Characterization of Glyphosate Resistance in Amaranthus

Article pubs.acs.org/JAFC

Characterization of Glyphosate Resistance in Amaranthus tuberculatus Populations Lothar Lorentz,†,§ Todd A. Gaines,†,# Scott J. Nissen,# Philip Westra,# Harry J. Strek,† Heinz W. Dehne,§ Juan Pedro Ruiz-Santaella,† and Roland Beffa*,† †

Bayer CropScience, Industriepark Hoechst, Building H872, 65926 Frankfurt am Main, Germany INRES-Phytomedicinem University of Bonn, Nußallee 9, 53115 Bonn, Germany # Department of Bioagricultural Sciences and Pest Management, Colorado State University, 1177 Campus Delivery, Fort Collins, Colorado 80523, United States §

S Supporting Information *

ABSTRACT: The evolution of glyphosate-resistant weeds has recently increased dramatically. Six suspected glyphosate-resistant Amaranthus tuberculatus populations were studied to confirm resistance and determine the resistance mechanism. Resistance was confirmed in greenhouse for all six populations with glyphosate resistance factors (R/S) between 5.2 and 7.5. No difference in glyphosate absorption or translocation was observed between resistant and susceptible individuals. No mutation at amino acid positions G101, T102, or P106 was detected in the EPSPS gene coding sequence, the target enzyme of glyphosate. Analysis of EPSPS gene copy number revealed that all glyphosate-resistant populations possessed increased EPSPS gene copy number, and this correlated with increased expression at both RNA and protein levels. EPSPS Vmax and Kcat values were more than doubled in resistant plants, indicating higher levels of catalytically active expressed EPSPS protein. EPSPS gene amplification is the main mechanism contributing to glyphosate resistance in the A. tuberculatus populations analyzed. KEYWORDS: glyphosate absorption, glyphosate translocation, EPSPS gene amplification, EPSPS gene expression, gene duplication, EPSPS enzyme activity, herbicide resistance

■

INTRODUCTION Amaranthus tuberculatus (Moq.) Sauer var. rudis (Sauer) Costea & Tardif (common waterhemp) is a dioecious C4 weed that can grow up to 3 m in height with roots reaching a depth of 70 cm. It can occupy a radial area of 2 m with a growing rate of 0.11−0.16 cm per growing degree day.1−3 The reported growth rate of A. tuberculatus is less than that for Amaranthus palmeri, but still higher than the values reported for other Amaranthus species.4 The female plant can produce between 35,000 and 1,200,000 seeds during the growing season.5 It prefers welldrained and nutrient-rich soils also well suited for agricultural production. Therefore, A. tuberculatus is an important weed, especially under drought stress conditions, and can vigorously compete with corn and soybean for water and nitrogen.5,6 A. tuberculatus has also evolved resistance to several herbicide modes of action either separately or in combination, including inhibitors of (1) aromatic amino acid biosynthesis, (2) photosystem II, (3) branched-chain amino acid biosynthesis, (4) chlorophyll biosynthesis, and (5) carotenoid biosynthesis.7−13 Glyphosate, a broad-spectrum herbicide, acts on enolpyruvyl-5-shikimate-3-phosphate-synthase (EPSPS), the sixth enzyme in the plant shikimic acid pathway. It converts shikimate-3-phosphate (S-3-P) together with phosphoenolpyruvate (PEP) into enolpyruvalshikimate-3-phosphate (EPSP), a precursor in the formation of aromatic amino acids and many secondary aromatic plant metabolites.14−16 Due to a missing feedback inhibition at this step, the S-3-P concentration in plants increases continuously after glyphosate treatment.17 © 2014 American Chemical Society

With its high-energy bonds, the phosphate group of S-3-P is unstable in plant cells and degrades into shikimic acid, which can be used as an early indicator of the inhibitory activity of glyphosate in plants.18−21 EPSPS is most active in young, actively growing plant tissue; therefore, the highest shikimic acid can be measured in these tissues, and particularly in the meristems, after glyphosate treatment.22,23 Both target- and non-target-site-based resistance mechanisms are responsible for glyphosate resistance.24 Alterations in the EPSPS gene sequence, specifically at the amino acid P106, have been reported in several glyphosate-resistant weeds, including Eleusine indica and Lolium rigidum.25,26 Differences in glyphosate translocation have been found in other populations of L. rigidum and in Lolium multiflorum, Sorghum halepense, and Conyza canadensis.27−30 Glyphosate translocation in these populations is mostly restricted within the treated leaves, resulting in significantly less translocation throughout the whole plant. In C. canadensis the reduced translocation is based on rapid glyphosate sequestration into vacuoles.31 In a population of L. multif lorum found in Chile, the resistance is based on differences in the spray solution retention and foliar absorption.32 Both a P106S mutation and reduced translocation were identified in a glyphosate-resistant A. tuberculatus population from Mississippi.13 Received: Revised: Accepted: Published: 8134

