Cell-Laden Electroconductive Hydrogel Simulating Nerve Matrix To

Research Article Cite This: ACS Appl. Mater. Interfaces 2019, 11, 22152−22163

www.acsami.org

Cell-Laden Electroconductive Hydrogel Simulating Nerve Matrix To Deliver Electrical Cues and Promote Neurogenesis Chengheng Wu, Amin Liu, Suping Chen, Xiaofeng Zhang, Lu Chen, Yuda Zhu, Zhanwen Xiao, Jing Sun, Hongrong Luo,* and Hongsong Fan* National Engineering Research Center for Biomaterials, Sichuan University, Sichuan, Chengdu 610064, P. R. China

Downloaded via UNIV OF SOUTHERN INDIANA on July 23, 2019 at 08:45:05 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

S Supporting Information *

ABSTRACT: Natural nerve tissue is composed of nerve bundles with multiple aligned assembles, and matrix electroconductivity is beneficial to the transmission of intercellular electrical signals, or effectively deliver external electrical cues to cells. Herein, aiming at the biomimetic design of the extracellular matrix for neurons, we first synthesized electroconductive polypyrrole (PPy) nanoparticles with modified hydrophilicity to improve their uniformity in collagen hydrogel. Next, cell-laden collagen−PPy hybrid hydrogel microfibers with highly oriented microstructures were fabricated via a microfluidic chip. The hydrogel microfibers formed a biomimetic three-dimensional microenvironment for neurons, resulting from the native cell adhesion domains, oriented fibrous structures, and conductivity. The oriented fibrous microstructures enhanced neuron-like cells aligning with fibers’ axon; the matrix conductivity improved cell extension and upregulated neuralrelated gene expression; moreover, external electrical stimulation further promoted the neuronal functional expression. This mechanism was attributed to the electroconductive matrix and its delivered electrical stimulation to cells synergistically upregulated the expression of an L-type voltage-gated calcium channel, resulting in an increase in the intracellular calcium level, which in turn promoted neurogenesis. This approach has potential in constructing the biomimetic microenvironment for neurogenesis. KEYWORDS: cell-laden, electroconductive hydrogel, collagen, polypyrrole, electrical stimulation, tissue engineering

■

neuronal functional expression.14,15 These existing studies proved that neurons could connect with other cells more readily in the electroconductive matrix than the conventional insulated matrix, and external electrical stimulation applied on the electroconductive matrix could promote the functional expression of neurons cultured in the matrix. However, in tissue engineering and regenerative medicine, it is still challenging for both biomimetic design of the three-dimensional (3D) conductive matrix and the effective introduction of controllable external electrical stimulation onto cells encapsulated in the 3D matrix. On the other hand, it is well-known that as the extracellular microenvironment supports cell growth, the matrix should be bioactive for cell adhesion and for inducing specific cell spreading.16,17 Therefore, the matrix should be first

INTRODUCTION In nervous system, neurons communicate with other cells via electrical signals, which play a critical role in neural development and maturation.1,2 Hence, stimulation and transmission of electrical signals are crucial for neuronal survival, differentiation, and functional expression.3−5 As the important microenvironment for cell survival, the extracellular matrix (ECM) is no doubt acting as transferring media for signal transmission among cells or between cells and the matrix. Therefore, the cellular microenvironment composed of the electroconductive matrix is beneficial to the transmission of intercellular electrical signals or effectively deliver electrical stimulation (ES) to cells in the matrix when subjected to external electrical cues.6−8 Based on this meaning, biocompatible electroconductive substrates have been universally investigated to enhance the growth of electrically sensitive tissues,9−11 particularly nervous tissue,12,13 and in some cases, external electrical stimulation is also applied to enhance © 2019 American Chemical Society

Received: March 28, 2019 Accepted: June 4, 2019 Published: June 4, 2019 22152

DOI: 10.1021/acsami.9b05520 ACS Appl. Mater. Interfaces 2019, 11, 22152−22163

Research Article

ACS Applied Materials & Interfaces

activity of the matrix must be taken into account in the design of biomimetic ECM for neurogenesis.23 Up to now, most studies on electroconductive substrates for the regeneration of neural tissue and other electrically sensitive tissues are confined to two-dimensional (2D) electroconductive materials, which are far from the native extracellular environment in which cells are encapsulated in threedimension.24 This is because the synthesis of many materials with high conductivity is not biocompatible, for instance, it is usually necessary to add a cytotoxic oxidant during the polymerization of a conductive polymer,25 and a high voltage required for fabricating electroconductive fibers via electrospinning is noxious for in situ 3D encapsulation of cells.26,27 Besides, the physicochemical properties of conductive materials such as metals and carbon-based materials determine that they are not suitable for 3D encapsulation of cells, let along the construction of 3D bioactive extracellular microenvironment suitable for cell survival. It is well-known that cells in vivo are encapsulated in the 3D microenvironment and are stimulated by signals from the 3D microenvironment. Therefore, in tissue engineering, the 3D matrix has attracted more attention than the 2D system on account of its biomimetic performance. In recent years, some attempts have been made to construct electroconductive substrates by combining bioactive materials (e.g., hydrogels derived from natural ECM) with conductive dopants (e.g., gold nanoparticles (NPs), graphene oxide, and conductive polymers).7,28−30 Nevertheless, the surface coating of conductive materials and construction of the 2D substrate are still dominant because it is difficult for many conductive dopants to evenly disperse in the hydrogel precursor due to their hydrophobic surfaces.31,32 To solve this problem,

equipped with cellular adhesive domains such as the RGD sequence18 in the matrix molecules (Scheme 1). At the same Scheme 1. Pivotal Elements and Strategies for Designing the Neural Microenvironment

time, on account of the multiple aligned neurocyte−matrix assemblies in natural nerve bundles,19 the oriented micro/ nanostructures of the matrix are favorable to guide neurite growth along the specific direction, thus promoting neurogenesis.20−22 In addition, the transmission of electrical signals along the interior orientation of the matrix and synergistic enhancement of neural function could be achieved by combining the oriented microstructure with the electroconductivity of the matrix. Therefore, besides the electroconductivity, the oriented microstructure and desired bio-

Scheme 2. Schematic Illustration of (a) Synthesizing PPy NPs in an Aqueous Dispersion and (b) Constructing Cell-Laden PPy-Incorporated Collagen Hydrogel Microfibera

a The electroconductive microfibers with special orientation facilitate the elongation of neurons orderly along the axon and the transduction of electrical signals among neurons, and the fibrous structure is beneficial for the application of electrical stimulation on neurons in the microfiber, finally the neurogenesis of neurons would be synergistically promoted by the conductive matrix and external electrical stimulation.

