Cell Surface Display of Functional Macromolecule Fusions on

Jul 15, 2008 - State Key Laboratory of Integrated Management of Pest Insects and ... be applied to various bacterial species for enhancing field use. ...
0 downloads 0 Views 1MB Size
Download PDF
Environ. Sci. Technol. 2008, 42, 6105–6110

Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst C H A O Y A N G , †,‡ Q I A O Z H A O , | Z H E N G L I U , †,‡ Q I Y U N L I , § C H U A N L I N G Q I A O , * ,† A S H O K M U L C H A N D A N I , * ,⊥ A N D WILFRED CHEN⊥ State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China, Graduate School of the Chinese Academy of Sciences, Beijing 100049, China, Institute of Plant Protection, Jilin Academy of Agricultural Sciences, Gongzhuling 136100, China, Plant Biotechnology Center and Department of Plant Cellular and Molecular Biology, Ohio State University, Columbus, Ohio 43210, Department of Chemical and Environmental Engineering, University of California, Riverside, California 92521

Received February 13, 2008. Revised manuscript received June 1, 2008. Accepted June 4, 2008.

At present, Lpp-OmpA-mediated surface display has opened a new dimension in the development of whole-cell factories. Here, we report the surface display of methyl parathion hydrolase (MPH) and enhanced green fluorescent protein (EGFP) fusions (60 kDa) by employing the Lpp-OmpA chimera as an anchoring motif. A broad-host-range vector, pLOMG33, coding for Lpp-OmpA-MPH-GFP fusion protein was constructed for targeting the fusion protein onto the surface of Escherichia coli. The surface localization of fusion protein was demonstrated by Western blot analysis, immunofluorescence microscopy, and a protease accessibility experiment. The surface-exposed fusion protein retains the MPH activity and GFP fluorescence. Anchorage of macromolecule fusions on the outer membrane neither inhibits cell growth nor affects cell viability, as shown by growth kinetics of cells and stability of resting cultures. The engineered E. coli with surface-expressed MPH-GFP has two major advantages over the same strain expressing cytosolic MPH-GFP, including 7-fold higher whole-cell activity and 2-fold stronger fluorescence. Moreover, the construct pLOMG33 can potentially be applied to various bacterial species for enhancing field use. This is the first report on the presentation of GFP fusions on the cell surface by Lpp-OmpA. Our results suggest that Lpp-OmpA is a useful tool for the functional display of macromolecule passenger proteins on the cell surface. * Authors to whom correspondence should be addressed. Phone: 86-10-64807191 (C.Q.); 951-827-6419 (A.M.).Fax: 86-10-64807099 (C.Q.); 951-827-5696 (A.M.). E-mail: [email protected] (C.Q.); adani@ engr.ucr.edu (A.M.). † Chinese Academy of Sciences. ‡ Graduate School of the Chinese Academy of Sciences. § Jilin Academy of Agricultural Sciences. | Ohio State University. ⊥ University of California. 10.1021/es800441t CCC: $40.75

Published on Web 07/15/2008

 2008 American Chemical Society

Introduction Synthetic organophosphates (OPs) are a group of highly toxic chemicals and exhibit broad-spectrum activity against major agricultural pests, accounting for ∼38% of total pesticides used globally (1). These compounds are potent acetylcholinesterase (AChE) inhibitors. Since AChE is present in all vertebrates, the potential damage caused by OPs to nontarget organisms is extremely high. Microbial degradation of OPs has received considerable attention, and the bacterial organophosphorus hydrolase (OPH) has been intensively researched (2, 3). Most microorganisms that produce OPH are Gramnegative bacteria, and their OPH is located within the cells (2, 3). Gram-negative bacteria possess a complex cell envelope structure that consists of a cytoplasmic membrane, cell wall, and outer membrane. The outer membrane prevents OPs from interacting with OPH residing within the cell, reducing the overall catalytic efficiency (4). However, this permeability barrier could be eliminated by the use of a microorganism displaying OPH on the surface (5, 6). The surface-exposed enzymes have free access to OPs, overcoming the rate-limiting step in the degradation of OPs by natural isolates expressing OPH intracellularly. Various surface-anchoring motifs that possess the potential to cross both the cytoplasmic and outer membranes have been employed for targeting heterologous proteins onto the cell surface, such as the lipoprotein-outer membrane protein A chimera (Lpp-OmpA), ice nucleation protein (INP), and autotransporter (7, 8). The protein to be displayed (passenger protein) can be fused to an anchoring motif (carrier protein) by N-terminal fusion, C-terminal fusion, or sandwich fusion. These characteristics of carrier proteins, passenger proteins, and fusion strategy affect the efficiency of the surface display of passenger proteins. The Lpp-OmpA chimera consists of the signal sequence and the first nine N-terminal amino acids of the major E. coli lipoprotein (Lpp) joined to a transmembrane domain (amino acids 46-159) from outer membrane protein A (OmpA) (9). The Lpp-OmpA-based cell display system was the first successful approach for displaying full-length heterologous proteins on the surface of Escherichia coli (10) and has been extensively used for the display of heterologous proteins, such as β-lactamase (10), cellulases (11), the scFv antibody (12), the cellulose-binding domain (13), cyclodextrin glucanotransferase (14), and the chitin-binding domain (15), on the surface of E. coli. The green fluorescent protein (GFP) from the jellyfish Aequorea victoria is an ideal marker for monitoring the genetically engineered microorganisms (GEMs) (16, 17). Fluorescence from GFP does not require additional gene products, substrates, or other factors and can be detected noninvasively using fluorescence microscopy and flow cytometry (18). Moreover, GFP can be expressed as either an N- or a C-terminal fusion and still fluoresce (19). In field studies, GFP has been used as a marker to assess the fate and activity of specific degrading microorganisms (20). Enhanced GFP (EGFP; GenBank accession no. U57609), which is a redshifted variant of GFP, assembles the chromophore more rapidly, shows much stronger fluorescence than wild-type GFP, and fluoresces after exposure to daylight (21). Recently, an organophosphate degradation gene (called mpd) was isolated from methyl parathion-degrading Plesiomonas sp., and its protein product, methyl parathion hydrolase (MPH), showed no homology to OPH (22). More recently, we reported the identification of the mpd gene VOL. 42, NO. 16, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6105

