Environ. Sci. Technol. 2006, 40, 3640-3645
Cathepsin B and Glutathione Peroxidase Show Differing Transcriptional Responses in the Grass Shrimp, Palaemonetes pugio Following Exposure to Three Xenobiotics R . J . G R I F F I T T , † G . T . C H A N D L E R , * ,† T . W . G R E I G , ‡ A N D J . M . Q U A T T R O ‡,§ Department of Environmental Health Sciences, Norman J. Arnold School of Public Health, University of South Carolina, Columbia, South Carolina 29208, Center for Coastal Environmental Health and Bio-molecular Research, 219 Fort Johnson Road, Charleston, South Carolina 29412, and Department of Biological Sciences, University of South Carolina, Columbia, South Carolina 29208
The common molecular biology techniques, suppressivesubtractive hybridization (SSH) and semi-quantitative realtime PCR (SQRT-PCR), were used to identify differentially expressed genes in the grass shrimp, Palaemonetes pugio following exposure to three different xenobiotics. Labacclimated adult male grass shrimp were exposed to empirically derived 96-hr male-specific LC50 concentrations of fipronil (FP, a phenylpyrazole GABA disrupting pesticide), endosulfan (ES, a cyclodiene GABA disrupting pesticide), or cadmium (Cd), as well as a control (CC). An SSH gene expression library was constructed from surviving shrimp from the fipronil and control exposures. Clones obtained by SSH were identified by searching against the NCBI website. A total of 42 genes were identified that were upregulated by FP exposure, and 47 that were downregulated. A subset of the affected genes was tested with SQRT-PCR to verify responsiveness to fipronil, as well as to endosulfan and cadmium. Two genes showed strong and significant responses to the exposures: glutathione peroxidase was significantly up-regulated by all three exposures, while Cathepsin B was strongly responsive to the two pesticides, but not to cadmium.
Introduction In recent years ecotoxicology has been revolutionized by the adoption of sophisticated molecular biology techniques such as differential display PCR (1), suppressive subtraction hybridization (SSH, 2, 3), and microarrays (4, 5) that allow researchers to more precisely analyze the effect of exposure to xenobiotics on a molecular or cellular level. Rather than assay a handful of genes or proteins at a time, it is now possible to rapidly screen large sections of a target species’ genome/ * Corresponding author. † University of South Carolina Department of Environmental Health Sciences. ‡ Center for Coastal Environmental Health and Bio-molecular Research. § Department of Biological Sciences, University of South Carolina. 3640
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 40, NO. 11, 2006
transcriptome simultaneously to identify genes affected by a particular stressor. More directed techniques such as semiquantitative real-time PCR (SQRT-PCR) can then be used to investigate the response pattern of a candidate gene following exposure in greater detail. The advantages to this approach are clear. Rather than making a priori assumptions about which genes or proteins are relevant or interesting, these techniques allow an unbiased look at an organism’s transcriptional response pattern and precise identification of affected genes. In this study, we used a combination of SSH and SQRTPCR to identify Palaemonetes pugio genes affected by exposure to three xenobiotics of interest to ecotoxicologists, the pesticides fipronil and endosulfan, and the metal cadmium. Fipronil (FP) is currently in widespread use for agricultural, residential, and recreational use (i.e., greens maintenance on golf courses) in the U.S. It is a member of the phenylpyrazole class of pesticides, and it acts by inhibiting chloride channels at the GABA receptor in invertebrate nervous systems, leading to constant neural excitation and death (6). As the GABA receptor is highly conserved across invertebrate taxa (7), fipronil is also highly toxic to nontarget crustaceans; particularly P. pugio, which has a reported 96-hour LC50 of 0.32 µg/L (8). Water concentrations of fipronil have been reported as high as 5.29 µg/L immediately beside an agricultural application site, and as high as 0.79 µg/L 20 miles distant from the same site (9); both concentrations exceed the previously mentioned LC50 for adult grass shrimp (0.32 µg/L). Endosulfan (ES) is a member of the cyclodiene family of organochlorine pesticides. It has the same mode of action as fipronil, namely inhibition of the proper functioning of the GABA receptor, and is similarly highly toxic to grass shrimp (96-hour LC50 ) 0.92 µg/L for adult male grass shrimp, (10). Cadmium is a nonessential trace metal that readily bioaccumulates in marine organisms (11) and is toxic to crustaceans. It inhibits molting processes (12), reduces reproductive success (13) in decapod crabs, and inhibits DNA repair mechanisms in grass shrimp (14). Palaemonetes pugio is an ecologically important decapod crustacean, with a distribution from Nova Scotia to Texas (15). It is an integral part of estuarine food webs in the Southeast U.S, an important food source for many species of commercially important fish that utilize estuaries for refuge or reproduction, and is also intimately involved in detritus breakdown and carbon cycling in estuaries (16). Significant effects of anthropogenic contaminants have been observed in P. pugio (17-21). Palaemonetes occurs in high abundance in tidal creek ecosystems adjacent to terrestrial influences (22) and shows a heightened sensitivity to endocrine disrupting chemicals (23). They are, therefore, an excellent model species for assessing sublethal xenobiotic effects of importance to ecologically and economically important crustaceans in estuarine systems.