22153


Research Article


Characterization of PPy NPs. The morphology of the prepared PPy NPs was monitored using a scanning electron microscope (SEM, S-4800, Hitachi, Japan). The size distribution of the PPy NPs in aqueous solution was measured by dynamic light scattering (DLS, Nano-ZS, Malvern Instruments, Ltd.). A Fourier transform infrared (FT-IR) spectrophotometer (Nicolet 6700, Thermo Fisher Scientific Inc.) was also used to characterize the prepared PPy NPs after lyophilization. Preparation of Col−PPy Hybrid Hydrogel Microfibers. The hybrid hydrogel microfibers were fabricated through a self-made microfluidic chip with a coaxial laminar flow device referring to previous reports21,41 (Scheme 2). 20% (w/v) PEG 2000 was dissolved in phosphate-buffered saline (PBS) to prepare PEG buffer solution. Collagen was dissolved in 0.5 M acetic acid solution and adjusted to pH = 7 by adding 5 M NaOH at 4 °C. The PPy dispersions produced by the above method were added to collagen solutions, with the final concentrations of PPy being 0, 0.1, 0.2, 0.5, and 1 mg/mL, respectively, and stirred evenly. To ensure the equivalent collagen concentration (6 mg/mL) in each hydrogel precursor solution, a certain amount of deionized water was added to the mixture (as shown in Table S1). Then each hydrogel precursor solution and PEG buffer solution were injected into syringes, respectively, and pumped into the inlets of microfluidic chips via Teflon tubes and pinheads. The syringes were set to syringe pumps (Longer Pump Co. Ltd., Baoding, China) to accurately control the flow rates of both the hydrogel precursor and PEG solution fluids at 50 μL/min. The outlet of the microfluidic chip with a 550 μm inner diameter was immersed in PEG buffer solution to harvest the hydrogel microfiber. On the other hand, for the measurement of conductivity and mechanical properties, the samples were prepared by a cylindrical polystyrene mold (⌀ 8 mm × 2.4 mm). Briefly, hydrogel precursor solutions were injected to the molds in a Petri dish (⌀ 35 mm), then 20% (w/v) PEG buffer solution was slowly pipetted into the Petri dish and submerged the molds to induce the gelation of collagen. After 10 min, Col−PPy hybrid hydrogels were separated from the molds. Characterization of Hybrid Hydrogels. Structural Characterization of Microfibers. A Leica DMi8A microscope was used to capture microscopy images for observation and measurement of the fibers’ diameter. The prepared microfibers were dehydrated by 30, 50, 60, 70, 80, 90, 95, and 100% (v/v) gradient ethanol, respectively, and then critical point dried. After being sputter-coated with 8 nm thick Au/Pd by E-1010 ION SPUTTER, the dried microfibers were imaged by scanning electron microscopy (SEM, S-4800, Hitachi, Japan) at 5.0 kV. Swelling Ratio. The microfiber samples for the swelling test were harvested in the same time period (2 min), followed by lyophilization. Dry weights (W0) were recorded and each sample was immersed into PBS solution and then placed into an incubator at 37 °C. The samples were then taken out at predetermined time points (1, 3, 6, 9, 12, and 24 h). The wet weight (W1) was recorded after the surface solution attached on the sample was quickly removed using filter paper. The swelling was calculated according to the following equation

appropriate modification of conductive nanoparticles to improve their hydrophilicity and uniform dispersion in hydrogels has been attempted. Recently, Shin et al.33 revealed that improving the hydrophilicity of carbon nanotubes facilitated their uniform dispersion in hyaluronic acid (HA) hydrogel, and subsequently, neuronal differentiation of neural progenitor cells was enhanced in the electroconductive 3D HA hydrogel. However, this conductive hydrogel is far from satisfaction due to the lack of adhesion sites and the oriented microstructure in the matrix. Considering the abundant adhesion sites in collagen, the main component of natural ECM with excellent biocompatibility34 and the fibrous structure of self-assembled collagen molecules,35 it is more promising to biomimetically construct an electroconductive matrix based on collagen hydrogel for the application in neural regeneration. As for the conductive dopants, polypyrrole (PPy) has high potential owing to its favorable conductivity and outstanding biocompatibility,36,37 but it is still necessary to improve the hydrophilicity of PPy due to the requirement for uniform dispersion in the hydrogel as mentioned above. The pivotal elements and strategies for designing a perfect neural microenvironment are shown in Scheme 1. Based on the above summary, this study aims to build a biomimetic 3D matrix environment platform for neuronal cells and provide a promising tissue-engineering scaffold to improve neural regeneration. The design is schematically illustrated in Scheme 2. First, water-dispersible PPy nanoparticles (PPy NPs) with high electroconductivity and good biocompatibility were readily synthesized through a microemulsion method (Scheme 2a). Then, based on the requirements of neuronal ECM for adhesion domains, fibrous orientation, electroconductivity, and application of electrical stimulation, cellladen hydrogel microfiber combined with PPy NPs and collagen was constructed using a microfluidic chip with coaxial laminar flow. Subsequently, the effects of the electroconductive microenvironment and its mediated electrical stimulation on the neural functional expression of rat pheochromocytoma (PC12) cells were emphatically investigated. Furthermore, the mechanism of the electroconductive matrix and electrical stimulation on neurogenesis was tentatively clarified.

■

MATERIALS AND METHODS

Materials. Type I collagen (Col) was extracted from calfskin by pepsin treatment and salt precipitation as previous reports.38 40,6Diamidino-2-phenylindole (DAPI), fluorescein diacetate (FDA), and propidium iodide (PI) were purchased from Sigma-Aldrich. Pyrrole (Py) and ferric chloride hexahydrate (FeCl3·6H2O) were obtained from Shanghai Aladdin Industrial Corporation (China). Methyl thiazolyltetrazolium (MTT) was purchased from Sigma-Aldrich. Sodium hydroxide (NaOH), acetic acid, poly(ethylene glycol) (PEG) with a molecular weight (MW) of 2000 (PEG 2000), and poly(vinyl alcohol) (PVA; MW ∼ 31 000) were obtained from Kelong Chem. Co. (China). Preparation of Water-Dispersible PPy NPs. PPy NPs were synthesized as previously described.39,40 Briefly, 1.5 g of PVA was dissolved in 20 mL of deionized water, then kept in a drying oven (60 °C) to facilitate the dissolution of PVA, followed by cooling to room temperature. 1.2434 g of FeCl3·6H2O was added to the solution and kept stirring for 1 h. After another 1 h of equilibration, 140 μL of Py was added dropwise into the solution in an ice-bath. To fabricate PPy NPs, the temperature of the reaction system was controlled at 5 °C for 4 h with stirring. At the end of the reaction, the PPy NPs were centrifugally washed with deionized water three times to remove dissolvable impurities. 1 mL of PPy-deionized water dispersion solution was lyophilized and weighed to ascertain the concentration.

(W1 − W0)/W0 × 100% Electrical Conductivity. Electrical conductivity of hybrid hydrogels was measured by the RST-9 four-point probe resistivity measurement system (Guangzhou, China). The resulting values of three parallel samples were averaged. Mechanical Properties. First, compressive modulus of hybrid hydrogels was measured by dynamic mechanical analysis (DMA, TAQ800) at an amplitude of 20 mm with 5 mN prestress. In addition, nanoindentation analysis was carried out using the displacementcontrolled Piuma Chiaro Nanoindenter (Optics11, Netherland). A spherical tip with a radius of 49 μm was used to measure the Young’s modulus of Col 0. All measurements were performed in air by gluing samples onto a glass slide. A 9 × 9 array with a step size of 20 μm was recorded for each sample. Cell Culture and Cell Encapsulation. PC12 cells (Type Culture Collection of the Chinese Academy of Science, Shanghai, China) that 22154