TABLE 1. Strains, Plasmids, and Primers Used in This Study strain, plasmid or primer

XL1-Blue DH5R

pOP131 pMDQ pEGFP-N3 pUC19 pVLT33 pLOMG33 pMG33

P1a P2 P3 P4 P5 P6 P7 a

description E. coli Strains recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 lac(F’ proAB lacIq∆M15 Tn10 [Tetr]) supE44 ∆lacU169(φ80 lacZ∆M15) recA1 endA1 hsdR17(rKmK+) thi-1 gyrA relA1 F- ∆(lacZYA-argF) Plasmids gene source of Lpp-OmpA fusion source of mpd gene source of gfp gene cloning vector for construction of fusion genes E. coli/Pseudomonas shuttle vector, oriT, RSF1010, oriV, lacIq, tac promoter, Kmr pVLT33 derivative, surface expression vector containing a lpp-ompA-mpd-gfp fusion gene pVLT33 derivative, control plasmid for expressing MPH-GFP fusion protein in the cytoplasm Primers (5′f3′) GAATTCAGGAAACAATGAAAGCTACTAAACTGGTA GGATCCGTTGTCCGGACGAGTGCCGAT GGATCCATGGCCGCACCGCAGGTG CTGCAGCTTGGGGTTGACGACCG CTGCAGATGGTGAGCAAGGGC AAGCTTACTTGTACAGCTCGTCCA GAATTCAGGAAACAATGGCCGCACCGCAGGTG

Stratagene Tiangen

4 23 21 TaKaRa 24 this study this study

this this this this this this this

study study study study study study study

The restriction sites are underlined.

(GenBank accession no. DQ677027) from chlorpyrifosdegrading Stenotrophomonas sp (23). In this study, we used the Lpp-OmpA chimera for the functional display of the MPH-GFP fusion protein on the surface of E. coli. The engineered E. coli can be applied in the form of a whole-cell biocatalyst by overcoming the substrate uptake limitation and can be easily monitored by fluorescence for its fate in the environment.

Materials and Methods Bacterial Strains and Plasmids. All strains, plasmids (4, 21, 23, 24), and primers used in this study are listed in Table 1. E. coli strains bearing plasmids were grown in Luria-Bertani (LB) media (25) supplemented with 50 µg/mL kanamycin or 100 µg/mL ampicillin. Plasmid Construction. The lpp-ompA fusion gene was polymerase chain reaction (PCR)-amplified from plasmid pOP131 using primers P1 and P2. The PCR product was digested with EcoRI and BamHI and then ligated into similarly digested pUC19 to generate pLO. The mpd gene was PCRamplified from plasmid pMDQ using primers P3 and P4. The PCR product was digested with BamHI and PstI and then ligated into similarly digested pLO to generate pLOM. The gfp gene was PCR-amplified form plasmid pEGFP-N3 using primers P5 and P6. The PCR product was digested with PstI and HindIII and then ligated into similarly digested pLOM to generate pLOMG. The lpp-ompA-mpd-gfp fusion gene was released from pLOMG with EcoRI-HindIII and subcloned into an E. coli/Pseudomonas shuttle vector, pVLT33, to create pLOMG33. Transformation of the plasmid into E. coli was done using the CaCl2 method (25). Expression of the fusion protein was induced with 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 24 h at 25 °C when cells were grown to an OD600 of 0.5. To construct a control plasmid for expressing the MPH-GFP fusion protein in the cytoplasm, the mpd-gfp fusion gene was PCR-amplified from plasmid pLOMG using primers P6 and P7. The PCR product was digested with EcoRI and HindIII and then ligated into similarly digested pVLT33 to generate pMG33. 6106

