmol/L) PYY (pg/mL) TC (mmol/L) TG (mmol/L) HDL-C (mmol/L) LDL-C (mmol/L)
NDM 4.55 20.64 88.26 4.92 3.42 97.61 1.89 1.10 1.00 0.39
± ± ± ± ± ± ± ± ± ±
DM
0.19 1.06 4.78 0.71 0.23 3.05 0.10 0.10 0.04 0.09
a a a a c d a a b a
26.60 65.04 158.77 7.33 1.51 41.86 8.08 9.86 0.74 2.86
± ± ± ± ± ± ± ± ± ±
NCU
0.84 d 4.13 c 10.17 c 0.68 b 0.09 a 4.21 a 0.51 c 0.56 c 0.03 a 0.32 d
19.37 39.22 130.29 5.52 2.49 64.02 5.24 7.31 0.85 1.07
± ± ± ± ± ± ± ± ± ±
FCJ
0.73 3.49 9.10 0.46 0.11 3.67 0.63 0.81 0.07 0.20
b b b ab b b b b a ab
17.19 44.54 107.50 4.97 2.81 78.53 6.37 7.47 0.81 1.54
± ± ± ± ± ± ± ± ± ±
NFCJ
0.98 7.88 6.54 0.30 0.15 2.31 0.65 0.37 0.05 0.19
b b a a b c b b a bc
23.34 59.77 169.57 6.48 1.76 44.98 6.75 8.60 0.80 2.04
± ± ± ± ± ± ± ± ± ±
0.83 2.44 4.74 0.74 0.06 3.37 0.36 0.56 0.02 0.34
c c c ab a a bc bc a c
a
NDM, non-diabetes mellitus + saline; DM, diabetes mellitus + saline; NCU, DM + 109 CFU/mL L. plantarum NCU116; FCJ, DM + fermented carrot juice with L. plantarum NCU116; and NFCJ, DM + non-fermented carrot juice. Data are expressed as the mean ± SEM (n = 10). Values within a row with different letters are significantly different (p < 0.05).
Table 4. Effect of NCU and FCJ Treatment on Oxidative Stress and Kidney Function in Diabetic Ratsa parameter SOD (units/mL) GSH-Px (units/mL) MDA (nmol/mL) T-AOC (units/mL) CAT (units/mL) urea nitrogen (mmol/L) creatinine (mmol/L) uric acid (mmol/L)
NDM 219.53 402.73 3.59 14.77 198.59 2.79 0.16 0.26
± ± ± ± ± ± ± ±
4.76 c 16.18 b 0.19 a 0.80 c 12.36 c 0.36 a 0.01 a 0.04 a
DM 156.94 289.28 5.36 6.67 98.65 13.30 0.98 0.56
± ± ± ± ± ± ± ±
NCU
6.03 a 34.29 a 0.41 ab 0.56 a 7.13 a 1.87 c 0.05 c 0.08 b
191.29 353.65 3.73 11.62 120.18 9.25 0.58 0.48
± ± ± ± ± ± ± ±
FCJ
6.20 4.22 0.14 0.63 9.67 0.24 0.06 0.10
b b a b ab b b ab
200.35 361.72 3.70 13.35 150.32 6.84 0.44 0.43
± ± ± ± ± ± ± ±
8.95 b 9.71 b 0.17 a 0.66 bc 18.96 b 0.67 b 0.08 b 0.12 ab
NFCJ 166.43 293.52 5.74 8.23 107.48 7.82 0.42 0.51
± ± ± ± ± ± ± ±
3.61 a 10.86 a 1.21 b 0.83 a 7.00 a 0.86 b 0.04 b 0.08 ab
a
NDM, non-diabetes mellitus + saline; DM, diabetes mellitus + saline; NCU, DM + 109 CFU/mL L. plantarum NCU116; FCJ, DM + fermented carrot juice with L. plantarum NCU116; and NFCJ, DM + non-fermented carrot juice. Data are expressed as the mean ± SEM (n = 10). Values within a row with different letters are significantly different (p < 0.05).