Experimental Methods Shrimp Collection. Palaemonetes were collected from Leadenwah Creek, a pristine tidal estuary of the Edisto River (32°36′12′′N, 80°07′00′′ W) in southeastern South Carolina. Individuals were collected by hand-held dip nets, and transferred to five gallon buckets containing three gallons of natural water from the collection site. Constant aeration was provided via battery operated air pumps. The buckets containing shrimp were immediately transported to the University of South Carolina and placed in 10 gallon filtered aquaria (less than 50 individuals per aquarium), and allowed 10.1021/es052537o CCC: $33.50
2006 American Chemical Society Published on Web 05/03/2006
to acclimate to laboratory conditions for two weeks. Following this initial acclimation period, individuals were sexed, and only adult males were used in the exposures to avoid sexlinked differential gene expression patterns as a potential confounding factor in the analysis. Exposures. Adult male grass shrimp were exposed for 96 h in static renewal bioassays following approved ASTM guidelines (24) at individual sex-specific LC50 concentrations (0.2 µg FP/L, 1.0 µg ES/L, 320 µg Cd/L) with complete media changes every 24 h. A series of exposures were performed to determine the acute LC50 concentrations for each of the three xenobiotics tested (data not shown). A carrier control (CC) exposure was performed simultaneously. The exposures were performed in 4 L glass jars containing 2 L of test solution and 10 individuals. Exposure regimes were run in triplicate. The containers were placed in a Revco environmental chamber to hold environmental factors constant (20C, 14h:10h light: dark cycle). Gentle aeration was provided by inserting a glass pipet attached to an aerator into the bottom of each container. Shrimp were not fed for the duration of the exposure. Test solutions were prepared in Griffin beakers by mixing 6 L of seawater (20 ppt, 20C, pH, etc) with the requisite amounts of analytical grade contaminant dissolved in acetone. Beakers were covered in foil to prevent evaporation and photodegradation, and vortexed for 6 h to allow adequate mixing. Water Chemistry Analysis. Triplicate water chemistry samples were taken from each replicate every 24 h. Pesticide concentrations were measured using a 2:1 liquid:liquid methyl tert-butyl ether (MTBE) extraction (25). Briefly, three mL of test solution was added to 1.5 mL MTBE containing 0.25 µl/L of 4-bromoanisole as an internal standard. The samples were vortexed for 60 s, and sonicated for 10 min at 23 °C. The solvent phase was removed and placed in 15 mm i.d. amber glass crimp top GC vials. Fipronil and endosulfan concentrations were quantified against a 5 point standard curve on a Hewlett-Packard 5890 series II gas chromatograph equipped with an electron capture detector (Hewlett-Packard, Palo Alto, CA). Cadmium was measured by removing 10 mL test solution, acidifying with 15 µL 3N HNO3, and storing in pre-acid washed 15 mL conical centrifuge tubes until analysis following protocols similar to (26). Suppressive-Subtraction Library Construction. At the conclusion of the exposure all surviving shrimp were removed from the test chambers, placed intact in 2-ml cryogenic storage vials, and immediately flash frozen by immersion in liquid nitrogen for 60 s. Frozen individuals were stored at -80 °C until library construction. Five individuals from the FP and CC treatments were pooled to get the necessary RNA for SSH library construction. SSH library construction was performed under contract by EcoArray Inc (Alachua, FL). Subtractive hybridizations were performed in both directions in order to obtain both up-regulated genes (subtraction run in forward direction) and down-regulated genes (subtraction run in reverse direction). Subtractive hybridizations were constructed using the Clontech (Palo Alto, CA) suppressive subtractive hybridization kit following the manufacturer’s recommendations as briefly outlined below. Poly-A mRNA was isolated using the Oligotex mRNA Midi Kit (Qiagen, Valencia, CA) and converted to cDNA. The tester and driver cDNAs were digested with Rsa I and the tester cDNA pool was divided into two portions, each of which was ligated with a different cDNA adapter sequence. Two sequential hybridizations were then performed. For the first hybridization, an excess of driver was added to each of the tester pools, the samples were heat denatured and then allowed to anneal to each other, resulting in the generation of several different hybrid sequences of cDNA. For the second hybridization, the two different tester pools were mixed together in the presence of an excess of driver without denaturing and new hybrids were formed. The ends of the differentially expressed