February 28, 2014 June 11, 2014 June 23, 2014 June 23, 2014 dx.doi.org/10.1021/jf501040x | J. Agric. Food Chem. 2014, 62, 8134−8142

Journal of Agricultural and Food Chemistry

Article

were treated with each glyphosate dose. All populations were treated together when they reached the growth stage defined as BBCH 1646 to allow unbiased comparisons. Thirteen increasing doses of glyphosate [0, 22.5, 45, 90, 180, 360, 540, 720, 1080, 1440, 2880, 5760, 11520 g ae ha−1 formulated as Roundup Weathermax, 660 g ae L−1 glyphosate (Monsanto Co., St. Louis, MO, USA)] containing additional nonionic surfactant (0.5% v/v Activator 90, Loveland Industries Inc., Greeley, CO, USA) were applied using a stationary sprayer outfitted with Teejet 8001 nozzles at 280 kPa and a spray volume of 200 L ha−1. The fresh weight of the above-ground plant material of each plant was determined 19 days after treatment (DAT). Dose response curves based on fresh weight and shikimic acid assays were determined using the statistical program R and the drc package to calculate the four-parameter sigmoidal log−logistic dose− response model.42,47 The calculated upper and lower limits were used in a second step to normalize raw data, allowing unbiased comparisons of dose response curves. The doses causing 50 and 90% effect on fresh weight reduction (ED50 and ED90, respectively) were calculated for each population. The resistance factor (R/S) for each population was calculated as the ratio between ED50 value of the putative resistant population and the susceptible A. tuberculatus control population. Shikimic acid content after glyphosate treatment is an early indicator for glyphosate-mediated plant injury,17,23 so a shikimic acid accumulation dose response model was evaluated as a potential method to characterize the A. tuberculatus populations. Therefore, shikimic acid accumulation was determined 4 DAT in leaf disks from plants used to establish the glyphosate dose response experiments. Four 0.4 cm diameter leaf disks of the youngest fully expanded leaf of each plant were harvested, except for plants treated with 11520 g ae ha−1 as these were severely stunted. The color reaction was measured at 380 nm on a 96-well plate reader (Biotek Synergy 4, Winooski, VT, USA) using previously described methods.18,19 Glyphosate Absorption and Translocation. Alterations in glyphosate absorption and translocation were evaluated in nine plants per population and time point in the A. tuberculatus populations MOS, MO-R1, and IL-R. The application solution was adjusted to a final rate of 720 g ae ha−1 glyphosate (Roundup Ultramax; 450 g ae L−1 glyphosate; Monsanto Co., St. Louis, MO, USA) and radiolabeled glyphosate (phosphonomethyl-[14C]) solution (50 mCi mmol−1, American Radiolabeled Chemicals, St. Louis, MO, USA). Twelve 0.5 μL droplets, each containing 1000 Bq μL−1, were spotted onto the youngest fully expanded leaf. The treated plants were moved to a growth chamber (model 1401, Rubarth Apparate GmbH, Laatzen, Germany) with a photoperiod of 16 h light and a light intensity of 120 μmol m−2 s−1 (Iwasaki Eye MT150D, Middlesex, UK) at a temperature of 25/18 °C day/night and a constant relative humidity of 70%. To determine the glyphosate absorption, treated leaves were removed from the plant 0, 8, 24, 48, 72, and 96 h after treatment (HAT). They were rinsed for 20 s in 3 mL of 0.1% Triton X-100 and 4% methanol, and radioactivity was measured using a scintillation counter (the scintillation liquid was Rotiszint Eco Plus, Carl Roth GmbH + Co. KG, Karlsruhe, Germany; the scintillation counter was a Packard 2000CA TriCarb Liquid Scintilation counter, Downers Grove, IL, USA). Glyphosate translocation was quantitatively measured by combusting different plant parts. The harvest time points were set at 0, 8, 24, 48, 72, and 96 HAT for the populations MO-S and MO-R1. The IL-R population had the same harvest time points except for 96 HAT, which could not be collected due to technical problems. Soil was washed off the roots at harvest, and plants were sectioned into roots, shoot above treated leaf, treated leaf, and remaining shoot material. The sectioned plant material was dried at 60 °C and oxidized using a biological sample oxidizer (OX-500, R. J. Harvey Instrument Corp., Hillsdale, NJ, USA) and released 14CO2 was determined (Packard 2000CA TriCarb liquid scintillation counter). Values for absorption and translocation were calculated as percent of total applied radioactivity. Glyphosate absorption and translocation were analyzed using nonlinear regression in the R statistical program.48