comparison to the NFCJ, with the fermentation of L. plantarum NCU116, FCJ showed more concentrations of acetic acid, propionic acid, total SCFA (=acetic acid + propionic acid + butyric acid), citric acid, lactic acid, and amino acids. In addition, the butyric acid in NFCJ was not detected, but the FCJ contained about 0.25 mmol/L of the acid. However, the concentrations of malic acid and β-carotene in FCJ decreased in comparison to that of NFCJ. Blood Glucose. As expected, the level of fasting blood glucose (FGB) in the DM group (26.72 mmol/L) was markedly higher than that in the NDM group (4.55 mmol/ L). Interestingly, the FGB levels in NCU and FCJ groups (19.37 and 17.19 mmol/L, respectively) were significantly lower than that of the DM group (p < 0.05). The animals that received NFCJ (23.34 mmol/L) also showed a significant decrease in the blood glucose level compared to the DM group. Hormones. The levels of serum insulin, glucagon, and leptin in the DM group were significantly higher than those in the NDM group (p < 0.05). Supplementation of NCU and FCJ reduced their levels close to the NDM group, especially glucagon and leptin levels in the FCJ group. The levels of the three hormones in the NFCJ group were not significantly different from the DM group. Meanwhile, levels of GLP-1 and PYY in the DM group were abatement compared to the NDM group, and the levels of these two parameters in NCU and FCJ groups were obviously increased (p < 0.05; Table 3). Serum Lipids. As shown in Table 3, TC, TG, and LDL-C levels in DM group were all notably increased in comparison to the NDM group. Interestingly, the levels of these three parameters in NCU and FCJ groups declined significantly (p < 0.05). The HDL-C contents in the four diabetic groups were all
significantly lower than that in the NDM group (1.00 mmol/ L), but there were no significant differences between the four groups (0.74−0.85 mmol/L; Table 3). Oxidative Stress. As shown in Table 4, the activities of SOD (156.94 units/mL), GSH-Px (289.28 units/mL), and CAT (98.65 units/mL) and level of T-AOC (6.67 unit/mL) in the DM group were significantly lower than those in the NDM group (p < 0.05). The treatment of FCJ significantly increased the levels of these parameters (200.35, 361.72, 150.32, and 13.35 units/mL, respectively). MDA contents in NCU and FCJ groups decreased to lower levels compared to that in the NFCJ group. Kidney Function. A high-fat diet and STZ-induced diabetes were found to raise the levels of urea nitrogen, creatinine, and uric acid. Interestingly, the treatment of NCU and FCJ led to a significant reduction in the levels of these parameters. These results suggested that supplementation of NCU and FCJ improved kidney function in diabetes (Table 4). SCFA Composition in Feces. As shown in Figure 1, the DM group contained significantly lower concentrations of acetic acid (120.54 μmol/g), propionic acid (49.15 μmol/g), butyric acid (16.44 μmol/g), and total SCFA (186.13 μmol/g) in feces compared to the NDM group (p < 0.05). These acids in feces of the NCU-, FCJ-, and NFCJ-treated groups were higher than those in the DM group, especially the NCU and FCJ groups (p < 0.05). Histopathology of the Pancreas and Kidney. Histological analysis of the pancreas showed that pancreatic cells of the NDM group had normal proportions of islets of Langerhans. Acinar cells, which stained strongly, were arranged in lobules with prominent nuclei and surrounding healthy islet C
dx.doi.org/10.1021/jf503681r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
cells. A marked decrease in pancreatic β-cell size and number of Langerhans was found in the DM group compared to that in the NDM group, and the DM group also showed degeneration and atrophy of the islets. DM rats treated with NCU and FCJ showed an improvement of cell damage, as shown by partial restoration of islet cells, increase in the number of islets, and decrease in β-cell necrosis and vacuolization, respectively (Figure 2A). Similarly, in comparison to the NDM group, diabetic rats exhibited a prominent feature of glomerular injury, with evidence of both diffuse and nodular glomerulosclerosis. In addition, tubulointerstitial pathology was present in these diabetic rats. This pathological appearance was reversed by NCU and its fermented carrot juice treatments. This reduction was greater with FCJ than with NCU. However, the NFCJ group had no notable change compared to the DM group (Figure 2B). mRNA Expression of Lipid and Glucose Metabolism. As shown in Figure 3, diabetes downregulated the expression of LDL receptor, GLUT4, and PPAR-α, and the supplementation of L. plantarum NCU116 increased the expression of these
Figure 1. Changes in SCFA in feces of five groups of rats: nondiabetes mellitus (NDM), untreated diabetes mellitus (DM), DM plus L. plantarum NCU116 (NCU), DM plus fermented carrot juice with L. plantarum NCU116 (FCJ), and DM plus non-fermented carrot juice (NFCJ). Data are expressed as the mean ± SEM (n = 10). Values with different letters are significantly different (p < 0.05).