source or literature

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 16, 2008

Cell Fractionation. Cells harboring pLOMG33 were harvested and resuspended in a 25 mM Tris-HCl buffer (pH 8.0). The cells were disrupted by sonication on ice. The crude extract was centrifuged for 10 min at 10 000 rpm to remove cell debris. The cell-free extract was then centrifuged for 1 h at 50 000 rpm to separate the membrane and soluble fractions. The supernatant representing the soluble fraction was retained. For further outer-membrane fractionation, the pellet (total membrane fraction) was resuspended with phosphate-buffered saline (PBS) containing 0.01 mM MgCl2 and 2% Triton X-100 for solubilizing the inner membrane and was incubated for 30 min at room temperature, and then the outer-membrane fraction was repelleted by ultracentrifugation (26). Western Blot Analysis. Samples of whole-cell lysate, the soluble fraction, and the outer-membrane fraction were analyzed on SDS-PAGE with 10% (w/v) acrylamide (25). After electrophoresis, the separated proteins were electroblotted overnight at 40 V to the nitrocellulose membrane (Millipore, Billerica, MA) with a tank transfer system (Bio-Rad, Hercules, CA) containing a transfer buffer (25 mM Tris, 192 mM glycine, 10% methanol). After the blocking step, the membrane was incubated with either rabbit anti-GFP polyclonal antibodies (Molecular Probes, Eugene, OR) or anti-MPH serum at a 1:1000 dilution in TBST buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween-20). Subsequently, the membrane was incubated with alkaline phosphatase-conjugated goat anti-rabbit IgG antibodies (Promega, Madison, WI) at a 1:2000 dilution. The membrane was then stained with NBT/BCIP in an alkaline phosphatase buffer (100 mM Tris-HCl, pH 9.0, 100 mM NaCl) for visualizing antigen-antibody conjugates. Immunofluorescence Microscopy. Cells harboring pLOMG33 and pMG33 were harvested and resuspended (OD600 ) 0.5) in phosphate-buffered saline (PBS) with 3% bovine serum albumin. Cells were then incubated with either GFP or MPH antisera at a 1:1000 dilution for 2 h at 30 °C. After washing with PBS, the cells were resuspended in PBS with goat antirabbit IgG conjugated with rhodamine (Invitrogen, Mukilteo, WA) at a 1:500 dilution and were incubated for 1 h at 30 °C. Prior to microscopic observation, cells were washed five times

FIGURE 1. Schematic diagram of the construction of the Lpp-OmpA-MPH-GFP fusion protein. Lpp SP, lipoprotein signal peptide; first 9 aa, the first nine amino acids; OmpA (aa 46-159), amino acids 46-159 from outer-membrane protein A. OmpA forms five membrane-spanning β strands, making up β-barrel structures, which allow the exposure of C-terminally fused MPH-GFP on the cell surface. with PBS and mounted on poly-L-lysine-coated microscopic slides. Photographs were taken using a fluorescence microscopy (Nikon) equipped with FITC and Rhodamine filters. Assay for Whole-Cell MPH Activity. Cells harboring pLOMG33 and pMG33 were suspended in a 100 mM phosphate buffer (pH 7.4) and diluted to an OD600 of 1.0. MPH activity assay mixtures (1 mL, 3% methanol) contained 50 µg/mL methyl parathion (added from a 10 mg/mL methanol stock solution), 960 µL of a 100 mM phosphate buffer (pH 7.4), and 10 µL of cells. Changes in absorbance (405 nm) were measured for 3 min at 30 °C using a Beckman DU800 spectrophotometer. Activities were expressed as units (1 µmol of p-nitrophenol formed per minute) per OD600 whole cells (ε405 ) 17 700 M-1 cm-1 for p-nitrophenol). Measurement of Whole-Cell Fluorescence. Cells harboring pLOMG33 and pMG33 were suspended in a PBS buffer (pH 7.5) and diluted to an OD600 of 1.0, and the similarly diluted cells harboring pVLT33 were used as background references. The GFP fluorescence intensity was determined using a fluorescence spectrophotometer (F-4500, HITACHI, Japan) with a bandwidth of 5 nm, an excitation wavelength of 488 nm, and an emission wavelength of 510 nm. Protease Accessibility Assay. Cells harboring pLOMG33 and pMG33 were harvested, suspended in a PBS buffer, and adjusted to an OD600 of 10. Pronase (4 units/mg; Sigma, St. Louis, MO) was added to a final concentration of 2 mg/mL. Cell suspensions were incubated at 37 °C for 3 h. Subsequently, Pronase-treated and untreated cells were assayed for GFP fluorescence and MPH activity as described above. Stability Study of Resting Cultures. Cells harboring pLOMG33 were grown in 50 mL of LB medium supplemented with 0.2 mM IPTG and 50 µg/mL kanamycin for 2 days, washed twice with 50 mL of a 150 mM NaCl solution, resuspended in 5 mL of a 100 mM phosphate buffer (pH 7.4), and incubated in a shaker at 25 °C. Over a 2-week duration, 0.1 mL of samples were removed each day. Samples were centrifuged and resuspended in 0.1 mL of a 100 mM phosphate buffer (pH 7.4). MPH activity assays were conducted as described above.