Although many different glyphosate resistance mechanisms have been reported, new mechanisms continue to be identified, such as the EPSPS gene amplification in A. palmeri populations from Georgia and Mississippi, USA.33−35 In these plants the EPSPS gene was amplified from 40- to >100-fold. The importance of gene amplification in conferring, for example, insecticide resistance has been well established;36 however, the amplification of the EPSPS gene in a single A. palmeri population was the first case of herbicide resistance induced by this mechanism.34 The EPSPS transcript abundance in untreated resistant plants was positively correlated with the genomic EPSPS gene copy number, suggesting no significant gene silencing of amplified genes. Amplified EPSPS genes were also translated into higher enzyme content.34,35 Glyphosate resistance based on gene amplification or increased EPSPS activity in vitro also occurred in cell cultures reared on glyphosate containing media, in Daucus carota L., Petunia hybrida, Nicotiana tabacum, Glycine max, Corydalis sempervirens, and Medicago sativa.37−41 However, plants derived from these cell cultures did not ultimately yield field-level glyphosate resistance. The scope of the present work is to characterize the glyphosate resistance mechanism(s) in A. tuberculatus and compare the role of gene amplification between two related species, A. tuberculatus and A. palmeri. Populations collected from the field and described as being either susceptible or resistant to glyphosate were characterized without further inbreeding of resistance using biological (greenhouse dose response), physiological (glyphosate absorption and translocation), biochemical (shikimic acid content and EPSPS enzyme activity), and molecular (EPSPS gene copy number and expression) analyses to determine the glyphosate resistance mechanism.

■

MATERIALS AND METHODS

Six different and still segregating A. tuberculatus populations collected between 2005 and 2009 from different fields in Missouri (MO) and Illinois (IL) (Supporting Information Table SI1) were assessed for their response to glyphosate. Previous results and the glyphosate resistance status of the field populations are described in Table SI1 of the Supporting Information. Six populations (IL-R, MO-R1, MO-R2, MO-R3, MO-R4, and MO-R5) were difficult to control in field, whereas the susceptible population, MO-S, was controlled by the recommended field rate of glyphosate. The A. tuberculatus populations were sown in Petri dishes containing 0.7% agar type A (Sigma-Aldrich Inc., St. Louis, MO, USA). The plates were stored in the dark for 2 days at 4 °C to induce germination and were then transferred to the greenhouse at a photoperiod of 16 h light, 28 °C/8 h dark, 15 °C. At the cotyledon developmental stage, single seedlings were transplanted into a 2 cm diameter pot system and grown for about 3 weeks, before 200−250 uniform plants from each population were transplanted as single plants into 8 cm diameter plastic pots containing a peat/vermiculite mixture (Fafard 2B Mix, Agawam MA, USA). A. tuberculatus used for all further experiments was similarly cultivated using 4.5 cm Fertilpots containing a peat/loam 1:1 soil mixture. Plants were grown in the greenhouse at a photoperiod of 16 h light, 22 °C/8 h dark, 14 °C, with a light intensity of at least 220 μmol m−2 s−1 (Phillips Son-T AGRO). Watering and fertilization with 0.4% Wuxal Super solution (Wilhelm Haug GmbH & Co. KG, Ammerbuch, Germany) were performed as necessary to maintain vigorous plant growth. Response to Glyphosate. A dose response study was performed to verify the previous reports of glyphosate resistance of the different A. tuberculatus populations. The dose response relationship was established according to described methods.42−45 For each population plants of uniform size and appearance were selected, and nine plants 8135

dx.doi.org/10.1021/jf501040x | J. Agric. Food Chem. 2014, 62, 8134−8142


Article

Table 1. ED50 and ED90 Values and R/S Ratios of A. tuberculatus Populations (n = 9) to Glyphosate; Dose Response Relationship in Shikimic Acid Concentration 4 DAT and Fresh Weight Assessment 19 DATa shikimate accumulation, 4 DAT

a

fresh weight, 19 DAT

population ratio

ED50 (g ae ha−1)

R/S ratio

ED50 (g ae ha−1)

95% confidence interval

R/S ratio

ED90 (g ae ha−1)

IL-R MO-R1 MO-R2 MO-R3 MO-R4 MO-R5 MO-S

192 419 224 393 419 310 68

2.8 a 6.2 b 3.3 ab 5.8 b 6.2 b 4.6 ab 1c

420 317 410 411 405 460 61

349−491 234−399 313−506 294−524 306−503 335−584 46−76

6.8 a 5.2 a 6.7 a 6.7 a 6.7 a 7.5 a 1b

1363 1728 1096 2021 1420 2969 291

Means with the same letter are not statistically different (P = 0.05).