Research Article

ACS Applied Materials & Interfaces Table 1. Primer Sequences for Targeted Genes gene

forward primer

reverse primer

tubulin-β3 Cacnb3 NF-66 GAPDH

ATTCTGGTGGACCTGGAG ACTGAGCTGGGATGCTGCT AGGCTGGAAGGTAAACTCAGAC AACCTGCCAAGTATGATGAC

CACTCTGACCGAAGATAAAGTT ACAGGTTTGTGCTTGGCTCT CAATTCCAGGAGTGAAGCAGGA GGAGTTGCTGTTGAAGTCA

Figure 1. Characterization of PPy NPs and Col−PPy hybrid hydrogels. (a) SEM image, (b) hydrodynamic size distribution, and (c) the FT-IR spectrum of the prepared PPy NPs with excellent monodispersity and uniform size. (d) Images of collagen solutions with two different kinds of PPy NPs before and after vibration and centrifugation. (e) Images of collagen solutions (top) and hydrogel bulks (bottom) with different PPy concentrations. (f) Words composed of hydrogel microfiber bundles. The concentration of PPy increases with the black arrow. (g) Bright field images of five hydrogel microfibers, scale bars = 250 μm. had been induced to differentiate by the nerve growth factor were cultured in high glucose Dulbecco’s modified Eagle’s medium (Hyclone, China) supplemented with 10% fetal bovine serum (TBDscience, China) and 1% penicillin/streptomycin (Hyclone) and cultivated in standard conditions (37 °C, 5%CO2 and 95% humidity). The cells were passaged once every 3 days using trypsin− ethylenediaminetetraacetic acid (EDTA) (0.25% v/v). The PC12 cells that detached from the Petri dish at 80% confluence were mixed evenly in the hydrogel precursor solutions at 1 × 107 cells/mL. Then, the hydrogel microfibers were fabricated similar to the above-mentioned process. Cell-encapsulated microfibers were received in a PEG buffer solution pool and then submerged in PBS solution for several minutes to remove superfluous PEG buffer, followed by transferring to Petri dishes filled with culture medium. The culture dishes were placed in standard culture conditions. The cell-laden microfibers were cultured continuously and the medium was changed every 2 days. Cell Viability and Morphology. The in vitro cell viability was measured at 1, 4, and 7 days via a standard MTT assay and FDA/PI double staining. The cell-laden microfibers that collected in the same time period (1 min) were taken out after being cultured for 1, 4, and 7 days and incubated with MTT (0.5 mg/mL in PBS) at 37 °C for 4 h. Then, the solutions were removed, replaced with 1 mL dimethyl sulfoxide (DMSO), followed by stirring for 30 min, and the absorbance of these solutions at 490 nm was measured by a multidetection microplate reader (BioTek Instruments Inc.). More-

over, the hydrogel microfibers were stained with a mixed solution of 100 μM FDA and 60 μM PI for 1 min, then observed and imaged by a confocal laser scanning microscope (CLSM, Leica-TCS-SP5). For actin cytoskeleton staining, cell-laden microfibers were washed with PBS and then fixed in 4% paraformaldehyde solution for 15 min at room temperature. Subsequently, the samples were incubated in 50 μg/mL fluorescein isothiocyanate-labeled phalloidin for 45 min. Then, the microfibers were washed with PBS and incubated in 0.1% (v/v) DAPI for 5 min, finally washed for CLSM imaging. Cell orientation angles were analyzed by measuring the intersection angle between the direction of cell elongation and fiber’s axial direction according to the F-actin staining images using NIH ImageJ software. Electric Field Stimulation for Cell-Laden Microfibers. Electrical stimulation (ES) was performed on an XPX116-B constant voltage resource (Shanghai, China). When PC12 cells spread well within the hydrogel microfibers after 4 days of culturing in standard conditions, some cell-laden microfibers of each group were taken out and stimulated via a self-made device. The continual electrical stimulation of 100 mV/cm was exerted onto cells through hydrogel microfibers 1 h/day. After 3 days of ES and another 12 h of culturing, the stimulated and nonstimulated cell-laden microfibers were studied further by FDA/PI staining, immunostaining, and quantitative gene expressions. Immunofluorescence Staining. At the predetermined time, cellladen microfibers were analyzed through immunostaining. In brief, the microfibers were washed with PBS to remove the residual medium 22155


Research Article


Figure 2. Structural and physical characterization of hybrid hydrogels. (a) SEM images of pure and PPy-incorporated collagen hydrogel microfibers, white arrows indicate the direction of microfibers’ axon; (b) swelling ratios of collagen hydrogel microfibers upon incubation at 37 °C in PBS (n = 3); (c) electroconductivity and (d) compressive modulus of the five types of hydrogels (n = 3, * p < 0.05). (e, f) Distribution of the Young’s modulus in Col 0. and fixed in 4% (w/v) paraformaldehyde for 15 min. Then, 0.2% (v/ v) Triton X-100 was added to the microfibers for permeabilization of cells. Afterward, 10% (v/v) goat serum was used to block nonspecific adsorption for 30 min at room temperature. Subsequently, the sample was incubated with the target primary antibody at 4 °C overnight. The target primary antibodies used were the rabbit polyclonal antiZO-1 (Affinity Bioscience), rabbit polyclonal anti-tubulin-β3 (Sigma), and mouse monoclonal anti-L-type Ca2+ channel protein β3 (Santa Cruz), respectively. After primary antibody binding, the microfibers were washed with PBS four times (10 min for each wash) and then incubated with second antibodies, fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Invitrogen), rhodamine-conjugated goat anti-rabbit IgG (Invitrogen), and fluorescein isothiocyanate-conjugated rabbit anti-mouse IgG (Invitrogen), respectively, for 1 h at room temperature in the dark. The samples were incubated with 0.1% (v/v) DAPI for the staining of nuclei and finally washed three times for CLSM images. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR). Gene expression related to neurogenesis and calcium channel proteins, including, tubulin-β3, neurofilament-66 (NF-66), and calcium voltage-gated channel auxiliary subunit β 3 (Cacnb3), were assessed by RT-PCR. For RT-PCR analysis, RNA of cells was extracted by the RNeasy Mini Kit (Qiagen) and then reversely transcribed into complementary DNA (cDNA) using the iScript cDNA Synthesis Kit (Bio-Rad). RT-PCR was performed with prepared cDNA on a CFX96t real-time PCR detection system (BioRad), according to the manufacturer’s instructions. Glyceraldehyde 3phosphate dehydrogenase (GAPDH) was also analyzed as the housekeeping gene to normalize the results. All of the sequences of primers are shown in Table 1. Calcium Imaging. On day 7 after encapsulation, the intracellular Ca2+ concentration in PC12 cells was measured using Fluo-4 AM (Beyotime, China), a Ca2+ sensitive indicator. Briefly, cell-laden hydrogel microfibers were washed with PBS three times (5 min each time) to remove the residual medium and incubated with 2 μM Fluo-

4 AM for 30 min at 37 °C. Subsequently, microfibers were immersed in PBS three times and then incubated in PBS at 37 °C for another 20 min. Time-series imaging was performed to observe the intracellular Ca2+ level using CLSM. The fluorescence intensity of each cell was defined by the region of interest (ROI) collected with NIH ImageJ software. All of the values of fluorescence intensities obtained throughout the time-series imaging were normalized to the value of the blank area. Statistical Analysis. All numerical data were presented as mean ± standard deviation. GraphPad Prism was used for statistical analysis of all of the groups with one-way or two-way analysis of variance. Significance levels were determined by * p < 0.05.