cDNA sequences were then filled in by DNA polymerase and two rounds of PCR were performed. The resultant pool of cDNA clones obtained from the PCR reaction were shotgun ligated into pGEM T-Easy cloning vector (Promega, Madison, WI) and then transformed into DH5-alpha cells and plated onto Luria-Bertani (LB) agar plates containing ampicillin and oxacillin (100 µg/mL each). Recombinant colonies were then picked from the plates and sequenced. Clones obtained via SSH were deposited in Genbank (http:// www.ncbi.nlm.nih.gov/Genbank/index.html). RNA Isolation. RNA isolation for SQRT-PCR analysis was performed using an RNABee kit (IsoTex Diagnostics, Inc, Friendswood, TX). Whole body homogenates were used for RNA isolation, with the exception that the eyestalks and telson were removed with a sterile razor prior to RNA isolation, as these regions have been observed to contain high levels of RNAse activity (JMQ, pers. obs.). RNA concentrations were quantified by measuring the absorbance at 260 nm with a spectrophotometer. An average of 50 µg total RNA was recovered from each individual. Real-Time PCR Assays. Eleven genes that were identified as “affected” by fipronil exposure (i.e., five up-regulated and six down-regulated) via SSH were selected for further study. The five up-regulated genes were masquerade-like protein (MLP), enteropeptidase (enterokinase (ETP), succinate dehydrogenase (SDH), cathepsin-B like precursor (CTB), and epididymal glutathione peroxidase precursor (GPx). The six down-regulated genes were phosphoenolpyruvate carboxykinase (PCK), casein kinase 2 (CK2), retinol dehydrogenase (RDH), RNA helicase (RNAH), eukaryotic translation initiation factor 3 (TIF3), and annexin XI (A11). Also, actin was measured as a normalization factor (ACT). Fold-change from controls was calculated both from FP-exposed individuals to confirm SSH results, as well as from ES and Cd-exposed individuals to investigate the response to different contaminants. The freely available software Primer3 (http:// frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) was used to design primers for semi-quantitative real-time PCR (SQRT-PCR) analysis. The following criteria were used: amplicon length (75-125 bp), annealing temperature (TA ) 54-60C), and GC clamp ) 2 (Table 3). Primers were synthesized by IDT technologies (www.idtdna.com). RNA from three randomly selected individuals from each of the four (CC, FP, ES, Cd) treatments was used to synthesize cDNA, using a superscript first-strand synthesis system for RTPCR (Invitrogen, Carlsbad, CA) using 4 µg total RNA and 0.5 µg oligo-dT primer. cDNA synthesis was performed following the manufacturer’s protocols with the exception that the incubation time was increased from 45 min to 90 min. Transcript levels were measured using a SYBR Green PCR Master Mix kit (Applied Biosystems, Foster City, CA) and an ABI 7700 thermocycler. Real-time PCR reactions were performed in 25 µl volumes consisting of 11 µl 2× Master Mix, 11 µl water, 1 µl F primer, 1 µl R primer (250 nM final primer concentration) and 1 µl cDNA. Thermocycler conditions were as follows: 50C for 2 min, 90C for 10 min, then 50 cycles of gene-specific annealing temperature for 1 min, 72C for 1 min, followed by melting curve analysis. Reactions were monitored continuously, and threshold cycles (Ct) determined. Individual reactions were run in duplicate, and any reaction whose melting curve profile indicated nonspecific amplification was removed from the analysis. For each individual, an additional reaction to measure actin levels was performed for use as a normalization factor and to control for reverse transcription efficiencies. Means and standard deviations for fold change for each gene were calculated as the average of three individuals using the ∆∆Ct approximation. Statistical significance was assessed by Student’s t-test, with a p-value < 0.05 denoting significance. VOL. 40, NO. 11, 2006 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3641
TABLE 1. BLAST Results of Transcripts Up-regulated by Fipronil Exposure.a
a
clone ID
top hit definition
top E value
FP-01 FP-02 FP-03 FP-04 FP-05 FP-06 FP-07 FP-08 FP-09 FP-10 FP-11 FP-12 FP-13 FP-14 FP-15 FP-16 FP-17 FP-18 FP-19 FP-20 FP-21
hemocyanin [Penaeus monodon] hemocyanin 2 [Pacifastacus leniusculus] masquerade-like protein [Pacifastacus leniusculus] cytochrome c oxidase subunit I [Fenneropenaeus chinensis] Enteropeptidase (enterokinase) succinate dehydrogenase [Xenopus laevis] hemocyanin subunit [Callinectes sapidus] LD24308p [Drosophila melanogaster] ATPase 6 [Macrobrachium australiense] Cathepsin B-like cysteine proteinase precursor elongation factor 1-alpha [Heteromysis formosa] epididymal secretory glutathione peroxidase [Rattus rattus] hemocyanin 2 [Pacifastacus leniusculus] Crustacyanin C1 subunit European lobster ENSANGP00000010110 [Anopheles gambiae] HEL protein [Chironomus tentans] trypsin [Litopenaeus vannamei] Troponin I (TnI) > fast skeletal muscle-broad-fingered crayfish preamylase 1 [Litopenaeus vannamei] cytochrome b [Uroderma bilobatum] serum lectin isoform 2 precursor [Salmo salar]
0 0 0 0 7.86 × 10-28 3.49 × 10-43 3.25 × 10-38 9.03 × 10-35 4.03 × 10-33 1.82 × 10-30 2.15 × 10-26 5.03 × 10-21 9.94 × 10-21 2.74 × 10-16 4.69 × 10-16 2.70 × 10-15 6.31 × 10-15 2.67 × 10-14 6.68 × 10-7 2.66 × 10-6 2.32 × 10-5
For each clone, the closest match and the corresponding e-score are listed. Bolded clones were chosen for SQRT-PCR analysis.