Figure 2. Effect of NCU and FCJ treatments on histology (100×) of the pancreas and kidney in five groups of rats: non-diabetes mellitus (NDM), untreated diabetes mellitus (DM), DM plus L. plantarum NCU116 (NCU), DM plus fermented carrot juice with L. plantarum NCU116 (FCJ), and DM plus non-fermented carrot juice (NFCJ). A, pancreas; B, kidney, with hematoxylin and eosin staining. D
dx.doi.org/10.1021/jf503681r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
Ingestion of a high-fat diet reduced the SCFA concentration, and fermentable dietary fibers increased SCFA in the colon.22,23 In these high-fat diet (fed) and low-dose STZ-induced diabetic rats, the fecal SCFA was obviously decreased in comparison to that of the NDM group. The NCU and FCJ groups showed a higher levels of SCFA than the DM and NFCJ groups (Figure 1). SCFA has several physiological properties that might suppress diabetes by different pathways; SCFA is probably a key component in the growth of lactobacilli and bifidobacteria and in lowering intestinal pH, all of which are expected to have beneficial effects on diabetes.24 The main beneficial activities of SCFA were identified in the decrease of levels of glucose in serum, insulin resistance, inflammation, and increase in protective PYY and GLP-1 secretion.22 Propionate has been shown to decrease glucose production in rat hepatocytes.25 In this experiment, the results suggested that the consumption of L. plantarum NCU116 and carrot juice led to an increase of propionic acid for preventing hyperglycemia, but a more pronounced effect was found when carrot juice was fermented with L. plantarum NCU116. The hypoglycemic effect of the FCJ observed in this study could be related to the synergistic effects of both β-carotene in carrot, gut microbiota, and the production of SCFA.26 In addition, hormones, such as insulin, glucagon, and leptin, play an important role in diabetes. Previous studies have suggested that leptin secretion is affected by insulin and that rats with metabolic syndrome exhibit high plasma levels of leptin.27 It has been reported that supplementation of L. plantarum NCU116 significantly decreased the oral glucose tolerance and insulin resistance in hyperlipidaemic rats, indicating that the probiotic fermented carrot juice could regulate the production of insulin and glucagon by pancreatic cells.13 These results suggested that the decrease in insulin, glucagon, and leptin levels may have resulted from the improvement of insulin sensitivity by the oral supplementation of L. plantarum NCU116. Changes in the microbiota and, consequently, in SCFA composition have been hypothesized to be associated with the development of insulin resistance and diabetes.22 Alterations to the composition and metabolic capacity of gut microbiota in metabolic syndrome influence metabolic processes in peripheral organs, the release of hormones from the gut (such as GLP-1 and PYY; Table 3), and the synthesis, storage, or metabolism of lipids in the adipose tissue, liver, and muscle.28 Studies performed in Gprotein-coupled receptor 41 (GPR41)-deficient mice suggested that the activation of GPR41 by SCFA is responsible for the release of the gut hormones PYY. The peptide has been shown to decrease the intestinal transit time, which indicates that it promotes the absorption of nutrients, mostly glucose.29 It has been reported that propionic and butyric acids were shown to reduce low-grade inflammation and induce hormone release. In addition, SCFA have been linked to increased GLP-1 secretion in both animal and human models. GLP-1 is an incretin hormone that participates in glucose homeostasis, mainly by lowering the plasma glucose concentration and preserving pancreatic β-cell function.22 The gastrointestinal hormones have antidiabetic effects primarily by stimulating glucosedependent insulin release and promoting glucose homeostasis.7,30 Dyslipidemia is the common character in T2DM and is the primary cause of cardiovascular diseases in patients with diabetes.6 In the STZ-induced diabetic rat model, it has been shown that TC, TG, and LDL-C levels increased and the HDLC level decreased and that the supplementation with soymilk
Figure 3. Effect of NCU and FCJ treatments on mRNA levels of lowdensity lipoprotein (LDL) receptor, cholesterol 7α-hydroxylase (CYP7A1), glucose transporter-4 (GLUT-4), peroxisome proliferator-activated receptor-α (PPAR-α), and peroxisome proliferatoractivated receptor-γ (PPAR-γ) in five groups of rats: non-diabetes mellitus (NDM), untreated diabetes mellitus (DM), DM plus L. plantarum NCU116 (NCU), DM plus fermented carrot juice with L. plantarum NCU116 (FCJ), and DM plus non-fermented carrot juice (NFCJ). The graph represents the mRNA levels relative to β-actin. Data are expressed as the mean ± SEM (n = 10). Values with different letters are significantly different (p < 0.05).