Results Confirmation of Surface Localization and Functionality of MPH-GFP Fusion Protein. To target MPH-GFP onto the

FIGURE 2. Western blot analysis for subcellular localization of expressed Lpp-OmpA-MPH-GFP fusion protein in E. coli XL1-Blue harboring pLOMG33. (A) Western blot analysis of different cellular fractions with anti-GFP antibody. Lane 1, protein markers; lane 2, negative control (XL1-Blue harboring pVLT33); lane 3, whole-cell lysates; lane 4, soluble fraction; lane 5, outer-membrane fraction. (B) Western blot analysis of different cellular fractions with anti-MPH serum. Lane 1, protein markers; lane 2, whole-cell lysates; lane 3, soluble fraction; lane 4, outer-membrane fraction; lane 5, negative control (XL1-Blue harboring pVLT33). surface of E. coli, the Lpp-OmpA chimera comprised of a localization domain (Lpp) and a transmembrane domain (OmpA) was employed as an anchoring motif. A schematic diagram of the construction of the Lpp-OmpA-MPH-GFP fusion protein is shown in Figure 1. The fusion gene was subcloned into a broad-host-range vector, pVLT33, to generate pLOMG33. Expression of the fusion protein was under the control of a tightly regulated tac promoter. Western blot was performed to verify the synthesis of the fusion protein with either GFP or MPH antisera. A specific band corresponding to the 76 kDa fusion protein was detected in whole-cell lysates from the cells carrying pLOMG33, which matches well with the molecular mass estimated from the deduced amino acid sequence of the fusion protein (Figure 2A and B, lanes 3 and 2). However, no signal was detected with the control cells carrying pVLT33. When the fractionated fractions of cells harboring pLOMG33 were probed with either GFP or MPH antisera, the 76 kDa band was detected in the outer-membrane fraction (Figure 2A and B, lanes 5 and 4). VOL. 42, NO. 16, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6107

Protease accessibility experiments were performed to ascertain the surface localization of the fusion protein. GFP is resistant to many common proteases except Pronase, which is a mixture of broad-specificity proteases (27). Since Pronase cannot penetrate the outer membrane, only those GFP and MPH molecules that are anchored on the outer membrane can be degraded by Pronase. With the Pronase treatment, the fluorescence intensity of cells carrying pLOMG33 decreased 87%, while cells carrying pMG33 had only a 6% drop in fluorescence intensity. Similarly, the MPH activity for cells (pLOMG33) decreased 81%, while cells expressing MPH intracellularly (pMG33) had only a 4% drop in activity. After the treatment of cells (pLOMG33) with Pronase, the fractionated outer membrane was probed with either GFP or MPH antisera; however, no signal corresponding to the fusion protein was detected. Immunolabeling with specific antibodies or antisera is a useful tool to detect surface-exposed proteins. The surface localization of the MPH-GFP fusion protein in E. coli was determined by immunofluorescence microscopy. Cells were probed with a primary anti-GFP antibody and then fluorescently stained with a rhodamine-labeled IgG antibody. Since the anti-GFP antibody cannot diffuse through the cell membrane, only those surface-exposed GFP molecules can interact with the anti-GFP antibody. Under fluorescence microscopy, an orange fluorescence was observed on the cells (pLOMG33) with surface-exposed GFP (Supporting Information, Figure S1). In contrast, the control cells (pMG33) expressing cytosolic GFP were not immunostained. From all of these results, we concluded that the MPH-GFP fusion protein was indeed displayed functionally on the cell surface using the Lpp-OmpA display system. Whole-Cell Activity and Fluorescence. The whole-cell activity of E. coli XL1-Blue displaying MPH was 7-fold higher than that of the same strain expressing cytosolic MPH. Moreover, XL1-Blue displaying GFP exhibited 2-fold stronger fluorescence than the same strain expressing cytosolic GFP (Supporting Information, Figure S2). The activity was not detected, and fluorescence remained at the original background level prior to induction. The activity and fluorescence increased gradually after induction with 0.2 mM IPTG and reached a maximum at 24 h (Supporting Information, Figure S3). As shown in Figure 3A, the expressed fusion protein was located in the outer-membrane fraction when IPTG induction was done at a concentration of 0.2 mM. In contrast, the fusion protein produced with induction at higher IPTG concentrations (0.5 and 1 mM) was only present in the soluble fraction. Accordingly, whole-cell activity reached a maximum at an IPTG concentration of 0.2 mM (Figure 3B). Further induction resulted in a gradual decline in the activity. Contrarily, wholecell fluorescence increased with increasing concentrations of IPTG (Figure 3C). Induction at 25 °C resulted in a high whole-cell activity and a significant fluorescence. The activity and fluorescence were not detected with induction at 37 °C, and the cultures with induction at 30 °C exhibited a low activity (0.02 U/OD600) and a weak fluorescence (20% of that achieved at 25 °C). The fluorescence of the surfaceexpressed GFP at pH 6 dropped to 30% of that at pH 7.5 and was almost entirely quenched at a pH below 5. In contrast, the fluorescence of the cytosol-expressed GFP at pH 6 maintained 80% of that at pH 7.5. Stability of Cultures Displaying Fusion Protein. To test whether surface expression of the fusion protein inhibits cell growth, growth kinetics of cells carrying pLOMG33 and pVLT33 were compared. No growth inhibition was observed for cells expressing the fusion protein. Both cultures reached the same final cell density after 48 h of incubation (Supporting Information, Figure S4). To monitor the stability of suspended cultures, whole-cell activity was determined periodically over a 2-week period. As shown in Figure 4, whole-cell activity of 6108