TABLE 2. BLAST Results of Transcripts Down-Regulated by Fipronil Exposure.a
a
clone ID
top hit definition
top E value
CC-01 CC-02 CC-03 CC-04 CC-05 CC-06 CC-07 CC-08 CC-09 CC-10 CC-11 CC-12 CC-13 CC-14 CC-15 CC-16 CC-17 CC-18 CC-19 CC-20 CC-21
cytochrome c oxidase subunit I [Fenneropenaeus chinensis] Heterogeneous nuclear ribonucleoprotein A1, A2/B1 homologue phosphoenolpyruvate carboxykinase [Litopenaeus vannamei] cytochrome oxidase I phosphoenolpyruvate carboxykinase [Litopenaeus vannamei] casein kinase II (EC 2.7.1.-) beta chain - bovine cytochrome c oxidase subunits I [Neocalanus cristatus] retinol dehydrogenase 12 [Mus musculus] cytochrome oxidase subunit I [Eurypanopeus turgidus] RNA helicase (5O490) [Caenorhabditis elegans] eukaryotic translation initiation factor 3 subunit [Aedes aegypti] LD29847p [Drosophila melanogaster] phosphoenolpyruvate carboxykinase [Litopenaeus vannamei] HEL protein [Chironomus tentans] phosphoenolpyruvate carboxykinase [Litopenaeus vannamei] similar to translation elongation factor 2 [Apis mellifera] Hemocyanin A chain >gi|225118|prf||1209209A hemocyanin a ENSANGP00000006309 [Anopheles gambiae] HYPOTHETICAL PROTEIN RS05233 spectrin alpha chain [Gallus gallus] Annexin A11
0 0 0 0 0 0 2.24 × 10-44 4.96 × 10-35 2.26 × 10-25 4.77 × 10-23 1.73 × 10-20 4.13 × 10-19 3.26 × 10-18 2.52 × 10-15 4.11 × 10-15 5.33 × 10-13 1.02 × 10-12 1.43 × 10-8 3.87 × 10-8 2.88 × 10-5 0.0001755
For each clone, the closest match and the corresponding e-score are listed. Bolded clones were chosen for SQRT-PCR Analysis.
Results Exposures. The LC50 exposure results were as expected: fipronil exposure resulted in precisely 50% mortality over the course of the experiment, while ES mortality was 60%, and Cd mortality was 47%. The mean measured toxicant concentrations were 0.25 µg/L FP, 1.2 ug/L ES, and 294 ug/L Cd. Environmental conditions (temperature, salinity, DO, and pH) varied less than 1% over the 96 h exposure. SSH Results. A total of 66 sequences were identified as putatively up-regulated in FP-exposed shrimp. Of these, 21 (Table 1) were tentatively identified by BLAST search against the NCBI database (27). Another 72 sequences were obtained that were putatively down-regulated in FP-exposed shrimp, with 20 (Table 2) matching known sequences. The rest of the sequences had no significant homologies. SQRT-PCR Results. Eleven genes identified by SSH as affected by FP exposure and having significant homologies were selected for further study (Table 3); these genes produced single bands in the expected size range following 3642
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 40, NO. 11, 2006
PCR amplification and visualization on a 1.5% agarose gel. Gene selection was driven by technical considerations, i.e., the capacity of designed primers to produce single amplicons. Two of the five genes predicted by SSH to be up-regulated were significantly affected by the exposures (Figure 1). Glutathione Peroxidase (GPx) precursor was significantly upregulated in all three exposures compared to the controls, while a Cathepsin B (CTB) precursor was significantly upregulated in both the FP and ES exposures, but not in the Cd exposure. None of the genes predicted by SSH to be downregulated showed a significant response from SQRT-PCR data (Figure 2). Some genes showed slightly elevated or reduced levels in one or more of the exposures, but the patterns were inconsistent and inter-individual variability precluded any statistical significance.