■

RESULTS AND DISCUSSION Characterization of Water-Dispersible PPy NPs and Construction of Col−PPy Hybrid Hydrogels. The waterdispersible PPy NPs were prepared through a water-soluble polymer/metal cation system (Scheme 2a). The hydroxyl groups of PVA chains co-ordinate with iron cations, which acted as the oxidizing agents for the chemical oxidation polymerization of the pyrrole monomer, and the resulting PPy NPs were stabilized in water by soluble PVA chains.40 As shown in Figure 1a, the SEM image indicates that PPy NPs with uniform morphology and excellent monodispersity were fabricated, and the diameter of NPs is approximately 70 nm. DLS analysis of PPy NPs in aqueous solution shows that the average size is of 74.12 nm (Figure 1b), which is consistent with SEM analysis. Subsequently, the FT-IR spectrum was recorded as shown in Figure 1c, in which the typical peaks of 1552, 1317, 1187, and 917 cm−1 prove the successful preparation of PPy according to the literature.42,43 These data proved that PPy NPs with excellent monodispersity in aqueous solution and with a diameter of about 70 nm were 22156


Research Article


to the addition of superabundant PPy that hindered the oriented self-assembly of collagen fibrils. Incorporation of the electroconductive PPy NPs significantly changed the physical properties of the hybrid hydrogel microfibers. The swelling ratio of hydrogels in PBS was measured and demonstrated in Figure 2b, as for all five groups, a dramatical increase of swelling was observed from 0 to 3 h, and the tendency of swelling declined from 3 to 12 h. After 12 h, all samples had nearly reached the equilibrium swelling level. Furthermore, the swelling ratio of hydrogels decreased at any point-in-time as the concentration of PPy increased because the 3D space of hydrogels was partially occupied by PPy NPs. Since electrical conductivity is one of the most momentous properties for the neural scaffold, the electroconductivity of the hybrid hydrogels was measured using a four-point probe (Figure 2c). There was no significant difference between Col 0 and Col 0.1 owing to the insufficient PPy in Col 0.1. However, upon the addition of 0.2, 0.5, and 1 mg/mL PPy, the conductivity increased by 2.6-, 8.7-, and 18.4-fold, respectively. In particular, the electroconductivity of Col 0.5 was 0.22 S/m, which matches the conductivity of many natural tissues, including nerve tissue.44 Theoretically, the transmission of electrical signals in Col 0.5 with such conductivity should be more facile than Col 0. Synthetically considering the electroconductivity of the collagen hydrogel and the formation of oriented collagen fibrils in the hydrogel, Col 0.5 is a more appropriate extracellular microenvironment for neurons. Thus, in the following electrical stimulation experiments, we selected Col 0.5 instead of Col 1 as the experimental group to investigate the regulation of cellular behavior and response when subjected to electrical stimulation. Dynamic mechanical analysis (DMA) was performed to measure the compressive modulus of the hybrid hydrogels (Figure 2d). As the concentration of PPy increased from 0 to 1 mg/mL, the compressive modulus of five groups did not change prominently, no significant difference was found among each group, indicating that the addition of PPy did not alter the compressive strength of collagen hydrogels. This further proved that PPy was evenly monodispersed in collagen hydrogels. It still should be noted that the compressive modulus of the five groups was close to native neural tissue.45 Moreover, to explore whether the micromechanical properties of hydrogels match the macroscopic mechanics, a nanoindenter was used to accurately measure the Young’s modulus distribution on Col 0 since no significant difference was observed among all of the samples in compressive modulus. Figure 2e,f records a 9 × 9 array with a step size of 20 μm, showing that the microscopic Young’s modulus distribution within Col 0 was uniform, and the average modulus of all 81 spots was 2.46 ± 0.51 kPa, which matches well with DMA analysis. The above results confirmed that our hybrid hydrogels possess favorable conductivity and mechanical properties that match with natural nervous tissue. The electroconductive hydrogel microfibers with eminent oriented structures in micro/nanoscale should have great potential to be constructed as neural scaffolds, which was further investigated by following in vitro cell experiments. Cell Viability and Spreading in Hybrid Hydrogel Microfibers. As the microenvironment supports the growth of nerve cells, the hybrid hydrogel should have excellent cytocompatibility, and more importantly, induce nerve cells orienting within the hydrogel. Cell viability of PC12 cells in

successfully prepared. This should be due to the fact that the complexation of Fe3+ with the water-soluble PVA chain resulted in a slow polymerization of PPy, and during the polymerization, the water-soluble PVA provided sufficient steric stability for the nuclei of PPy NPs. Therefore, the surface hydrophilicity of PPy NPs was improved, and thus excellent monodispersity in aqueous solution was observed, which together contribute the uniform composite in the collagen hydrogel. Next, the prepared aqueous dispersion of PPy NPs was added to collagen solutions to obtain hydrogel precursor solutions with different concentrations of PPy (Table S1). As exhibited in Figure 1d, the PPy NPs evenly dispersed in collagen solution after 1 min of vibration even after 5 min of centrifugation (10 000 rpm), indicating the excellent monodispersity of PPy NPs in the collagen precursor. In contrast, PPy NPs synthesized by conventional chemical oxidation of pyrrole using FeCl3 without PVA showed unsatisfactory dispersion in collagen solution after vibration, and PPy NPs were even found in the supernatant after centrifugation. Figure 1e demonstrates that as the concentration of PPy NPs increased, the color of the resulting Col−PPy hybrid hydrogel precursors and the corresponding hydrogel bulks changed from transparent to black. A similar tendency is observed in Figure 1f, hydrogel microfiber bundles, fabricated as shown in Scheme 2b (without cells), were placed in the shape of different letters, respectively, to make up words “SCUCD” (Sichuan University, Chengdu) and “PANDA” (representing a national treasure of China). The bright field images exhibited in Figure 1g indicates that continuous hydrogel microfibers could be obtained through the microfluidic chip, in which the formation of collagen fibrils was triggered by the flow of PEG buffer, and the transparency of the hydrogel decreased with the increase of PPy concentration. In addition, the diameter of each group of hydrogel microfibers was measured through these bright field images. As shown in Table S2, there was no significant difference among the five groups in diameter, indicating that the formation of microfibers was not affected by the addition of PPy NPs. Similarly, with the augment of PPy NPs, the color of fibers was deepened, and all groups showed homogeneous color, indicating the uniform distribution of PPy within microfibers. The results proved that the Col−PPy composite hydrogel with excellent uniformity was readily prepared and the water-soluble PVA contributed to the remarkable dispersity of PPy and its uniform incorporation in the collagen hydrogel. Structural and Physical Characterization of Hybrid Hydrogels. SEM images of microfibers were taken to observe the distribution of PPy NPs within hydrogel microfibers and the internal structures of microfibers. Figures 2a and S1 illustrate that PPy NPs were evenly distributed in all of the hybrid hydrogel microfibers (Col 0.1, Col 0.2, Col 0.5, and Col 1), and no agglomerate of PPy was found due to the excellent monodispersity of PPy NPs in aqueous solution. On the other hand, the evident aligned orientation of collagen fibrils within the microfibers was observed in Col 0, Col 0.1, Col 0.2, and Col 0.5, respectively (shown as white arrows). This orientation of collagen fibrils was due to the shear force provided by PEG buffer flow that forced the assembled collagen fibrils to align with the direction of flow, which was similar to the previous report.21 This oriented structure of microfibers is essential to the neural scaffold in consideration of multiple aligned neurocyte−matrix assemblies. Differently, no evident collagen fibril was found in Col 1 (Figure S1), which may be attributed 22157