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 16, 2008

FIGURE 3. (A) Localization of the expressed Lpp-OmpAMPH-GFP fusion protein in E. coli XL1-Blue at increasing concentrations of IPTG. The fusion proteins in the soluble fraction (S) and outer-membrane fraction (OM) were probed with anti-GFP antibody. Whole-cell activity (B) and fluorescence (C) of XL1-Blue harboring pLOMG33 are shown under different levels of induction. Data are mean values ( standard deviations from three replicates.

FIGURE 4. Whole-cell MPH activity in suspended E. coli cultures expressing the MPH-GFP fusion protein on the cell surface. Data are mean values ( standard deviations from three replicates. XL1-Blue (pLOMG33) remained at essentially the original level over the 2-week period.

Discussion Surface display of the active proteins on living cells has enormous potential in the synthesis of a wide variety of valuable products and in the degradation of numerous toxic compounds (7, 8). Up to now, however, cellular surface display was merely restricted to a few proteins due to the

limited availability of optimized anchoring motifs to efficiently display proteins having different molecular weights and molecular characteristics. An anchoring motif, which is successfully applied to display some target proteins, often fails to display other proteins. In the previous work, we used an INP-based display system to functionally express MPH on the cell surface (28). The mechanism of INP anchoring to display proteins is still unknown. To date, only a few anchoring motifs that include Lpp-OmpA from E. coli and INP from Pseudomonas syringae were shown to be capable of displaying GFP on the cell surface (26, 29). This difficulty in targeting GFP onto the cell surface may be attributed to the distinguishing three-dimensional structure of GFP. It has been reported that GFP is an 11-stranded β barrel threaded by an R helix running up the axis of the cylinder (30). The early developed Lpp-OmpA system has been intensively researched for its translocation mechanism (9, 10). All information that is needed for targeting and insertion into the outer membrane resides in the signal sequence and the first nine N-terminal amino acids of Lpp (31, 32). Fusions to the short Lpp sequence become fatty-acylated, export via the lipoprotein pathway, and insert into the outer membrane but are not surface-exposed (32). OmpA spans the outer membrane five times, and membrane-spanning β strands make up β-barrel structures, which allow the translocation of C-terminally attached passenger proteins across the outer membrane (10, 33). The Lpp-OmpA system looks promising since it is wellsuited as a carrier of relatively large inserts. The largest protein that has been successfully displayed with Lpp-OmpA in E. coli so far is a 74 kDa cyclodextrin glucanotransferase (14). Our findings demonstrated that MPH-GFP (60 kDa) fused to the C-terminus of Lpp-OmpA could be functionally anchored on the outer membrane of E. coli. The physical binding between MPH and the substrate was reinforced by expressing MPH on the E. coli surface, and it enhances wholecell catalytic efficiency. Moreover, surface-expressed GFP shows much stronger fluorescence than cytosol-expressed GFP due to the elimination of the barrier effect of the cell membrane, making it ideal for monitoring the fate of the released GEMs in the environment. Furthermore, the strategy of linking GFP to MPH facilitates the online monitoring of the expression and localization of MPH. GFP has been used as a fusion partner for online monitoring and quantifying protein production (34). To our knowledge, this is the first report on the presentation of GFP fusions on the cell surface by Lpp-OmpA. Most importantly, our results highlight the potential of Lpp-OmpA to be utilized for the functional display of macromolecule passenger proteins on the cell surface. A high transcription rate can block the translocation pathway of a secreted protein, as translocation is generally the limiting step for a secreted protein (35). The inhibitory effects of overexpression on the translocation pathway have been well-documented (26, 29). In this study, high doses of IPTG will induce a high transcription rate; however, the large amounts of protein thus produced cannot be efficiently translocated onto the cell surface. Consequently, whole-cell activity decreased with increasing concentrations of IPTG. However, fluorescence increased with enhanced expression levels because it was minimally affected by the barrier effect of the cell membrane. Our results suggest that induction with 0.2 mM IPTG provides an optimal balance between whole-cell activity and fluorescence. In this study, 25 °C proved to be an optimum induction temperature, suggesting that a low temperature may be favorable to the correct folding and proper translocation of proteins (36). The adverse effects of a high temperature on the surface expression of foreign proteins were reported previously (4, 29).