Discussion We used the common transcriptomics techniques suppressive subtraction hybridization (SSH) and semi-quantitative
TABLE 3. Primer Sequences and Annealing Temperatures for Genes Assayed via SQRT-PCRa clone ID
primer
FP-03 FP-03 FP-05 FP-05 FP-06 FP-06 FP-10 FP-10 FP-12 FP-12
MLP L MLP R ETK L ETK R SDH L SDH R CTB L CTB R GPX L GPX R
up-regulated by FP TGTGAAGACCCAGACACAGG CCAGGAACGTCTTTGACTCC TGTGAAGACCCAGACACAGG GTCTGAAGAGCTGCACATCG GTCCGATCCCAAAGTACAGC TCGTAGGTCTGCATGTGAGG TCCAGTTACCGTGGTGTTCC GGTTGATTCCCAATTCATGG TCGAAAAGGGTCAATTCAGG CAGTTTGGCTTGCAAGAACC
56.7 55.4 56.7 55.9 55.6 56.5 57.0 51.7 52.7 55.0
CC-03 CC-03 CC-06 CC-06 CC-08 CC-08 CC-10 CC-10 CC-11 CC-11 CC-21 CC-21
PCK L PCK R CK2 L CK2 R RDH L RDH R RNAH L RNAH R TIF3 L TIF3 R A11 L A11 R
down-regulated by FP GCTTGTCCAGCCTCTTTAGC GACGAACTTTTCAGCCTTCC CAGCGGAAATGCTGTATGG GTCCAATTGGCAACATAGGC TACGAGCTGGTTCTGAATGG TTGAAATGCAGATGGGAACC CCAATTCGGTGAACATAATCC TGCTCGTGGTCTAGATGTGG AACAAGGATTTTTGAAGGATGG AGGCACTGTGCAATTTCTGG GACATAAAGGGTGATACCTCTGG GGAAGACACTTAAGATTACAAAAA
56.1 53.9 54.0 54.4 54.4 53.3 51.6 56.5 51.5 56.1 54.6 52.7
ACT L ACT R
constitutively expressed GAGCGATGATCTTGATCTTGATG TGTACCCAGBTATTGCTGACC
54.9 57.7
sequence (5′ - 3′)
TA (°C)
a Abbreviations are as follows: MLP, masquerade-like protein; ETP, Enteropeptidase (Enterokinase); SDH, succinate dehydrogenase; CTB, Cathepsin b-like precursor; GPX, epididymal secretory glutathione peroxidase; PCK, phosphoenolpyruvate carboxykinase; CK2, casein kinase 2; RDH, retinol dehydrogenase; RNAH, RNA helicase; TIF3, eukaryotic translation initiation factor 3 subunit; A11, Annexin XI; ACT, actin.
real-time PCR (SQRT-PCR) to identify genes affected by acute exposures to the xenobiotics fipronil, endosulfan, and cadmium. SSH was initially used to identify a suite of genes responsive to fipronil exposure. A subset of these genes was then tested using SQRT-PCR for xenobiotic-specific responsiveness to endosulfan and cadmium, in addition to fipronil. Two genes were significantly affected: Glutathione Peroxidase (GPx) was significantly up-regulated in organisms from all three exposures, and Cathepsin B (CTB) was significantly up-regulated in the FP and ES exposed individuals, but not in Cd-exposed individuals. Our study shows that specific genes can be identified in this crustacean model species that are responsive to particular toxicant classes. Here, we present hypothetical mechanisms by which these particular genes are affected. Reactive oxidant species (ROS) are a common byproduct of aerobic cellular metabolism. Imbalances between prooxidants and antioxidants lead to oxidative stress. Environmental factors, including exposure to xenobiotics, have been shown to increase the rate of ROS formation and thus increase cellular oxidative stress (28, 29). Several enzymes have evolved as antioxidants to neutralize ROS, including glutathione peroxidase (GPx), which has been shown to be responsive to contaminant-induced oxidative stress invertebrates, including mussels (30), clams (31), and earthworms (32). There is also evidence that GPx transcripts may play a role in reproductive success. Larval prawn (Macrobrachium rosenbergii) experience elevated levels of oxidative stress, and GPx is one of several enzymes deployed to minimize the damage caused by lipid peroxidation (33). Our results show that P. pugio GPx levels are significantly up-regulated in tissue from all three exposures, indicating that each exposure resulted
FIGURE 1. Fold change in genes predicted by SSH to be up-regulated by fipronil exposure. Data points are means plus or minus 1 standard deviation of the fold change from exposed individuals to control individuals (three individuals per treatment), normalized to actin expression levels. Levels significantly different from 1 are indicated. Positive values reflect up-regulation, negative values reflect downregulation. A. FP exposure. B. ES Exposure. C. Cd exposure. in increased ROS formation, and enhanced oxidative stress. The response was highest in the pesticide exposures (∼19fold increase for Fp, ∼9-fold increase for Es), and lowest in the Cd exposures (∼6-fold increase). However, all responses were consistent and statistically significant, showing that GPx may be useful as a general bioindicator of contaminantinduced oxidative stress in P. pugio. Cathepsin B is a member of the cysteine protease family, and is highly conserved across taxa (34). It has been well studied in different invertebrate systems (35, 36) and has been shown to be involved in invertebrate endocrinecontrolled pathways, particularly vitellogenesis. Vitellogenesis is a complex, hormonally regulated process that involves the production of vitellogenin, and the subsequent processing into yolk proteins lipovitellin (vitellin) and phosvitin. Cathepsin B-like proteins have been shown to control the degradation of vitellogenin in mosquitoes (37), to regulate the degradation of larval fat bodies in flesh flies (38), and to control follicular atresia in the mosquito Culex pipiens pallens (39). Cathepsin B-like proteins have also been observed in the northern shrimp (40), and in the pacific oyster, where levels were shown to peak immediately after fertilization (41). These results indicate that CTB plays an important role in regulating larval metamorphosis and development in invertebrates, and alterations in CTB transcriptional levels may be a useful bioindicator of contaminant-induced endocrine or reproductive dysfunction. Fipronil has previously been implicated in reproductive failure in the copepod Amphiascus tenureimus (42) by inducing strong male infertility and by significantly delaying VOL. 40, NO. 11, 2006 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3643
receptor, and so they would be expected to elicit similar transcriptional responses. Cadmium does not affect the GABA receptor, and so it would be expected to induce a different transcriptional response. Identification of genes that are diagnostic of a specific form of cellular distress, exposure to a particular pesticide, or (more likely) a specific class of pesticides, is of obvious importance to ecological managers. This research reinforces the limited utility of SSH alone as a tool for biomarker identification specifically or computational toxicology generally. Only two of the eleven genes surveyed with SQRT-PCR confirmed the response predicted by SSH. While this is not an uncommon result of subtractive hybridization techniques, it necessarily reduces the utility they have for efficient identification of biomarkers or gene response pathways. Large-scale techniques such as microarrays, SAGE, or MPSS that are capable of surveying entire transcriptomes are likely more appropriate techniques for accurate identification of genes responsive to environmental stressors. However, the combination of SSH and the more rapid and precise SQRT-PCR is a powerful tool, both for identifying possible biomarkers as well as for investigating more subtle xenobiotic-induced transcriptional response pathways.