To visualize differences in glyphosate transport, autoradiographs were obtained at 8, 18, 48, and 96 HAT. Treated plants of each population and at each time point including the washed leaf and rinsed root were fixed on a paper sheet (20 × 40 cm) and pressed until complete dryness. The dry plants were exposed to a phosphoimaging film (Fujifilm BAS-MS-2040) for 48 h before image detection (BASreader 1000, Fujix, Japan). Background reduction and image evaluation were performed with AIDA Image Analyzer software 4.19 (Raytest, Germany). EPSPS Target-Site Detection. Pyrosequencing was used to detect target-site mutations at G101, T102, or P106 in the A. tuberculatus EPSPS gene sequence with modifications.49 The DNA was purified with the Qiagen DNeasy Plant mini kit in eight biological and three technical replicates each. For the sequencing reactions a 195 bp long DNA fragment was amplified using the forward primer gly.a.3f (5′ ATGTTGGACGCTCTCAGAACTCTTGGT 3′) and the 5′-biotinylated reverse primer gly.a.4r (BT - 5′ TGAATTTCCTCCAGCAACGGCAA 3′) in a polymerase chain reaction (PCR). The PCR conditions were 15 min of preincubation at 95 °C, followed by 45 cycles at 94 °C denaturating step (30 s), 55 °C annealing temperature (40 s), 70 °C elongation (40 s)m and a final extension step for 10 min at 70 °C (Eppendorf Mastercycler ep Thermal Cyclers, Hamburg, Germany). The primer gly.pyro.a1.1 (5′ GGAAATGC(AT)GGAACAGCGATGCG 3′) was used to sequence the coding sites G101 and T102, whereas the primer gly.pyro.a1.2 (5′ CAACTTTT(CT)CTTGGAAATGC 3′) was used to sequence the coding site P106 in a Pyromark PSQ 96 device. Evaluation was in all cases done with the manufacturer’s software (Qiagen, Hilden, Germany). Relative Genomic EPSPS Gene Copy Number. The EPSPS gene copy number in the A. tuberculatus genomic DNA was determined as previously described with minor modifications.34 Due to the high homology of EPSPS and ALS genes of both closely related species, the same quantitative PCR (qPCR) method was used to determine the relative EPSPS gene copy number in 16 A. tuberculatus plants of each population. The DNA was purified using the Promega Wizard Magnetic 96 DNA Plant system kit (Madison, WI, USA) according to manufacturer’s instructions. The comparison was done at a level of 12 times the standard deviation of the background by using the model of crossing points with the manufacturer’s software (Roche LightCycler 480 1.5, Mannheim, Germany). The difference between the ALS gene and the EPSPS gene was expressed as relative EPSPS gene amount in relation to the ALS reference gene (2ΔCp).34,50,51 A calibration curve was performed using increasing DNA concentrations to determine the amplification efficacy of each primer combination. EPSPS Expression Characteristics. Plants at four-leaf stage, BBCH 14, were sprayed with 720 g ae ha−1 glyphosate (Roundup Ultramax, 450 g ae L−1 glyphosate) using a single-nozzle overhead track sprayer outfitted with Teejet 8001 nozzle at 280 kPA and a spray volume of 200 L ha−1. Plant samples from the shoot tip were taken directly before treatment and at 4, 8, 24, and 48 HAT from both treated and untreated plants maintained under identical conditions.52 RNA was purified with a RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instruction, followed by DNase I (Invitrogen, Carlsbad, CA, USA) treatment. The cDNA synthesis was

performed using the Superscript kit (Invitrogen). The expression of EPSPS and ALS mRNA was determined using the previously described method.34 A 242 bp long fragment from the Actin gene was used as an additional reference gene. The Actin gene fragment was amplified with the primer pair act.a.1f (5′ GACTCTGGTGATGGTGTGAGTC 3′) and act.a.2r (5′ GAGCTGCTCTTGGCAGTCTC 3′). Evaluation was done as previously described with the manufacturer’s software (Roche LightCycler 480 1.5). The obtained crossing points of the Actin fragment were tested for statistical differences in all time points with a t test (P = 0.05) for the populations MO-S, MO-R1, and IL-R and for all time points. Because no changes in expression were observed, the Actin gene was used as a stably expressed reference gene. The values obtained for the Actin gene were tested for their homogeneity by ANOVA (t test). The relative expression values of the EPSPS and ALS genes were given by the ratio of their respective absolute values with those obtained for the Actin gene. Significant differences between the relative ALS and EPSPS gene expression values at different time points were tested by ANOVA at a probability value of P = 0.05 (Sigmaplot 11.0, Erkrath, Germany). EPSPS Enzyme Activity. The EPSPS enzyme activity was measured in crude extracts prepared from the youngest leaves and shoot tip of actively growing plants according to previously described methods with minor modifications.53 The final extract was mixed with 20% glycerol (v/v) and stored at −20 °C. The protein concentration was determined in a Bradford assay (Bio-Rad, Hercules, CA, USA), and bovine serum albumin (BSA) (Sigma-Aldrich Inc., St. Louis, MO, USA) was used to establish the calibration curve.54 Results are given as micrograms of BSA equivalent protein. The EPSPS activity was measured by monitoring the Pi release of the crude protein extract.34 The color reaction was continuously measured at 360 nm in a Fluostar Optima 96-well plate reader to determine EPSPS enzyme parameters. The S-3-P concentration was held constant at 0.5 mM while the PEP concentration was varied (0, 0.016, 0.031, 0.0625, 0.125, 0.25, and 0.5 mM PEP). The experiments were conducted with two technical and at least two biological replicates of each population (IL-R and MO-S). A calibration curve was used to express the enzyme activity as micromoles Pi released. Enzyme kinetic parameters were determined using the linear Lineweaver−Burk model55 and Sigmaplot 11.0. A probability value of P < 0.05 was chosen to determine significant differences in a t test between populations (SigmaPlot 11.0).