Research Article


and demonstrated the characteristics of oriented extension. Evident cell spreading and elongating along the microfibers and cell−cell contact networks were also observed on day 7. In addition, the immunofluorescence staining of ZO-1, a tight junction protein that participates directly in the control of gene expression, was performed to characterize the cell junction. As shown in Figure S3, on day 4, the expression levels of ZO-1 in PC12 cells of three groups were as low as negligible. After 7 days of culture, the expression of ZO-1 increased significantly in all three groups. The enhanced expression of ZO-1 on day 7 indicated that the cell−cell interaction was increased in all groups. The cells elongating along the microfibers was further confirmed by statistical analysis of orientation angles at which cells and fibers formed according to the F-actin/DAPI staining on day 4 (Figure 4b). The results exhibited that the PC12 cells oriented along fiber axon with angles below 15° were 66.9, 67.6, and 62.04% in Col 0, Col 0.2, and Col 0.5, respectively, without significant difference. In contrast, PC12 cells encapsulated in hydrogel bulk of Col 0 showed randomly oriented adhesion and extension (Figures 4b and S4). It was the aligned oriented collagen fibrils (as shown in Figure 2a) that induced the orientation of PC12 cells in all microfibers, which is crucial to neurogenesis since the natural peripheral nerve bundles are composed of multiple neurocyte−matrix assemblies. To further investigate the effect of the electroconductive matrix on the growth of PC12 cells, the length of the cells in microfibers were measured and statistically analyzed on the basis of F-actin/DAPI staining on day 1 and day 4 (Figure 4c). The cells in Col 0.5 showed longer length than Col 0 on both time points, indicating that the moderate PPy NPs promoted elongation of PC12 cells. This increased elongation of PC12 cells in Col 0.5 should be due to the enhanced electroconductivity that promotes the transferring of electrical signals, as well as the communication among the cells. These results demonstrated that our PPy-incorporated collagen microfibers not only have prominent cytocompatibility but also with bioactivity to promote aligned elongation of PC12 cells on account of the oriented collagen fibrils within microfibers. Besides, the extension of PC12 cells was facilitated in Col 0.5 owing to its eminent electroconductivity. Enhanced Neurogenesis of PC12 Cells in Electroconductive Hydrogel Microfibers. The effect of the electroconductive matrix on early neurogenesis was investigated by immunofluorescence staining and quantitative RTPCR (Figure 5). First, the expression of tubulin-β3, a specific protein marker associated with neurogenesis, was analyzed by immunofluorescence staining after 4 days of culture. From Figure 5a, substantial expression of tubulin-β3 in PC12 cells was observed in all groups, whereas a notable upregulated expression was found in Col 0.5, which is consistent with the statistical analysis of mean density (Figure 5c). It is believed that electrical activities generated by environmental cues can activate voltage-gated calcium ion channels, leading to an elevated intracellular Ca2+ ion level, which plays a crucial role in early neurogenesis.47 Consequently, protein expression of the L-type voltage-gated calcium channel (L-VGCC) was characterized through immunofluorescence staining on day 4 (Figure 5b). Compared to others, obvious incremental expression of L-VGCC was found in PC12 cells encapsulated in Col 0.5. The mean density of L-VGCC based on CLSM images was analyzed, and the result exhibited that the expression in Col 0.5 is significantly stronger than that in Col 0 and Col 0.2 (Figure 5d). Furthermore, the efficacy of

hydrogel microfibers was evaluated by the MTT assay (Figure S2). The result showed that PC12 cells revealed an obvious proliferation tendency with prolonged culture time in all groups of microfibers except for Col 1, indicating that the hydrogel microfibers of Col 0, Col 0.1, Col 0.2, and Col 0.5 was cytocompatible. However, the proliferation of PC12 cells in Col 1 microfiber was restrained, which should be attributed to the existence of superabundant PPy NPs within the microfiber that occupied the space of cell growth and spreading.46 Next, microfibers of Col 0, Col 0.2, and Col 0.5 were further studied in the next experiment given that no significant difference was found between Col 0 and Col 0.1 in terms of electrical conductivity, mechanical properties, and cytotoxicity, as well as suppressed cell proliferation in Col 1. FDA/PI staining was performed to investigate the viability, proliferation, and extension of PC12 cells encapsulated in hydrogel microfibers. As shown in Figure 3, the majority of

Figure 3. FDA (green)/PI (red) staining of PC12 cells cultured in hybrid hydrogel microfibers after 1, 4, and 7 days.

PC12 cells encapsulated in hydrogel microfibers are viable on day 1, indicating that the fabrication process of cell-laden microfibers had a negligible effect on cell viability. In addition, a few cells exhibited the tendency of extension along with microfibers. After 4 days of culture, the cells in all of the groups maintained high activity and spread along the microfibers’ axon. Moreover, evident cell−cell contact networks were discovered in all groups on day 7, which is believed to be beneficial for cellular functional expression. The results indicated that the obtained microfibers provide the bioactive 3D microenvironment for the survival and spreading of PC12 cells, and the introduction of electroconductive PPy NPs maintained the activity of oriented collagen microfibers upon elongation of PC12 cells. Cell morphologies were ulteriorly observed by F-actin/DAPI staining (Figure 4a). On day 1 after encapsulation, the majority of PC12 cells exhibited round shape, a few cells had begun to elongate, which was in accord with FDA/PI staining. More and more cells spread and extended in microfibers after 4 days, the majority of cells were found elongating along the microfibers 22158


Research Article


Figure 4. (a) F-actin (green)/DAPI (blue) staining images of PC12 cells encapsulated in three samples after 1, 4, and 7 days. (b) Statistical analysis of PC12 cell orientation (polar graph) after 7 days (n ≥ 100). (c) Boxplot of PC12 cells’ length after 1 and 4 days according to F-actin/DAPI staining (n ≥ 40, * p < 0.05).

differentiation and maturation, was also elevated in PC12 cells that were cultured in Col 0.5. The above results indicate that electroconductive hydrogel microfibers, Col 0.5, could dramatically promote the neural functional expression of PC12 cells. It is also worth noting that no growth factor was added to the culture medium in this case. This improved neurogenesis should be attributed to the enhanced conductivity that contributes to the effective transmission of electrical signals. In addition, we assumed that the intensive electrophysiological activities of PC12 cells generated by electroconductive environmental cues gave rise to the incremental expression level of genes encoding L-VGCC, promoting more calcium ions entering into the cells, thus leading to enhanced neurogenesis. As for Col 0.2, no significant difference in neurogenesis or the production of VGCC was observed when compared to Col 0 due to the weak conductivity brought by inadequate PPy. These results demonstrated the importance of matrix conductivity for neural regeneration and functional expression in a 3D microenvironment. Impact of External Electrical Stimulation Delivered through Conductive Matrix on Neurogenesis. A selfmade device of exerting electrical stimulation (ES) on cellladen microfibers was used to investigate the capability of electrical stimulation for promoting neurogenesis (Figures 6a and S5). Then, 100 mV/cm of electrical stimulation was exerted on cell-laden microfibers for 1 h every day from day 4, since cells had completely adhered to substrates according to the consequence of F-actin/DAPI staining in Figure 4a. After three times of stimulation (i.e., on day 7), the MTT assay and FDA/PI staining were utilized to evaluate the cytocompatibility of external electrical stimulation (Figures S6 and 6b). In all three groups, whether the electrical field was applied or not, PC12 cells in the collagen microfibers showed satisfactory viability, indicating that our procedure of stimulation is compatible for cells.