Acknowledgments We acknowledge the technical assistance of Mark Roberts and Kristen Baltgalvis. This research was funded by the U.S. Environmental Protection Agency STAR program (award nos. R-827397 and R-83-2737), the NOAA Urbanization and Southeastern Estuaries Study (USES), and by the South Carolina Sea Grant Consortium (award no. R/ER-21). This research has not been subjected to either funding agencies' peer and policy review, and therefore, does not necessarily reflect their views and no endorsement should be inferred.
Literature Cited FIGURE 2. Fold change in genes predicted by SSH to be downregulated by FP exposure. Data points are means plus or minus 1 standard deviation from exposed individuals to control individuals (three individuals per treatment), normalized to actin expression levels. Levels significantly different from 1 are indicated. Positive values reflect up-regulation, negative values reflect down-regulation. A. FP exposure. B. ES Exposure. C. Cd exposure. development at concentrations similar to those used here (25). Additionally, a significant increase in lipovitellin levels in female copepods was reported following fipronil exposure (43), possibly indicating increased vitellogenesis mediated by CTB. Endosulfan increases time to hatch for grass shrimp eggs (10), and reproductive success in grass shrimp is highly correlated with vitellogenin levels in P. pugio females (23). While hormonal control of vitellogenesis is a complex and poorly understood process, fipronil and endosulfan (and, by inference, possibly other GABA-active pesticides) appear to have some effect. Our current results show that a Cathepsin B-like gene is strongly up-regulated by exposure to fipronil (∼30-fold) and endosulfan (∼19-fold) in male grass shrimp, presumably as part of a vitellogenesis regulatory pathway. These data indicate the possible utility of increased CTB transcription levels as an indicator of reproductive dysfunction caused by exposure to GABA-acting pesticides. The exact nature of the interaction between pesticide exposure, vitellogenesis, and CTB activity needs further study. However, given that Cd decreases crustacean reproductive success (13), and increases crustacean VTG levels (44), the present lack of CTB response to cadmium exposure suggests a GABA-inhibiting pesticide-specific interaction between CTB and vitellogenesis. Fipronil and endosulfan are structurally similar and induce death by inhibiting the proper functioning of the GABA 3644
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 40, NO. 11, 2006
(1) Maples, N. L.; L. J. Bain. Trivalent chromium alters gene expression in the mummichog (Fundulus heteroclitus). Environ. Toxicol. Chem. 2004, 23(3), 626-631. (2) Diatchenko, L.; Lau, Y. F.; Campbell, A. P.; Chenchik, A.; Moqadam, F.; Huang, B., et al. Suppressive-subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 6025-6030. (3) Pan, D.; He, N.; Yang, Z.; Liu, H.; Xu, X. Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Dev. Comput. Immunol. 2005, 29, 103-112. (4) Larkin, P.; Knoebl, I.; Denslow, N. D. Differential gene expression analysis in fish exposed to endocrine disrupting compounds. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 2003, 136, 149161. (5) Hogstrand, C.; Balesaria, S.; Glover, C. N. Application of genomics and proteomics for study of the integrated response to zinc exposure in a nonmodel fish species, the rainbow trout. Comp. Biochem Physiol. Part B: Biochem. Mol. Biol. 2002, 133, 523535. (6) Cole, L. M.; Nicholson, R. A.; Casida, J. A. Action of phenylpyrazole insecticides at the GABA-gated chloride channel. Pestic. Biochem. Physiol. 1993, 46, 47-54. (7) Robinson, T. N.; Olson, R. W. GABA. In Comparative Invertebrate Neurochemistry; Lunt, G. G., Olsen, R. W., Eds.; Cornell University Press: Ithica NY, 1998; pp 90-123. (8) Key, P. B.; Chung, K. W.; Opatkiewicz, A. D.; Wirth, E. F.; Fulton, M. H. Toxicity of the insecticides fipronil and endosulfan to selected life stages of the grass shrimp (Palaemonetes pugio). Bull. Envir. Contam. Toxicol. 2003, 70, 533-540. (9) Demcheck, D. K.; Skrobialowski, S. C. Fipronil and degradation products in the rice producing areas of the Mermentau river basin, Louisiana, February-September 2000, USGS Fact Sheet, FS-010-03; USGS: Denver, CO, 2003. (10) Wirth, E. F.; Lund, S. L.; Fulton, M. H.; Scott, G. I. Determination of acute mortality in adults, sublethal embryo responses of Palaemonetes pugio to endosulfan and methoprene exposure. Aquat. Toxicol. 2001, 53, 9-18.