■

RESULTS Response to Glyphosate. The fresh weight of treated plants of A. tuberculatus populations IL-R, MO-R1, MO-R2, MO-R3, MO-R4, and MO-R5 assessed 19 DAT (Supporting Information Figure SI1) showed ED50 values between 317 and 460 g ae ha−1, whereas the ED50 of the susceptible population MO-S was 61 g ae ha−1 (Table 1). None of the susceptible plants would survive labeled glyphosate rates, as their ED90 values were below 300 g ae ha−1 glyphosate (Table 1). The resistant populations were clustered together with average ED50 values of 396 g ae ha−1 and a resistance factor of >5-fold. Some 8136



Article

Table 2. Maximum Glyphosate Foliar Absorption and Translocation (Amax) in Percentage of Applied Radioactivity and Time Required To Reach 50% of the Amax Value (T50) in the Different Plant Tissues Assessed in the A. tuberculatus Populations MOS, MO-R1, and IL-R (n = 9; Standard Errors in Parentheses)a IL-R

MO-R1

Amax

T50 (h)

absorption

58.2 (3.17)

ns

applied leaf shoot root shoot tip

33.6 3.8 0.6 5.1

ns ns ns ns

(3.4) (0.9) (0.2) (3)

28.2 (9) 29.2 57.8 0.5 447.9

(15.6) (49.3) (14.6) (405.7)

Amax

MO-S T50 (h)

Glyphosate Absorption of Treated Leaf ns 69.1 (4) ns 60.8 (14.2) Glyphosate Translocation Throughout Plant ns 46.3 (3.6) ns 68.4 (20.9) ns 4.3 (0.8) ns 87.1 (55.2) ns 0.7 (0.1) ns 0.6 (10.8) ns 5.4 (NA) NA 549.3 (NA)

Amax

T50 (h)

ns

59.4 (3.8)

51.9 (14.8)

ns ns ns NA

37.4 6 0.6 1.6

(3.1) (1.6) (0.1) (0.3)

47 158.3 0.5 74

(18.2) (121.3) (13.3) (54.6)

a Data fitted to the rectangular hyperbolic model. No significant statistical differences (ns) were observed between MO-R1 and IL-R compared to MO-S. NA = not applicable.

plants within these populations survived dose rates of 720 g ae ha−1 glyphosate, as their ED90 values were between 1350 and 3000 g ae ha−1 glyphosate. Glyphosate Absorption and Translocation. Total average recovery of applied radioactivity was 90% in the glyphosate absorption and translocation experiments. Approximately 62.2 ± 2.2% of the total applied radioactivity was the maximum absorption of the A. tuberculatus populations MO-S, MO-R1, and IL-R (Table 2; Supporting Information Figure SI2). On average 46.4 ± 7.5 h was necessary to absorb 50% of the maximum amount of radioactivity. No significant differences in absorption were observed between glyphosatesusceptible and -resistant populations at any time points analyzed. Radioactivity was detected in all plant parts 8 HAT, and concentration increased with time (Supporting Information Figure SI3). Translocation occurred at a nearly constant rate over the 96 h time frame, especially into the root. There were no differences between populations in total amount of glyphosate translocated to the different plant tissues among the investigated populations MO-S, MO-R1, and IL-R (Table 2; Supporting Information Figure SI3). The average maximum amounts of translocation into the root, shoot, and shoot tip and in the applied leaf were 0.65 ± 0.1, 4.8 ± 0.6, 3.1 ± 0.7, and 40 ± 2.1% of total applied radioactivity, respectively. There were also no significant differences in the rate of translocation. The times to reach 50% of the maximum amount of radioactivity (T50) in the root, shoot, shoot tip, and applied leaf were 0.55 ± 7.1, 104 ± 43, 242 ± 113.3, and 52 ± 11.7 h after application, respectively. Significant differences among populations were solely obtained from the calculation of the time needed to reach 90% of the maximum translocated amount (T90) in the shoot tip. The glyphosate-resistant populations MO-R1 and IL-R absorbed significantly more radioactivity in the shoot tip 72 HAT (2.6 ± 0.6 and 2.3 ± 0.3%, respectively) than the glyphosate-susceptible population MO-S (1.5 ± 0.4%). At T50 no significant differences between resistant and susceptible populations were found in translocation to the shoot tip (Table 2). The autoradiographs in Figure 1 revealed no differences in the translocation of 14C-labeled glyphosate throughout susceptible and resistant plants. Radioactivity was distributed throughout the plant by 8 HAT, with the highest radioactivity found in the youngest and most actively growing plant parts. The amount of radioactivity in older and less active plant parts and the overall amount in each tissue increased with time. Additionally, no localized differences in directed translocation