genes after the 5 week experimental period. Simultaneously, the expression of CYP7A1 and PPAR-γ in diabetic rats was raised, and higher expression levels of these two genes were found in the NCU and FCJ groups.
■
DISCUSSION T2DM, which has a higher incidence (90−95%) than T1DM, previously referred to as non-insulin-dependent diabetes or adult onset diabetes, encompasses individuals who have insulin resistance and usually have relative (rather than absolute) insulin deficiency.2 A high-fat diet and low-dose STZ used in the study resulted in destruction of pancreatic β-cells, an increased blood glucose level (hyperglycemia), and induced oxidative stress. The T2DM experimental rat model mimics closely metabolic characteristics of human T2DM.20 The T2DM model used in this study apparently showed the basic phenotypes of hyperglycemia and insulin resistance (Table 3). Evidence from our study clearly demonstrated that supplementation of NCU and FCJ significantly attenuated hyperglycemia and insulin resistance. Organic acids, the main products of probiotic fermentation, contribute toward an appropriate colonic pH and protect against pathological changes in the colonic mucosa.21 In this study, it must be noted that the concentrations of SCFA in fermented carrot juice (FCJ) supplemented with L. plantarum NCU116 were significantly increased compared to those of non-fermented carrot juice (NFCJ). Interestingly, the butyric acid was not detected in non-fermented carrot juice (NFCJ), which means L. plantarum NCU116 could ferment the dietary fiber in the carrot juice to produce certain kinds of SCFA, such as butyric acid. Thus, in this study, we focused on the function of SCFA to the diabetic rats. Because L. plantarum NCU116 had the property of promotion of SCFA production in vitro, we determined the SCFA concentrations in vivo of rat colonic feces. Studies showed that 90−95% of the SCFA present in the colon is constituted by acetic acid, propionic acid, and butyric acid. E
dx.doi.org/10.1021/jf503681r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
fermented with Lactobacillus rhamnosus CRL981 could ameliorate lipid profiles compared to the unfermented soymilk.16 It is well-known that high levels of serum TC and LDL-C can increase the risk of cardiovascular events. Decreasing TC and LDL-C levels in serum is effective for reducing the risk of atherosclerosis. A previous study showed that L. plantarum NCU116 significantly decreased the levels of serum TC, TG, and LDL-C and increased the HDL-C level in a hyperlipidaemic rat model.13 Butyrate-producing intestinal bacteria seem to play an important role in blood glucose regulation and lipid metabolism, as shown by fecal transplantation studies.22 In the present study, the administration of FCJ showed the best ability of regulating TC, TG, and LDL-C compared to the other treatments, and it might relate to the increase of butyric acid production in the colonic content by the gut microbiota (Table 3). Oxidative stress is considered to play an important role in the pathogenesis of type 2 diabetes. The increased risk of dyslipidemia and hyperglycemia damage the antioxidant system of tissues.31 Diabetes is associated with the increase of oxidative stress, which is essentially an imbalance of free radicals and antioxidant defenses.32 Oxidative stress can impair the living cell membrane, and this may be the reason for the injury to the islets of Langerhans and glomeruli of kidney. It has been shown that STZ-induced diabetes in rats caused an abnormal decrease of SOD, GSH-Px, and CAT activities and T-AOC level, resulting in the accumulation of reactive oxygen species (ROS), such as hydrogen peroxide and superoxide radicals.33 MDA, as an end product and marker of the lipid peroxidation process, is toxic to DNA and protein. In this study, the administration of NCU and FCJ caused as a significant increase in activities of SOD, GSH-Px, and CAT and level of T-AOC. This may