Figure 5. Immunofluorescence staining of tubulin-β3/DAPI (a) and L-VGCC/DAPI (b), in which white arrow indicates an obvious fluorescence signal, and the statistical analysis of mean density from the corresponding immunofluorescence images (c, d); (e−g) quantitative gene expressions of PC12 cells in various samples after 1 and 4 days (n = 3, * p < 0.05).

electrically conductive hydrogel microfibers in improving neurogenesis was also evaluated by quantitative RT-PCR. As exhibited in Figure 5e−g, there was no significant difference in the expression of any targeted genes among all samples on day 1. With prolonged culture time, the expression of all concerned genes increased in all groups, especially, upregulated expressions of both tubulin-β3 and Cacnb3 (calcium voltagegated channel auxiliary subunit β3) were found in Col 0.5 when compared to expressions in Col 0, which is in accord with the results of immunofluorescence staining. Similarly, neurofilament-66 (NF-66), which plays an essential role in neurite outgrowth and is expressed in neurons undergoing 22159


Research Article


Figure 6. (a) Schematic illustration of the self-made device of exerting electrical stimulation on cell-laden microfibers. (b) FDA/PI staining, immunofluorescence staining of tubulin β3/DAPI(c), and L-VGCC/DAPI (d) of various samples with or without ES after 7 days, white arrow indicates an obvious fluorescence signal. (e−g) Quantitative gene expressions of PC12 cells in various hydrogel microfibers after 7 days (n = 3, * p < 0.05).

stimulation either in Col 0 or Col 0.2. As for the expression of cacnb3, the similar tendency with tubulin-β3 was observed in all groups, Col 0.5 with electrical stimulation showed the highest expression level (Figure 6f). Expression levels of NF-66 in all groups were also evaluated (Figure 6g), although no difference was found among three groups without applied electrical stimulation, all groups showed distinct ascent in the expressions of NF-66 after ES, especially, the increase in Col 0.5 was much higher than that of others. Interestingly, there was no difference in the expression of three studied genes between Col 0 and Col 0.2 whether ES was applied or not. These results demonstrated that our procedure of ES on cell-laden microfibers is cyto-nontoxic. Besides the electroconductive matrix, external ES delivered through the matrix could promote the production of proteins related to neurogenesis or calcium ion channels. In particular, Col 0.5 with the highest electroconductivity transmitted electrical signals to cells more effectively when subjected to ES. Therefore, enhanced neurogenesis was found in Col 0.5 after three times of ES, which was considered to attribute to the improved expression of genes and proteins related to the calcium ion channels. ES only significantly promoted neurogenesis of PC12 cells in Col 0.5, indicating that the conductivity of the matrix is an important factor for transmitting external electrical stimulation signals to cells.

Afterward, the impact of external electrical stimulation on neurogenesis was investigated by immunofluorescence staining and RT-PCR. The CLSM images in Figure 6c,d illustrate that as the concentrate of PPy NPs increased, protein expressions of tubulin-β3 and L-VGCC showed a tendency of augmenting, indicating that the incorporated PPy promoted the neurogenesis of PC12 cells, which was further verified by the statistical analysis of cells’ positive rate according to the corresponding CLSM images (Figure S7). These results were in accordance with that on day 4. More importantly, after three times of ES, the increased protein expressions of tubulin-β3 and L-VGCC were found in every sample when compared to the sample without ES, particularly in Col 0.5. From the CLSM images and statistics of cells’ positive rate (Figure S7), after ES, the rate of cells in Col 0.5 that had expressed tubulinβ3 and L-VGCC was 95.17 ± 2.39 and 95.80 ± 1.61%, respectively, which was significantly higher than the cells in Col 0 and Col 0.2. Subsequently, RT-PCR was performed to evaluate the expression of genes related to neurogenesis of PC12 cells in microfibers with/without ES. As exhibited in Figure 6e, without electrical stimulation, slight incremental gene expression of tubulin-β3 on day 7 was found in Col 0.5 when compared to Col 0. After three times of ES, the expression of tubulin-β3 in Col 0.5 was increased by 2.2-fold; however, there was no significant difference with or without electrical 22160


Research Article

ACS Applied Materials & Interfaces Mechanism of Enhanced Neurogenesis by Conductive Matrix and External Electrical Stimulation. Ultimately, the mechanism of increased matrix conductivity and ES to induce neurogenesis was investigated. In the above works, we have manifested that both the electroconductive matrix and ES could promote the protein expression of L-VGCC, which is believed to be able to regulate the intracellular calcium ion concentration by regulating influx or efflux from the extracellular matrix. Subsequently, the intracellular Ca2+ concentration ([Ca2+]i) of PC12 cells encapsulated in Col 0 and Col 0.5 was evaluated by Fluo-4 AM, since no difference in neurogenesis was found between Col 0 and Col 0.2 whether ES was applied or not. As shown in Figure 7a,b, during the

stimulation, Col 0.5 could transmit the external electrical signals to cells in it more effortlessly than Col 0, resulting in upregulation of L-VGCC and in turn resulting in Ca2+ influx. Previous studies have demonstrated that the upregulated expression of voltage-gated calcium ion channels and the resulting increase of [Ca2+]i can regulate neurogenesis-related gene expression both directly and indirectly.33,47 Therefore, the electroconductive matrix promoted the neurogenesis of PC12 cells in Col 0.5. On the other hand, electrical field stimulation has been shown to enhance and direct nerve growth by turning neuronal growth cone and inducing asymmetries of receptors, second messengers, and cytoskeletal molecules.5 In this work, as an important second messenger, [Ca2+ ]i increased significantly in Col 0.5 after ES, resulting from the enhanced expression of L-VGCC. These results support our hypothesis that the electroconductive microenvironment and application of ES synergistically enhanced the expression of L-VGCC, resulting in elevated intracellular Ca2+ concentrations. Then intracellular signaling cascades were activated, which contributed to the upregulation of genes related to neurogenesis, eventually promoting the neurogenesis of PC12 cells, as schematically exhibited in Figure 7d.

■

CONCLUSIONS Water-dispersible PPy NPs were successfully synthesized by a microemulsion method and evenly doped into collagen hydrogel to effectively improve the electroconductivity of collagen hydrogel. Through a capillary-based microfluidic chip, 3D cell-laden hybrid hydrogel microfibers with highly oriented microstructures were successfully fabricated. The hybrid hydrogel fibers formed a bioactive extracellular matrix with excellent cytocompatibility and guided PC12 cells to align with the fiber axon. More importantly, the hydrogel microfibers with enhanced electroconductivity promoted the neurogenesis of PC12 cells. At the same time, the fibrous structure facilitated the delivery of external electrical stimulation in the 3D matrix. Therefore, the as-prepared conductive matrix played an important role in mediating the delivery of external electrical cues between the matrix and cells and further improved the neurogenesis significantly. Further investigation demonstrated that the 3D conductive environment and the effective electrical stimulation mediated by the matrix enhanced neurogenesis by upregulating expression of calcium channels, resulting in facilitated intracellular calcium influx of PC12 cells encapsulated in microfiber, and the activation of neurogenesis-related gene expression. To the best of our acknowledge, this is the first approach that the bioactivity, electroconductivity, and orientation of the matrix and simple application of moderate electrical stimulation on cells in the 3D matrix are simultaneously taken into account in the design of the neuronal microenvironment to promote neurogenesis. This 3D system of the hydrogel microfiber is meaningful due to its designing to mimic the shape of natural nerve bundles and the 3D microenvironment of natural neural cells. This approach showed great potential to construct the biomimetic 3D neural matrix for neural regeneration.