Figure 1. Phosphorimaging visualization of 14C-glyphosate translocation in A. tuberculatus populations IL-R, MO-R1, and MO-S at 8, 18, 48, and 96 HAT. Arrow heads indicate the treated leaves at 96 HAT, rinsed at harvest time and dried separately. Each plant is representative of five plants tested at each time point. Increasing color intensity indicates a higher amount of radioactivity within the plant material.

into leaf margins or into any specific plant organs were observed in these glyphosate-resistant A. tuberculatus populations. Mutations in the EPSPS Coding Sequence. Using pyrosequencing to genotype multiple individuals from each glyphosate-resistant A. tuberculatus population, no DNA sequence mutations were found in any individual that altered the predicted EPSPS amino acid sequence at position G101, T102, or P106 (data not shown). 8137



Article

EPSPS Gene Amplification. Comparable amounts of EPSPS and ALS genes in the genome of the susceptible A. tuberculatus population MO-S were measured with 1.1 ± 0.4 relative EPSPS gene copies (Figure 2). The glyphosate-resistant

S (P = 0.05), but there were no significant EPSPS expression changes at any time point within a population (Table 3). EPSPS Enzyme Activity. The EPSPS Km (app) (PEP) values of MO-S and IL-R were 58.49 and 59.92 μM PEP, respectively (Table 4). The lack of difference suggests that no alterations in the EPSPS amino acid sequence influencing the enzyme activity occur in the IL-R population. Significant differences were found in the Vmax values with a 2.4 times higher Pi release in IL-R (Vmax of 0.15 μmol Pi s−1) than in MOS (Vmax of 0.64 μmol Pi s−1). Differences were also obtained in the total EPSPS activity per equivalent total protein present in crude extracts. The Kcat value of the resistant population IL-R was 3.7 times higher than the Kcat value of the susceptible population MO-S, whereas the Kcat values of MO-R1, MO-R3, and MO-R4 were about 2 times higher (Table 4). These differences are due to the higher EPSPS enzyme quantity present in the total extract.

■

DISCUSSION Glyphosate Resistance of the A. tuberculatus Populations. Glyphosate resistance was confirmed in the tested A. tuberculatus populations IL-R, MO-R1, MO-R2, MO-R3, MOR4, and MO-R5 with an average RF of 6.5 ± 0.33, which is at a lower level than found in other glyphosate-resistant A. tuberculatus or A. palmeri populations.10,13,33 The 2-fold higher sensitivity of the susceptible population MO-S in comparison to previous results for the same population10 might explain part of this difference and shows also the impact of environmental conditions on plant susceptibility to herbicides, including glyphosate. Nevertheless, with an ED90 value of 1096−2969 g ae ha−1 several plants of the populations MO-R1, MO-R2, MOR3, MO-R4, MO-R5, and IL-R will survive the recommended field rate of 720 g ae ha−1 glyphosate and will be able to set viable seeds. Ongoing glyphosate selection pressure will most probably enable the further evolution of higher resistance factors in A. tuberculatus. The accumulation of shikimic acid in plant tissue after glyphosate treatment can be used for an early determination of glyphosate efficacy.17,23 In the present work shikimic acid content indicated the populations could be grouped according to their response to glyphosate into two different groups. The susceptible and resistant populations were clearly separated by the ED50 values, with all resistant populations at least 2.8-fold more resistant than the susceptible population MO-S. This method is suitable to distinguish between resistant and susceptible plants. Also, the ED50 values and the R/S factors calculated from the shikimic acid levels of the population MO-S and the different MO-R populations provide a reasonable correlation with the fresh weight data assessed 19 DAT. In comparison, the weaker correlation between the shikimic acid response after glyphosate treatment and the fresh weight data