Anchorage of the macromolecule passenger proteins on the outer membrane may result in instability of the outer membrane and growth inhibition of the cells (7). In addition to the choice of compatible surface anchors, optimization of the expression systems may also waive the metabolic burden placed on the cell. In the previous works, expression of the Lpp-OmpA fusion proteins was controlled by a lpp-lac promoter that lacks a Cap site; as such, it was not regulated by catabolite repression and was weakly constitutively active without IPTG induction (10, 11). The promoter leakiness results in decreased viability of the cells when certain proteins are expressed. It has been reported that surface expression driven by the lpp-lac promoter either inhibits cell growth or reduces cell viability (4, 29). In this study, a low-copynumber plasmid, pLOMG33, containing a tightly regulated tac promoter was used for surface expression of macromolecule fusions in E. coli. The expression of Lpp-OmpAMPH-GFP is tightly regulated by the tac promoter due to the presence of the lacIq gene on the plasmid. As a result, cells harboring pLOMG33 did not show detectable MPH activity and GFP fluorescence prior to induction. Growth inhibition of the cells was also not observed in the XL1-Blue (pLOMG33) cultures. Additionally, the level of expression driven by the tac promoter is moderately high (5), while the expression level is quite low using the lpp-lac promoter (29). Consequently, the use of the tac promoter in this study will produce more enzyme molecules in a single cell, resulting in improved whole-cell activity and fluorescence. The current technology is very useful not only for the detoxification of OPs but also for the rapid detection of OPs. It has been reported that surface-expressed GFP exhibits a stronger pH-dependent fluorescence compared to cytosolexpressed GFP (29). Our results showed that the fluorescence of whole cells displaying MPH-GFP fusion was very sensitive to extracellular pH changes. Since the hydrolysis of OPs by MPH generates protons, it is possible to develop whole-cell biosensors for OP detection on the basis of the changes in fluorescence by utilizing the whole cells displaying MPHGFP fusion. Unlike divalent cation-dependent OPH activity, MPH requires no cofactor for maintaining its activity, suggesting that MPH-displaying systems may be more suitable for fieldscale remediation than previously reported OPH-displaying systems (4, 37). MPH exhibits high activity for dimethyl OPs (22), while OPH lacks any hydrolytic activity toward numerous dimethyl OPs (38), indicating that the MPH-displaying system is particularly suitable for the simultaneous degradation and detection of dimethyl OPs. At present, functional expression of the OPH-GFP fusion protein on the surface of E. coli has been accomplished by the AIDA-I autotransporter pathway (37). However, surface expression mediated by the AIDA-I autotransporter requires an ompT (outer membrane protease T)-negative host strain, E. coli UT5600 (8, 37). In contrast, surface expression of the Lpp-OmpA fusion proteins has been achieved in various E. coli strains, such as JM105 (4), JM109 (11, 29), XL1-Blue (13), and BL21 (DE3) (15). E. coli, which is very well-known in regard to its genetic background, is still the most commonly used host for recombinant protein expression (39). However, more effective and competitive strains that well-adapt the fluctuating environmental conditions and competition from indigenous microbial populations are required for in situ bioremediation of contaminated sites. The broad-host-range vector, pVLT33, used in this study is an RSF1010 derivative and therefore able to replicate in a wide variety of Gram-negative bacteria (24). At present, the pVLT33-based vectors have been successfully used to express several proteins in various Gramnegative bacteria, such as Moraxella sp (5). and P. putida JS444 (6, 28). Therefore, the pVLT33-derived surface expression vector, pLOMG33, has enormous potential for funcVOL. 42, NO. 16, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6109

tionally displaying MPH-GFP fusion on cell surfaces of the environmentally robust bacteria.