Figure 7. (a) Representative CLSM images of intracellular calcium (green) in various samples. (b) Quantitative analysis of calcium fluorescence intensities over time from the region of interest. (c) Statistical analysis of mean fluorescence intensity of intracellular calcium in various samples (n = 10, * p < 0.05). (d) Schematic illustration showing how matrix electroconductivity and external electrical stimulation promote neurogenesis of PC12 cells: (1) electrical cues and external electrical stimulation delivered through the conductive matrix synergistically stimulate PC12 cells, (2) the upregulated expression of L-VGCC resulted from the electrical cue results in (3) the increased Ca2+ influx acts on cells which in turn (4) activates the intracellular signal cascades, finally upregulates the related genes and promotes neurogenesis.

measurement, although no significant change was found in the [Ca2+]i of all samples in the time series, there were significant differences in [Ca2+]i between Col 0 and Col 0.5 with/without ES, which was further verified by the statistical mean Ca2+ fluorescence intensity of multiple cells (Figure 7c). The [Ca2+]i of cells in Col 0.5 was 1.91-fold as high as that in Col 0, and further increased after three times of ES. Dissimilarly, [Ca2+]i in Col 0 increased little after the application of ES. This is because the conductivity of Col 0 is much lower than that of Col 0.5. It is well-known that electroconductive substrates could deliver electrical signals more effectively than the insulated substrates. Therefore, when subjected to electrical

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsami.9b05520. 22161


Research Article


■

Composition of five hybrid hydrogels with different concentrations of PPy (Table S1); diameter statistics of hydrogel microfibers (Table S2); the SEM image of Col 1 (Figure S1); the MTT test (Figure S2); immunofluorescence staining of ZO-1/DAPI (Figure S3); representative F-actin (green)/DAPI (blue) staining image of PC12 cells (Figure S4); picture of the selfmade device (Figure S5); the MTT test for proliferation of PC12 cells (Figure S6); tubulin-β3 and L-VGCC positive rate of PC12 cells (Figure S7) (PDF)

(12) Fabbro, A.; Scaini, D.; León, V.; Vázquez, E.; Cellot, G.; Privitera, G.; Lombardi, L.; Torrisi, F.; Tomarchio, F.; Bonaccorso, F.; et al. Graphene-Based Interfaces Do Not Alter Target Nerve Cells. ACS Nano 2016, 10, 615−623. (13) Guiseppi-Elie, A. Electroconductive Hydrogels: Synthesis, Characterization and Biomedical Applications. Biomaterials 2010, 31, 2701−2716. (14) Zhang, J.; Qiu, K.; Sun, B.; et al. The Aligned Core−Sheath Nanofibers with Electrical Conductivity for Neural Tissue Engineering. J. Mater. Chem. B 2014, 2, 7945−7954. (15) Thrivikraman, G.; Madras, G.; Basu, B. Intermittent Electrical Stimuli for Guidance of Human Mesenchymal Stem Cell Lineage Commitment towards Neural-like Cells on Electroconductive Substrates. Biomaterials 2014, 35, 6219−6235. (16) Lehnert, D.; Wehrle-Haller, B.; David, C.; Weiland, U.; Ballestrem, C.; Imhof, B. A.; Bastmeyer, M. Cell Behaviour on Micropatterned Substrata: Limits of Extracellular Matrix Geometry for Spreading and Adhesion. J. Cell Sci. 2004, 117, 41−52. (17) Welsh, E. R.; Tirrell, D. A. Engineering the Extracellular Matrix: A Novel Approach to Polymeric Biomaterials. I. Control of the Physical Properties of Artificial Protein Matrices Designed to Support Adhesion of Vascular Endothelial Cells. Biomacromolecules 2000, 1, 23−30. (18) Liu, J. C.; Tirrell, D. A. Cell Response to RGD Density in Cross-linked Artificial Extracellular Matrix Protein Films. Biomacromolecules 2008, 9, 2984−2988. (19) Yang, Y.; Sun, J.; Liu, X.; Guo, Z.; He, Y.; Wei, D.; Zhong, M.; Guo, L.; Fan, H.; Zhang, X. Wet-spinning Fabrication of Shearpatterned Alginate Hydrogel Microfibers and the Guidance of Cell Alignment. Regener. Biomater. 2017, 4, 299−307. (20) Chang, Y.-C.; Chen, M.-H.; Liao, S.-Y.; Wu, H.-C.; Kuan, C.H.; Sun, J.-S.; Wang, T.-W. Multichanneled Nerve Guidance Conduit with Spatial Gradients of Neurotrophic Factors and Oriented Nanotopography for Repairing the Peripheral Nervous System. ACS Appl. Mater. Interfaces 2017, 9, 37623−37636. (21) Wei, D.; Sun, J.; Yang, Y.; Wu, C.; Chen, S.; Guo, Z.; Fan, H.; Zhang, X. Cell Alignment Guided by Nano/micro Oriented Collagen Fibers and the Synergistic Vascularization for Nervous Cell Functional Expression. Mater. Today Chem. 2018, 8, 85−95. (22) Yucel, D.; Kose, G. T.; Hasirci, V. Tissue Engineered, Guided Nerve tube Consisting of Aligned Neural Stem Cells and Astrocytes. Biomacromolecules 2010, 11, 3584−3591. (23) Yan, L.; Zhao, B.; Liu, X.; Li, X.; Zeng, C.; Shi, H.; Xu, X.; Lin, T.; Dai, L.; Liu, Y. Aligned Nanofibers from Polypyrrole/graphene as Electrodes for Regeneration of Optic Nerve via Electrical Stimulation. ACS Appl. Mater. Interfaces 2016, 8, 6834−6840. (24) Tekin, H.; Simmons, S.; Cummings, B.; Gao, L.; Adiconis, X.; Hession, C. C.; Ghoshal, A.; Dionne, D.; Choudhury, S. R.; Yesilyurt, V.; et al. Effects of 3D Culturing Conditions on the Transcriptomic Profile of Stem-cell-derived Neurons. Nat. Biomed. Eng. 2018, 2, 540− 554. (25) Yang, S.; Jang, L.; Kim, S.; Yang, J.; Yang, K.; Cho, S. W.; Lee, J. Y. Polypyrrole/Alginate Hybrid hydrogels: Electrically Conductive and Soft Biomaterials for Human Mesenchymal Stem Cell Culture and Potential Neural Tissue Engineering Applications. Macromol. Biosci. 2016, 16, 1653−1661. (26) Lee, J. Y.; Bashur, C. A.; Goldstein, A. S.; Schmidt, C. E. Polypyrrole-coated Electrospun PLGA Nanofibers for Neural Tissue Applications. Biomaterials 2009, 30, 4325−4335. (27) Xie, J.; MacEwan, M. R.; Willerth, S. M.; Li, X.; Moran, D. W.; Sakiyama-Elbert, S. E.; Xia, Y. Conductive Core−sheath Nanofibers and their Potential Application in Neural Tissue Engineering. Adv. Funct. Mater. 2009, 19, 2312−2318. (28) Navaei, A.; Saini, H.; Christenson, W.; Sullivan, R. T.; Ros, R.; Nikkhah, M. Gold Nanorod-Incorporated Gelatin-Based Conductive Hydrogels for Engineering Cardiac Tissue Constructs. Acta Biomater. 2016, 41, 133−146.

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (H.L.). *E-mail: [email protected] (H.F.). ORCID

Hongsong Fan: 0000-0003-3812-9208 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work is supported by the National Natural Science Foundation of China (Grants Nos. 51673128 and 51473098).