be due to the biologically active β-carotene present in the fermented carrot juice with L. plantarum NCU116 bioconversion, because non-fermented carrot juice did not show the same level of increase (Table 4). Hyperglycemia and dyslipidemia in diabetes are related to the increased production of free radicals. Consequently, oxidative damages and pancreas and kidney injuries leading to failure and dysfunctions were observed. Interestingly, after NCU and FCJ supplementation, reduction of pancreas and kidney injuries was found in the histopathology study (Figure 2). NCU and FCJ could enhance pancreatic activity in regenerating β-cells by reducing β-cell necrosis and vacuolization.34 To our knowledge, rare studies have shown the effect of fermented carrot juice administration on histology, except for a few studies showing the effect of β-carotene supplementation on the incidence of type 2 diabetes.35 A long period of hyperglycemia can induce damage to blood vessels that can affect the functionality of some organs, such as the pancreas, liver, and kidney. Consequently, oxidative damages and kidney tissue damage leading to failure and dysfunctions were observed. The disability of the kidney in the diabetic rats to filter properly leads to the accumulation of waste and toxic substances, such as uric acid, creatinine, and urea nitrogen in the blood.36 STZ-induced diabetic rats showed an increase of uric acid, creatinine, and urea nitrogen, and the supplementation with soymilk fermented with L. rhamnosus CRL981 did not have any effect in diabetic rats. 16 Morphologically, the findings of this study revealed the efficiency of NCU and FCJ in protecting the kidney of diabetic rats, which was evidenced by the lower rates observed for kidney dysfunction indices (Table 4 and Figure 2).
The gut microbiota not only affect the metabolic syndrome by SCFA production but also influence the expression of host genes and control fatty acid absorption, oxidation, and storage.29 A previous study showed that oral administration of L. plantarum NCU116 could regulate LDL receptor and CYP7A1 to alleviate the high-fat diet induced hyperlipidaemic symptom in rats. The increased expression of these genes in liver may be the mechanism by which L. plantarum NCU116 reduces TC and LDL-C in serum.13 In this study, mRNA expression levels of LDL receptor and CYP7A1 in NCU and FCJ groups were significantly increased, which may result in the decrease of the serum LDL-C level. GLUT-4 is the insulinregulated glucose transporter found primarily in adipose tissues and skeletal muscle, which is responsible for insulin-stimulated glucose transport into the cell. Conditional depletion of GLUT4 in certain organs caused a roughly equivalent incidence of diabetes in animals.37 We found that GLUT4 mRNA expression was increased in the skeletal muscle of NCU and FCJ groups compared to the untreated DM group. With more than 80% insulin-stimulated glucose disposal in the skeletal muscle, the increased GLUT4 mRNA expression by supplementation of NCU and FCJ could enhance glucose uptake in diabetic rats.38 It has been known that PPARs play a key role in inflammation and glucose homeostasis. PPAR-α may relate to the improvement insulin sensitivity, and PPAR-γ is a therapeutic drug target for metabolic syndrome.39,40 Our results suggested that NCU and FCJ could regulate glucose homeostasis and insulin sensitivity in the diabetic rats via regulating the expression of these genes (Figure 3). The possible mechanism involved in antidiabetic effects of L. plantarum NCU116 and its fermented carrot juice on a high-fat diet (fed) and low-dose STZ-induced type 2 diabetic rat model is provided in Figure 4.
Figure 4. Possible mechanism involved in antidiabetic effects of L. plantarum NCU116 and its fermented carrot juice on a high-fat diet (fed) and low-dose STZ-induced type 2 diabetic rat model. Red arrows represent inhibition, and green arrows represent promotion.