(11) Rainbow, P. S. The significance of trace metal concentrations in decapods. Symp. Soc. London 1998, 59, 291-313. (12) Rodriguez Moreno, P. A.; Medesani, D. A. Rodriguez, E. M. Inhibition of molting by cadmium in the crab Chasmagnathus granulata (Decapoda Brachyura). Aquat. Toxicol. 2003, 64, 155164. (13) Kogan M.; Lopez Greco, L. S.; Romano, L. A.; Rodriguez, E. M. Effects of cadmium on gonadal and somatic growth of juvenile females of the estuarine crab Chasmagnathus granulata (Brachyura: Grapsidae). Zool. Stud. 2000, 34, 344-350. (14) Hook, S. L.; Lee, R. F. Interactive effects of UV, benzo[a]pyrene, and cadmium on DNA damage and repair in embryos of the grass shrimp Palaemonetes pugio. Mar. Environ.l Res. 2004, 58, 735-739. (15) Williams, A. B.; Wigley, R. L. Distribution of decapod crustacean off Northeast United States based on specimens at the Northeast Fisheries Center, Woods Hole, Massachusetts, NOAA technical report NMFS circulation 407; NOAA: Silver Spring, MD,1977; pp 1-4. (16) Welsh, B. L. The role of grass shrimp, Palaemonetes pugio, in a tidal marsh ecosystem. Ecology 1975, 56, 513-530. (17) Fulton, M. H.; Scott, G. I.; Fortner, A.; Bidleman, T. F.; Ngabe, B. The effects of urbanization on small high salinity estuaries of the southeastern United States. Arch. Environ. Contam. Toxicol. 1993, 25, 476-84. (18) Fulton, M. H.; Chandler, G. T.; Scott, G. I. Urbanization effects on the fauna of a Southeastern USA bar-built estuary. In Sustainable Development in the Southeastern Coastal Zone; Vernberg, F. J., Vernberg, W. B., Siewicki, T., Eds.; University of South Carolina Press: Lumbia, SC. 1996; pp 477-504. (19) Vernberg, F. J.; Vernberg, W. B.; Blood, E.; Fortner, A.; Fulton, M.; McKellar, H.; Michener, W.; Scott, G.; Siewicki, T.; El-Figi, K. Impact of urbanization on high salinity estuaries in the southeastern United States. Neth. J. Sea Res. 1992, 30, 239-248. (20) Vernberg, F. J.; Vernberg, W. B.; Porter, D. E.; Chandler, G. T.; McKellar, H. N.; Scott, G.; Siewicki, T.; Fulton, M.; Bushek, D.; Tufford, D. Coastal development impact on land-coastal waters. In Land-Ocean Interactions: Managing Coastal Ecosystems; Ozhan, E., Ed.; Nurol Press: Ankara, Turkey 1999; pp 613-622. (21) Finley, D. B.; Scott, G. I.; Daugomah, J. W.; Layman, S. L.; Reed, L. A.; Sanders, M.; Sivertsen, S. K.; Strozier, E. D. An ecotoxicological assessment of urban and agricultural nonpoint source runoff effects on the grass shrimp, Palaemonetes pugio. In Ecological Risk Assessment for Wetlands; Lewis, M. A., Powell, R. L., Nelson, M. K., Henry, M. G., Klaine, S. J., Dickson, G. W., Mayer, F. L., Eds.; SETAC Press: Pensacola, FL. 1999. (22) Porter, D. E.; Edwards, D.; Scott, G.; Jones, B.; Street, S. Assessing the impacts of anthropogenic and physiographic influences on grass shrimp in localized salt marsh estuaries: a multidisciplinary approach. Aquat. Bot. 1997; 58, 289-306. (23) Volz, D. C.; Wirth, E. W.; Fulton, M. H.; Scott, G. I.; Block, D. S.; Chandler, G. T. Endocrine-mediated effects of UV-A irradiation on grass shrimp (Palaemonetes pugio) reproduction. Comput. Biochem. Physiol. 2002, 133C, 419-434. (24) ASTM. Standard Guide for Conducting Toxicity Tests on Test Materials with Fishes, macroinvertebrates, and Amphibians, E-729-88a; American Society for Testing and Standings: West Conshohocken, PA, 1998. (25) Chandler, G. T.; Cary, T. L.; Volz, D. C.; Walse, S. S.; Ferry, J. L.; Klosterhaus, S. L. Fipronil effects on estuarine copepod (Amphiascus tenuiremis) development, fertility, and reproduction: a rapid life cycle assay in 96-well microplate format. Environ. Toxicol. Chem. 2004, 23(1), 117-124. (26) Flinder, C. G.; Kjellstrom, T.; Linmann, L.; Pershagen, G. Urinary Excretion of cadmium and zinc among persons from Sweden. Environ. Res. 1978, (3) 473-484. (27) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403410. (28) Dandapat, J.; Rao, K. J.; Chainy, G. B. N. An in vitro study of metal ion-induced lipid peroxidation in giant freshwater prawn, Macrobrachium rosenbergii (de Man). Biometals 1999, 12, 8997.