(20)

Acknowledgments This work was financially supported by the 863 Hi-Tech Research and Development Program of the People’s Republic of China (No. 2007AA06Z335) and the Innovation Program of the Chinese Academy of Sciences (No. KSCX2-YW-G-008).

Supporting Information Available Four figures showing additional details of our study. This information is available free of charge via the Internet at http://pubs.acs.org.

Literature Cited (1) Singh, B. K.; Walker, A. Microbial degradation of organophosphorus compounds. FEMS Microbiol. Rev. 2006, 30, 428–471. (2) Serdar, C. M.; Gibson, D. T. Enzymatic hydrolysis of organophosphates: cloning and expression of a parathion hydrolase gene from Pseudomonas diminuta. Bio/Technology 1985, 3, 567– 571. (3) Mulbry, W. W.; Hams, J. F.; Kearney, P. C.; Nelson, J. O.; McDaniel, C. S.; Wild, J. R. Identification of a plasmid-borne parathion hydrolase gene from Flavobacterium sp. by Southern hybridization with opd from Pseudomonas diminuta. Appl. Environ. Microbiol. 1986, 51, 926–930. (4) Richins, R. D.; Kaneva, I.; Mulchandani, A.; Chen, W. Biodegradation of organophosphorus pesticides by surface-expressed organophosphorus hydrolase. Nat. Biotechnol. 1997, 15, 984– 987. (5) Shimazu, M.; Mulchandani, A.; Chen, W. Simultaneous degradation of organophosphorus pesticides and p-nitrophenol by a genetically engineered Moraxella sp.with surface-expressed organophosphorus hydrolase. Biotechnol. Bioeng. 2001, 76, 318– 324. (6) Lei, Y.; Mulchandani, A.; Chen, W. Improved degradation of organophosphorus nerve agents and p-nitrophenol by Pseudomonas putida JS444 with surface-expressed organophosphorus hydrolase. Biotechnol. Prog. 2005, 21, 678–681. (7) Samuelson, P.; Gunneriusson, E.; Nygren, P. A.; Stahl, S. Display of proteins on bacteria. J. Biotechnol. 2002, 96, 129–154. (8) Lee, S. Y.; Jong, H. C.; Zhaohui, X. Microbial cell-surface display. Trends Biotechnol. 2003, 21, 45–52. (9) Earhart, C. F. Use of an Lpp-OmpA fusion vehicle for bacterial surface display. Methods Enzymol. 2000, 326, 506–516. (10) Francisco, J. A.; Earhart, C. F.; Georgiou, G. Transport and anchoring of β-lactamase to the external surface of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1992, 89, 2713–2717. (11) Francisco, J. A.; Stathopoulos, C.; Warren, R. A. J.; Kilburn, D. G.; Georgiou, G. Specific adhesion and hydrolysis of cellulose by intact Escherichia coli expressing surface anchored cellulose or cellulose binding domain. Bio/Technology 1993, 11, 491–495. (12) Daugherty, P. S.; Chen, G.; Olsen, M. J.; Iverson, B. L.; Georgiou, G. Antibody affinity maturation using bacterial surface display. Protein Eng. 1998, 11, 825–832. (13) Wang, A. A.; Mulchandani, A.; Chen, W. Whole-cell immobilization with cell surface-exposed cellulose-binding domain. Biotechnol. Prog. 2001, 17, 407–411. (14) Wan, H. M.; Chang, B. Y.; Lin, S. C. Anchorage of cyclodextrin glucanotransferase on the outer membrane of Escherichia coli. Biotechnol. Bioeng. 2002, 79, 457–464. (15) Wang, J. Y.; Chao, Y. P. Immobilization of cells with surfacedisplayed chitin-binding domain. Appl. Environ. Microbiol. 2006, 72, 927–931. (16) Errampalli, D.; Leung, K.; Cassidy, M. B.; Kostrzynska, M.; Blears, M.; Lee, H.; Trevors, J. T. Applications of the green fluorescent protein as a molecular marker in environmental microorganisms. J. Microbiol. Methods 1999, 35, 187–199. (17) Larrainzar, E.; O’Gara, F.; Morrissey, J. P. Applications of autofluorescent proteins for in situ studies in microbial ecology. Annu. Rev. Microbiol. 2005, 59, 257–277. (18) Chalfie, M.; Tu, Y.; Euskirchen, G.; Ward, W. W.; Prasher, D. C. Greenfluorescent protein as a marker for gene expression. Science 1994, 263, 802–805. (19) March, J. C.; Rao, G.; Bentley, W. E. Biotechnological applications