■

REFERENCES

(1) Galarreta, M.; Hestrin, S. Electrical Synapses Between GABAReleasing Interneurons. Nat. Rev. Neurosci. 2001, 2, 425−433. (2) Laughlin, S. B.; Sejnowski, T. J. Communication in Neuronal Networks. Science 2003, 301, 1870−1874. (3) Zhang, L. I.; Poo, M.-m. Electrical Activity and Development of Neural Circuits. Nat. Neurosci. 2001, 4, 1207−1214. (4) Huang, Y. J.; Wu, H. C.; Tai, N. H.; Wang, T. W. Carbon Nanotube Rope with Electrical Stimulation Promotes the Differentiation and Maturity of Neural Stem Cells. Small 2012, 8, 2869− 2877. (5) McCaig, C. D.; Rajnicek, A. M.; Song, B.; Zhao, M. Controlling Cell Behavior Electrically: Current Views and Future Potential. Physiol. Rev. 2005, 85, 943−978. (6) Mihic, A.; Cui, Z.; Wu, J.; Vlacic, G.; Miyagi, Y.; Li, S.-H.; Lu, S.; Sung, H.-W.; Weisel, R. D.; Li, R.-K. A Conductive Polymer Hydrogel Supports Cell Electrical Signaling and Improves Cardiac Function After Implantation into Myocardial Infarct. Circulation 2015, 132, 772−784. (7) Ryan, A. J.; Kearney, C. J.; Shen, N.; Khan, U.; Kelly, A. G.; Probst, C.; Brauchle, E.; Biccai, S.; Garciarena, C. D.; Vega-Mayoral, V.; et al. Electroconductive Biohybrid Collagen/Pristine Graphene Composite Biomaterials with Enhanced Biological Activity. Adv. Mater. 2018, 30, No. 1706442. (8) Schmidt, C. E.; Shastri, V. R.; Vacanti, J. P.; Langer, R. Stimulation of Neurite Outgrowth Using an Electrically Conducting Polymer. Proc. Natl. Acad. Sci. U.S.A. 1997, 94, 8948−8953. (9) Xu, Y.; Cui, M.; Patsis, P. A.; Günther, M.; Yang, X.; Eckert, K.; Zhang, Y. Reversibly Assembled Electroconductive Hydrogel via Host-guest Interaction for 3D Cell Culture. ACS Appl. Mater. Interfaces 2019, 11, 7715−7724. (10) Roshanbinfar, K.; Vogt, L.; Greber, B.; Diecke, S.; Boccaccini, A. R.; Scheibel, T.; Engel, F. B. Electroconductive Biohybrid Hydrogel for Enhanced Maturation and Beating Properties of Engineered Cardiac Tissues. Adv. Funct. Mater. 2018, 28, No. 1803951. (11) Hosoyama, K.; Ahumada, M.; McTiernan, C. D.; Davis, D. R.; Variola, F.; Ruel, M.; Liang, W.; Suuronen, E. J.; Alarcon, E. I. Nanoengineered Electroconductive Collagen-Based Cardiac Patch for Infarcted Myocardium Repair. ACS Appl. Mater. Interfaces 2018, 10, 44668−44677. 22162


Research Article

ACS Applied Materials & Interfaces (29) Shevach, M.; Fleischer, S.; Shapira, A.; Dvir, T. Gold Nanoparticle-Decellularized Matrix Hybrids for Cardiac Tissue Engineering. Nano Lett. 2014, 14, 5792−5796. (30) Guo, B.; Ma, P. X. Conducting Polymers for Tissue Engineering. Biomacromolecules 2018, 19, 1764−1782. (31) Orza, A.; Soritau, O.; Olenic, L.; Diudea, M.; Florea, A.; Rus Ciuca, D.; Mihu, C.; Casciano, D.; Biris, A. S. Electrically Conductive Gold-Coated Collagen Nanofibers for Placental-Derived Mesenchymal Stem Cells Enhanced Differentiation and Proliferation. ACS Nano 2011, 5, 4490−4503. (32) Baei, P.; Jalili-Firoozinezhad, S.; Rajabi-Zeleti, S.; TafazzoliShadpour, M.; Baharvand, H.; Aghdami, N. Electrically Conductive Gold Nanoparticle-Chitosan Thermosensitive Hydrogels for Cardiac Tissue Engineering. Mater. Sci. Eng., C 2016, 63, 131−141. (33) Shin, J.; Choi, E. J.; Cho, J. H.; Cho, A.-N.; Jin, Y.; Yang, K.; Song, C.; Cho, S.-W. Three-Dimensional Electroconductive Hyaluronic Acid Hydrogels Incorporated with Carbon Nanotubes and Polypyrrole by Catechol-Mediated Dispersion Enhance Neurogenesis of Human Neural Stem Cells. Biomacromolecules 2017, 18, 3060− 3072. (34) Bellis, S. L. Advantages of RGD Peptides for Directing Cell Association with Biomaterials. Biomaterials 2011, 32, 4205−4210. (35) Yang, K.; Sun, J.; Wei, D.; Yuan, L.; Yang, J.; Guo, L.; Fan, H.; Zhang, X. Photo-Crosslinked Mono-component Type II Collagen Hydrogel as A Matrix to Induce Chondrogenic Differentiation of Bone Marrow Mesenchymal Stem Cells. J. Mater. Chem. B 2017, 5, 8707−8718. (36) Zha, Z.; Deng, Z.; Li, Y.; Li, C.; Wang, J.; Wang, S.; Qu, E.; Dai, Z. Biocompatible Polypyrrole Nanoparticles as a Novel Organic Photoacoustic Contrast Agent for Deep Tissue Imaging. Nanoscale 2013, 5, 4462−4467. (37) Balint, R.; Cassidy, N. J.; Cartmell, S. H. Conductive Polymers: Towards a Smart Biomaterial for Tissue Engineering. Acta Biomater. 2014, 10, 2341−2353. (38) Chen, L.; Yang, K.; Zhao, H.; Liu, A.; Tu, W.; Wu, C.; Chen, S.; Guo, Z.; Luo, H.; Sun, J.; Fan, H. Biomineralized Hydrogel with Enhanced Toughness by Chemical Bonding of Alkaline Phosphatase and Vinylphosphonic Acid in Collagen Framework. ACS Biomater. Sci. Eng. 2019, 5, 1405−1415. (39) Zhu, Y.-D.; Chen, S.-P.; Zhao, H.; Yang, Y.; Chen, X.-Q.; Sun, J.; Fan, H.-S.; Zhang, X.-D. PPy@ MIL-100 Nanoparticles as a pHand Near-IR-Irradiation-Responsive Drug Carrier for Simultaneous Photothermal Therapy and Chemotherapy of Cancer Cells. ACS Appl. Mater. Interfaces 2016, 8, 34209−34217. (40) Hong, J. Y.; Yoon, H.; Jang, J. Kinetic Study of the Formation of Polypyrrole Nanoparticles in Water-Soluble Polymer/Metal Cation Systems: A Light-Scattering Analysis. Small 2010, 6, 679−686. (41) Yu, Y.; Shang, L.; Guo, J.; Wang, J.; Zhao, Y. Design of Capillary Microfluidics for Spinning Cell-laden Microfibers. Nat. Protoc. 2018, 2557. (42) Zhu, W.; Wang, Q.; Ma, H.; Lv, X.; Wu, D.; Sun, X.; Du, B.; Wei, Q. Single-step Cycle Pulse Operation of the Label-free Electrochemiluminescence Immunosensor Based on Branched Polypyrrole for Carcinoembryonic Antigen Detection. Sci. Rep. 2016, 6, No. 24599. (43) Chen, X.; Yu, N.; Zhang, L.; Liu, Z.; Wang, Z.; Chen, Z. Synthesis of Polypyrrole Nanoparticles for Constructing Full-Polymer UV/NIR-shielding Film. RSC Adv. 2015, 5, 96888−96895. (44) Gabriel, C.; Peyman, A.; Grant, E. Electrical Conductivity of Tissue at Frequencies below 1 MHz. Phys. Med. Biol. 2009, 54, 4863− 4878. (45) Engler, A. J.; Sen, S.; Sweeney, H. L.; Discher, D. E. Matrix Elasticity Directs Stem Cell Lineage Specification. Cell 2006, 126, 677−689. (46) Sun, J.; Wei, D.; Zhu, Y.; Zhong, M.; Zuo, Y.; Fan, H.; Zhang, X. A Spatial Patternable Macroporous Hydrogel with Cell-affinity Domains to Enhance Cell Spreading and Differentiation. Biomaterials 2014, 35, 4759−4768.

(47) Spitzer, N. C. Electrical Activity in Early Neuronal Development. Nature 2006, 444, 707−712.

22163


Cell-Laden Electroconductive Hydrogel Simulating Nerve Matrix To

Recommend Documents