(29) Romeo M.; Bennani, N.; Barelli-Gnassia, M.; Lafaurie, M.; Girard, J. P. Cadmium and copper display different responses towards oxidative stress in the kidney of the sea bass, Diocentrarchus labrax. Aquat. Toxicol. 2000, 48, 185-194. (30) de Almeida, E. A.; Miyamoto, S.; Bainy, A. C. D.; de Medeiros, M. H. G.; Di Mascio, P. Mar. Pollut. Bull. 2004, 49, 386-392. (31) Manduzio, H.; Monsinjon, T.; Galap, C.; Leboulenger, F.; Rocher, B. Seasonal variations in antioxidant defenses in blue mussles Mytilus edulis collected from a polluted area: major contributions in gills of an inducible isoform of Cu/Zn-superoxide dismutase and of glutathione S-transferase. Aquat. Toxicol. 2004, 70, 83-93. (32) Laszczyca, P.; Augystyniak, M.; Babczynska, A.; Bednarska, K.; Kafel, A.; Migula, P. et al. Profiles of enzymatic activity in earthworms from zinc, lead, and cadmium polluted areas near Olkusz (Poland). Environ Int. 2004, 30, 901-910. (33) Dandapat, J.; Chainy, G. B. N.; Rao, K. J. Lipid peroxidation and antioxidant defense status during larval development and metamorphosis of giant prawn, Macrobrachium rosenbergii. Comp. Biochem. Physiol. Part C: Pharmacol., Toxicol. Endocrinol. 2003, 135, 221-233. (34) McGrath, M. E. The lysosomal cysteine proteases. Annu. Rev. Biophys. Biochem. Struct. 1999, 28, 181-204. (35) Cazzulo, J. J.; Couso, R.; Raimondi, A.; Wernstedt, C.; Hellman, U. Further characterization and partial amino acid sequence of a cystein proteinase from trypanosoma-cruizi. Mol. Biochem. Parasitol. 1989, 33, 33-42. (36) Loukas, A.; Selzer, P. M.; Maizels, R. M. Characterisation of Tccpl-1, a cathepsin L-like cysteine protease from Toxocara canis infective larvae Mol. Biochem. Parasitol. 1998, 92, 275-289. (37) Cho, W.-L.; Tsao, S.-M.; Hays, A. R.; Walter, R.; Chen, J.-S.; Snigirevskaya, E. S. et al. Mosquito Cathepsin B-like protease involved in embryonic degradation of vitellin is produced as a latent extraovarian precursor. J. Biol. Chem. 1999, 274(19), 13311-13321. (38) Takahashi, N.; Kurata, S.; Natori, S. Molecular cloning of cDNA fore the 29 kDa proteinase participating in decomposition of the larval fat body during metamorphosis of Sarcophaga peregrine (flesh fly). FEBS Letts. 1993, 334, 153-157. (39) Uchida, K.; Ohmori, D.; Ueno, T.; Nishizuka, M.; Eshita, Y.; Fukunaga, A. et al. Preoviposition activation of cathepsin-like proteinases in degenerating ovarian follicles of the mosquito Culex pipiens pallens. Dev. Biol. 2001, 237, 68-78. (40) Aoki, H.; Ahsan, N., Md.; Watabe, S. Molecular cloning and characterization of cathepsin B from the hepatopancreas of northern shrimp Pandalus borealis. Comp. Biochem. and Physiol. Part B: Biochem. Mol. Biol. 2003, 134, 681-694. (41) Donald, K. M.; Day, A. J.; Smerdon, G. R.; Cross, L. J.; Hawkins, A. J. S. Quantification of gene transcription and enzyme activity for important proteolytic enzymes during early development in the Pacific oyster Crassostrea gigas. Comput. Biochem. and Physiol. Part B: Biochem. Mol. Biol. 2003, 136, 383-392. (42) Cary, T. L.; Chandler, G. T.; Volz, D. C.; Walsh, S. S.; Ferry, J. L. Phenylpyrazole insecticide fipronil induces male infertility in the estuarine meiobenthic crustacean Amphiascus tenuiremis. Environ. Sci. Technol. 2004, 38, 522-528. (43) Volz, D. C.; Chandler, G. T. An enzyme-linked immunosorbent assay for lipovitellin quantification in copepods: a screening tool for endocrine toxicity. Environ. Toxicol. Chem. 2004, 23 (2), 298-305. (44) Martin-Diaz, M. L.; Lincoln-Villena, A.; Bamber, S.; Blasco, J.; DelValls., T. An integrated approach using bioaccumulation and biomarker measurements in female shore crab, Carcinus maenas. Chemosphere 2005, 58(5), 615-626.
Received for review December 19, 2005. Revised manuscript received March 21, 2006. Accepted March 24, 2006. ES052537O
VOL. 40, NO. 11, 2006 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3645