In conclusion, this study demonstrated that the antidiabetic effect of NCU and FCJ on a high-fat diet (fed) and low-dose STZ-induced type 2 diabetic rat model. L. plantarum NCU116 was found to increase SCFA in the fermented carrot juice (FCJ); meanwhile, NCU and FCJ increased SCFA in the colonic feces of diabetic rats. The results have shown that NCU and FCJ had the potential abilities to regulate levels of blood glucose and its related hormones (insulin, glucagon, GLP-1, F
dx.doi.org/10.1021/jf503681r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
(9) Wallace, T. C.; Guarner, F.; Madsen, K.; Cabana, M. D.; Gibson, G.; Hentges, E.; Sanders, M. E. Human gut microbiota and its relationship to health and disease. Nutr. Rev. 2011, 69, 392−403. (10) Rupa, P.; Mine, Y. Recent advances in the role of probiotics in human inflammation and gut health. J. Agric. Food Chem. 2012, 60, 8249−8256. (11) Lye, H.-S.; Kuan, C.-Y.; Ewe, J.-A.; Fung, W.-Y.; Liong, M.-T. The improvement of hypertension by probiotics: Effects on cholesterol, diabetes, renin, and phytoestrogens. Int. J. Mol. Sci. 2009, 10, 3755−3775. (12) Xiong, T.; Song, S.; Huang, X.; Feng, C.; Liu, G.; Huang, J.; Xie, M. Screening and identification of functional Lactobacillus specific for vegetable fermentation. J. Food Sci. 2013, 78, 84−89. (13) Li, C.; Nie, S.-P.; Ding, Q.; Zhu, K.-X.; Wang, Z.-J.; Xiong, T.; Gong, J.; Xie, M.-Y. Cholesterol-lowering effect of Lactobacillus plantarum NCU116 in a hyperlipidaemic rat model. J. Funct. Foods 2014, 8, 340−347. (14) Li, C.; Nie, S.; Zhu, K.-X.; Ding, Q.; Li, C.; Xiong, T.; Xie, M.-Y. Lactobacillus plantarum NCU116 improves liver function, oxidative stress and lipid metabolism in high fat diet induced non-alcoholic fatty liver disease rats. Food Funct. 2014, 5, 3216−3223. (15) Demir, N.; Bahçeci,̇ K. S.; Acar, J. The effects of different initial Lactobacillus plantarum concentrations on some properties of fermented carrot juice. J. Food Process. Preserv. 2006, 30, 352−363. (16) Marazza, J. A.; LeBlanc, J. G.; de Giori, G. S.; Garro, M. S. Soymilk fermented with Lactobacillus rhamnosus CRL981 ameliorates hyperglycemia, lipid profiles and increases antioxidant enzyme activities in diabetic mice. J. Funct. Foods 2013, 5, 1848−1853. (17) Barba, A.; Hurtado, M. C.; Mata, M.; Ruiz, V. F.; Tejada, M. Application of a UV−vis detection−HPLC method for a rapid determination of lycopene and β-carotene in vegetables. Food Chem. 2006, 95, 328−336. (18) Hu, J. L.; Nie, S. P.; Min, F. F.; Xie, M. Y. Polysaccharide from seeds of Plantago asiatica L. increases short-chain fatty acid production and fecal moisture along with lowering pH in mouse colon. J. Agric. Food Chem. 2012, 60, 11525−11532. (19) Kun, S.; Rezessy-Szabó, J. M.; Nguyen, Q. D.; Hoschke, Á . Changes of microbial population and some components in carrot juice during fermentation with selected Bifidobacterium strains. Process Biochem. 2008, 43, 816−821. (20) Srinivasan, K.; Viswanad, B.; Asrat, L.; Kaul, C.; Ramarao, P. Combination of high-fat diet-fed and low-dose streptozotocin-treated rat: A model for type 2 diabetes and pharmacological screening. Pharmacol. Res. 2005, 52, 313−320. (21) Parvez, S.; Malik, K.; Ah Kang, S.; Kim, H. Y. Probiotics and their fermented food products are beneficial for health. J. Appl. Microbiol. 