6110

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 16, 2008

(21) (22) (23)

(24)

(25) (26) (27) (28)

(29) (30) (31)

(32)

(33) (34)

(35)

(36) (37)

(38)

(39)

of green fluorescent protein. Appl. Microbiol. Biotechnol. 2003, 62, 303–315. Elva¨ng, A. M.; Westerberg, K.; Jernberg, C.; Jansson, J. K. Use of green fluorescent protein and luciferase biomarkers to monitor survival and activity of Arthrobacter chlorophenolicus A6 cells during degradation of 4-chlorophenol in soil. Environ. Microbiol. 2001, 1, 32–42. Cormack, B. P.; Valdivia, R. H.; Falkow, S. FACS-optimized mutants of the green fluorescent protein (GFP). Gene 1996, 173, 33–38. Cui, Z. L.; Li, S. P.; Fu, G. P. Isolation of methyl parathiondegrading strain M6 and cloning of the methyl parathion hydrolase gene. Appl. Environ. Microbiol. 2001, 67, 4922–4925. Yang, C.; Liu, N.; Guo, X.; Qiao, C. Cloning of mpd gene from a chlorpyrifos-degrading bacterium and use of this strain in bioremediation of contaminated soil. FEMS Microbiol. Lett. 2006, 265, 118–125. de Lorenzo, V.; Eltis, L.; Kessler, B.; Timmis, K. N. Analysis of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and transposons that confer conditional phenotypes. Gene 1993, 123, 17–24. Sambrook, J.; Russel, D. W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 2001. Li, L.; Kang, D. G.; Cha, H. J. Functional display of foreign protein on surface of Escherichia coli using N-terminal domain of ice nucleation protein. Biotechnol. Bioeng. 2004, 85, 214–221. Bokman, S. H.; Ward, W. W. Renaturation of Aequorea green fluorescent protein. Biochem. Biophys. Res. Commun. 1981, 101, 1372–1380. Yang, C.; Cai, N.; Dong, M.; Jiang, H.; Li, J.; Qiao, C.; Mulchandani, A.; Chen, W. Surface display of MPH on Pseudomonas putida JS444 using ice nucleation protein and its application in detoxification of organophosphates. Biotechnol. Bioeng. 2008, 99, 30–37. Shi, H.; Su, W. W. Display of green fluorescent protein on Escherichia coli cell surface. Enzyme Microb. Technol. 2001, 28, 25–34. Yang, F.; Moss, L. G.; Phillips, G. N., Jr. The molecular structure of green fluorescent protein. Nat. Biotechnol. 1996, 14, 1246– 1251. Georgiou, G.; Stephens, D. L.; Stathopoulos, C.; Poetschke, H. L.; Mendenhall, J.; Earhart, C. F. Display of β-lactamase on the Escherichia coli surface: outer membrane phenotypes conferred by Lpp′-OmpA′-β-lactamase fusions. Protein Eng. 1996, 9, 239– 247. Ghrayeb, J.; Inouye, M. Nine amino acid residues at the NH2terminal of lipoprotein are sufficient for its modification, processing, and localization in the outer membrane of Escherichia coli. J. Biol. Chem. 1984, 259, 463–467. Vogel, H.; Ja¨hnig, F. Models for the structure of outer-membrane proteins of Escherichia coli derived from raman spectroscopy and prediction methods. J. Mol. Biol. 1986, 190, 191–199. Wu, C. F.; Cha, H. J.; Rao, G.; Valdes, J. J.; Bentley, W. E. A green fluorescent protein fusion strategy for monitoring the expression, cellular location, and separation of biologically active organophosphorus hydrolase. Appl. Microbiol. Biotechnol. 2000, 54, 78–83. Rodrigue, A.; Chanal, A.; Beck, K.; Muller, M.; Wu, L. Cotranslocation of a periplasmic enzyme complex by a hitchhiker mechanism through the bacterial Tat pathway. J. Biol. Chem. 1999, 274, 13223–13228. Bukau, B. Regulation of the Escherichia coli heat-shock response. Mol. Microbiol. 1993, 9, 671–680. Li, C.; Zhu, Y.; Benz, I.; Schmidt, M. A.; Chen, W.; Mulchandani, A.; Qiao, C. Presentation of functional organophosphorus hydrolase fusions on the surface of Escherichia coli by the AIDA-I autotransporter pathway. Biotechnol. Bioeng. 2008, 99, 485– 490. Horne, I.; Sutherland, T. D.; Harcourt, R. L.; Russell, R. J.; Oakeshott, J. G. Identification of an opd (organophosphate degradation) gene in an Agrobacterium isolate. Appl. Environ. Microbiol. 2002, 68, 3371–3376. Terpe, K. Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 2006, 72, 211–222.

ES800441T