Figure 2. Genomic EPSPS gene copy number in A. tuberculatus populations IL-R, MO-R1, MO-R2, MO-R3, MO-R4, MO-R5, and MO-S relative to the ALS gene. Individual plants were not selected for their glyphosate resistance before EPSPS gene copy number measurement (n = 16); IL-R = 7.1 ± 0.84 relative EPSPS genes; MO-R1 = 2.3 ± 0.15; MO-R2 = 2.5 ± 17; MO-R3 = 1.7 ± 0.15; MOR4 = 2.7 ± 0.4; MO-R5 = 2.9 ± 0.23; and MO-S = 1.1 ± 0.04. Different letters indicate significant differences among populations (P = 0.05).

plants had on average a higher amount of EPSPS genes in their genome, from 2- to 8-fold (Figure 2). IL-R had the highest EPSPS gene amplification with on average 7.1 ± 0.84 relative EPSPS genes. The populations collected in Missouri had on average 2.4 ± 0.11 relative EPSPS genes in the genome. The highest gene amplification found in a single resistant plant of the Missouri populations was 6 times the ALS gene, but each population also contained some individuals bearing an equal EPSPS and ALS copy number. To study whether amplified EPSPS genes were expressed differently after glyphosate application, the EPSPS mRNA expression in untreated plants was compared to those of plants treated with the recommended field rate of 720 g ae ha−1 glyphosate. The Actin gene and the ALS gene were tested for their stable expression among time points and individual plants and found to be suitable as stably expressed reference genes. The EPSPS mRNA expression was significantly higher in both A. tuberculatus populations MO-R1 and IL-R compared to MO-

Table 3. EPSPS Gene Expression Expressed as Fold-Change Relative to the ALS Gene (Standard Error in Parentheses) in Individuals (n = 4) of the A. tuberculatus Populations IL-R, MO-R1, and MO-S at Different Time Points after Glyphosate Treatment (720 g ae ha−1)a 0 HAT IL-R MO-S MO-R1 a

4 HAT

8 HAT

24 HAT

48 HAT

untreated

untreated

treated

untreated

treated

untreated

treated

untreated

treated

5.5 (1.3) 1.0 (0.08) 4.5 (0.6)

4.3 (0.7) 1.0 (0.09) 2.1 (0.14)

4.7 (0.73) 1.0 (0.13) 2.7 (0.4)

6.2 (0.42) 1.0 (0.08) 2.6 (0.23)

5.6 (1.4) 1.0 (0.04) 2.2 (0.37)

6.8 (0.79) 1.0 (0.04) 2.4 (0.3)

6.6 (0.78) 1.1 (0.18) 3.6 (1.2)

7.7 (1.46) 1.0 (0.12) 3.5 (0.49)

7.9 (1.61) 1.0 (0.17) 2.7 (0.53)

Individuals were not selected for glyphosate resistance prior to EPSPS expression measurement. 8138



Article

Table 4. Native EPSPS Protein Activity of Plants of the A. tuberculatus Populations MO-S, IL-R, MO-R1, MO-R3, and MO-R4a KM(app) (PEP) (μM) Vmax(μmol Pi s−1) Kcat (μmol Pi μg−1 protein)

MO-S

IL-R

MO-R1

MO-R3

MO-R4

58.49 ns 0.064 a 11.43 a

59.92 ns 0.15 b 41.25 b

nd nd 22.5 c

nd nd 22.75 c

nd nd 21.75 c

a

Plants used for the enzyme extraction were not selected for their glyphosate resistance. Values are the mean of two biological replications with two technical replicates each. Samples with different letters are significantly different (P = 0.05); ns, not significant; nd, not determined. Crude protein is given in μg BSA equivalent.