2006, 100, 1171−1185. (22) Puddu, A.; Sanguineti, R.; Montecucco, F.; Viviani, G. L. Evidence for the gut microbiota short-chain fatty acids as key pathophysiological molecules improving diabetes. Mediators Inflammation 2014, 2014, 1−9. (23) Jakobsdottir, G.; Xu, J.; Molin, G.; Ahrné, S.; Nyman, M. Highfat diet reduces the formation of butyrate, but increases succinate, inflammation, liver fat and cholesterol in rats, while dietary fibre counteracts these effects. PLoS One 2013, 8, No. e80476. (24) Mehal, W. Z. The Gordian Knot of dysbiosis, obesity and NAFLD. Nat. Rev. Gastroenterol. Hepatol. 2013, 10, 637−644. (25) Cameron-Smith, D.; Collier, G.; O’Dea, K. Effect of propionate on in vivo carbohydrate metabolism in streptozocin-induced diabetic rats. Metabolism 1994, 43, 728−734. (26) Nicolle, C.; Gueux, E.; Jaffrelo, L.; Rock, E.; Mazur, A.; Amouroux, P.; Rémésy, C. Lyophilized carrot ingestion lowers lipemia and beneficially affects cholesterol metabolism in cholesterol-fed C57BL/6J mice. Eur. J. Nutr. 2004, 43, 237−245. (27) Lee, M. J.; Fried, S. K. Multilevel regulation of leptin storage, turnover, and secretion by feeding and insulin in rat adipose tissue. J. Lipid Res. 2006, 47, 1984−1993. (28) Tremaroli, V.; Bäckhed, F. Functional interactions between the gut microbiota and host metabolism. Nature 2012, 489, 242−249.
and PYY) and ameliorated diabetes induced damage of the pancreas and kidney. In addition, NCU and FCJ also decreased serum lipids and oxidative stress and regulated the expression levels of lipid and glucose metabolism. The possible mechanism of the paper was that NCU and FCJ changed the gut microbiota and, consequently, SCFA composition, which were associated with the development of diabetes. Thus, these results indicated that L. plantarum NCU116 and the probiotic fermented carrot juice have potential for the treatment of diabetes.
■
ASSOCIATED CONTENT
S Supporting Information *
Amino acids in carrot juices (Supplementary Table) and final body weight, food intake, and water consumption in the last week (Supplementary Figure). This material is available free of charge via the Internet at http://pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Authors
*Telephone: +86-791-88304452. Fax: +86-791-88304452. Email:
[email protected]. *Telephone: +86-791-83969009. Fax: +86-791-83969009. Email:
[email protected]. Author Contributions †
Chuan Li and Qiao Ding contributed equally to this work.
Funding
The authors are grateful for financial support from the National High Technology Research and Development Key Program of China (863 Key Program, 2011AA100904) and the Program for New Century Excellent Talents in University (NCET-120749). Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Ristagno, G.; Fumagalli, F.; Porretta-Serapiglia, C.; Orrù, A.; Cassina, C.; Pesaresi, M.; Masson, S.; Villanova, L.; Merendino, A.; Villanova, A. Hydroxytyrosol attenuates peripheral neuropathy in streptozotocin-induced diabetes in rats. J. Agric. Food Chem. 2012, 60, 5859−5865. (2) Association, A. D. Diagnosis and classification of diabetes mellitus. Diabetes Care 2013, 36, S67−S74. (3) Karlsson, F. H.; Tremaroli, V.; Nookaew, I.; Bergström, G.; Behre, C. J.; Fagerberg, B.; Nielsen, J.; Bäckhed, F. Gut metagenome in European women with normal, impaired and diabetic glucose control. Nature 2013, 498, 99−103. (4) Qin, J.; Li, Y.; Cai, Z.; Li, S.; Zhu, J.; Zhang, F.; Liang, S.; Zhang, W.; Guan, Y.; Shen, D. A metagenome-wide association study of gut microbiota in type 2 diabetes. Nature 2012, 490, 55−60. (5) Krentz, A. J.; Bailey, C. J. Oral antidiabetic agents. Drugs 2005, 65, 385−411. (6) Chen, P.; Zhang, Q.; Dang, H.; Liu, X.; Tian, F.; Zhao, J.; Chen, Y.; Zhang, H.; Chen, W. Antidiabetic effect of Lactobacillus casei CCFM0412 in high-fat-fed, streptozotocin-induced type 2 diabetic mice. Nutrition 2014, 30, 1061−1068. (7) Devaraj, S.; Hemarajata, P.; Versalovic, J. The human gut microbiome and body metabolism: Implications for obesity and diabetes. Clin. Chem. 2013, 59, 617−628. (8) Kootte, R.; Vrieze, A.; Holleman, F.; Dallinga-Thie, G.; Zoetendal, E.; De Vos, W.; Groen, A.; Hoekstra, J.; Stroes, E.; Nieuwdorp, M. The therapeutic potential of manipulating gut microbiota in obesity and type 2 diabetes mellitus. Diabetes, Obes. Metab. 2012, 14, 112−120. G
dx.doi.org/10.1021/jf503681r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
(29) Delzenne, N. M.; Neyrinck, A. M.; Bäckhed, F.; Cani, P. D. Targeting gut microbiota in obesity: Effects of prebiotics and probiotics. Nat. Rev. Endocrinol. 2011, 7, 639−646. (30) Nachnani, J.; Bulchandani, D.; Nookala, A.; Herndon, B.; Molteni, A.; Pandya, P.; Taylor, R.; Quinn, T.; Weide, L.; Alba, L. Biochemical and histological effects of exendin-4 (exenatide) on the rat pancreas. Diabetologia 2010, 53, 153−159. (31) Yadav, H.; Jain, S.; Sinha, P. Antidiabetic effect of probiotic dahi containing Lactobacillus acidophilus and Lactobacillus casei in high fructose fed rats. Nutrition 2007, 23, 62−68. (32) Betteridge, D. J. What is oxidative stress? Metabolism 2000, 49, 3−8. (33) Lee, J.-S. Effects of soy protein and genistein on blood glucose, antioxidant enzyme activities, and lipid profile in streptozotocininduced diabetic rats. Life Sci. 2006, 79, 1578−1584. (34) Posuwan, J.; Prangthip, P.; Leardkamolkarn, V.; Yamborisut, U.; Surasiang, R.; Charoensiri, R.; Kongkachuichai, R. Long-term supplementation of high pigmented rice bran oil (Oryza sativa L.) on amelioration of oxidative stress and histological changes in streptozotocin-induced diabetic rats fed a high fat diet; Riceberry bran oil. Food Chem. 2013, 138, 501−508. (35) Kataja-Tuomola, M.; Sundell, J.; Männistö, S.; Virtanen, M.; Kontto, J.; Albanes, D.; Virtamo, J. Effect of α-tocopherol and βcarotene supplementation on the incidence of type 2 diabetes. Diabetologia 2008, 51, 47−53. (36) Bejar, W.; Hamden, K.; Ben Salah, R.; Chouayekh, H. Lactobacillus plantarum TN627 significantly reduces complications of alloxan-induced diabetes in rats. Anaerobe 2013, 24, 4−11. (37) Huang, S.; Czech, M. P. The GLUT4 glucose transporter. Cell Metab. 2007, 5, 237−252. (38) Kim, S.-W.; Park, K.-Y.; Kim, B.; Kim, E.; Hyun, C.-K. Lactobacillus rhamnosus GG improves insulin sensitivity and reduces adiposity in high-fat diet-fed mice through enhancement of adiponectin production. Biochem. Biophys. Res. Commun. 2013, 431, 258−263. (39) Soares, F. L. P.; de Oliveira Matoso, R.; Teixeira, L. G.; Menezes, Z.; Pereira, S. S.; Alves, A. C.; Batista, N. V.; de Faria, A. M. C.; Cara, D. C.; Ferreira, A. V. M Gluten-free diet reduces adiposity, inflammation and insulin resistance associated with the induction of PPAR-α and PPAR-γ expression. J. Nutr. Biochem. 2013, 24, 1105− 1111. (40) Mohamed, S. Functional foods against metabolic syndrome (obesity, diabetes, hypertension and dyslipidemia) and cardiovasular disease. Trends Food Sci. Technol. 2014, 35, 114−128.
H
dx.doi.org/10.1021/jf503681r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