levels showed the same differences between the resistant and susceptible populations as found in genomic DNA. A previous paper hypothesized that glyphosate resistance in A. tuberculatus could be determined by a polygenic event.70 A positive correlation between EPSPS gene copy number and increasing glyphosate resistance level has been reported in A. palmeri35,71 and L. multif lorum,57 consistent with the current results showing gene dosage effects of additional EPSPS gene copies. EPSPS Enzyme Kinetics. Previous results showed higher EPSPS protein content in a glyphosate-resistant A. palmeri population by immunoblotting and a higher EPSPS activity during the determination of IC50 values for glyphosate.34,35 The EPSPS enzyme activity was measured to test resistant A. tuberculatus plants for a higher EPSPS enzyme content relative to susceptible. Glyphosate inhibits EPSPS as a competitive inhibitor of PEP.72 Higher Km(app) (PEP) values indicate a lower enzyme affinity to its substrate PEP and decreases EPSPS activity at lower PEP concentrations.72 Glyphosate-resistant plant EPSPS enzymes with target-site mutations typically have increased Km(app) (PEP) values in comparison to wild-type enzymes.72 The Km(app) (PEP) values were determined in the A. tuberculatus populations MO-S and IL-R. The values, although measured in a crude enzyme extract, are comparable to published values (e.g., Corydalis sempervirens and Zea mays).41,73 They are about 10-fold higher than those published for Sorghum bicolor, Escherichia coli, and Pseudomonas aeruginosa and also for the EPSPS of Eleusine indica and Zea mays expressed in E. coli.25,74,75 As the Km values between the protein extracts IL-R and MO-S plants were not significantly different, it can be hypothesized that the EPSPS enzyme sequence therefore contained no mutations influencing affinity to PEP, the competitive substrate of glyphosate. In addition, no known resistance-endowing EPSPS mutations76 were found using pyrosequencing. A different A. tuberculatus population was reported with a P106S mutation,13 again demonstrating that different populations of the same species may have different resistance mechanisms.24 Whereas no significant differences were obtained between the Km(app) (PEP) values between resistant and susceptible populations, the Vmax and Kcat values were significantly different between resistant and susceptible individuals. Because the Vmax and K cat values were measured at an equal protein concentration, but not at an equal EPSPS concentration, among populations, the higher Vmax and Kcat values indicate a higher proportion of EPSPS in the protein pool of resistant plants. Increases of 2.3 and 3.7 times in Vmax and Kcat values, respectively, were measured between resistant and susceptible A. tuberculatus plants. These values, from a naturally evolved plant population, are lower than those reported for the same mechanism selected in cell culture experiments, for example, a 40-fold increase in EPSPS activity in C. sempervirens.41 However, the obtained values are already high enough to mediate plant glyphosate resistance in the field. The R/S ratio

for the IL-R population is probably reflecting bigger genetic differences to the susceptible population MO-S. Determining shikimic acid levels using a dose response provides an early separation of resistant and susceptible individuals, but this approach is not suitable for early and exact prediction of ED50 values or of R/S ratios between different resistant A. tuberculatus populations. The exact accumulation of shikimate is known to vary between species and populations with different resistance mechanisms.13,56,57 Absorption and Translocation of 14C-Glyphosate. Because altered glyphosate translocation is a common glyphosate resistance mechanism in some weeds, translocation patterns were evaluated to clarify whether this mechanism contributes to glyphosate resistance of A. tuberculatus populations.58 No spatial or temporal differences in glyphosate translocation were observed in the A. tuberculatus populations analyzed. Slightly higher glyphosate translocation to the shoot tip occurred in glyphosate-resistant populations; however, the higher translocation is likely due to herbicide injury in the susceptible biotype, resulting in what is known as self-limiting translocation.59 Previous research reported similar absorption during the first 50 HAT in a glyphosate-susceptible A. tuberculatus population,60 which is comparable to data reported here. Glyphosate absorption is within the common range for other species, such as C. canadensis.61 Glyphosate translocation observed in these A. tuberculatus populations was similar to more typical patterns of glyphosate translocation,22,60,62 and differences in absorption or translocation like those described in glyphosate-resistant C. canadensis, S. halepense, L. multif lorum, and L. rigidum populations were not found.26−30 Although reduced translocation has been reported in an A. tuberculatus population from Mississippi,13 our data clearly demonstrated that glyphosate resistance in these A. tuberculatus populations is not based on reduced absorption. This diversity in resistance mechanisms among different populations of the same species has been frequently described.24 EPSPS Gene Amplification. The A. tuberculatus populations MO-R1, MO-R2, MO-R3, MO-R4, MO-R5, and IL-R were resistant to glyphosate in the dose response study; however, on the basis of R/S values resistance was lower than the glyphosate-resistant A. palmeri population from Georgia, USA.33,63 Because A. palmeri and A. tuberculatus are closely related species and are able to produce fertile crosses, EPSPS gene amplification was also evaluated in these populations.64−66 We found evidence that the glyphosate-resistant A. tuberculatus populations evolved EPSPS gene amplification, similar to previous reports for multiple species with EPSPS gene copy increases from 2−10-fold up to 40−100-fold.3,34,35,57,67−69 Despite differences in EPSPS copy number, all glyphosateresistant A. tuberculatus populations had similar glyphosate resistance based on fresh weight assessment 19 DAT. EPSPS expression in IL-R, MO-R1, or MO-S was not induced or silenced by glyphosate treatment, but the EPSPS transcript 8139



Article

(4) Sellers, B. A.; Smeda, R. J.; Johnson, W. G.; Kendig, J. A.; Ellersieck, M. R. Comparative growth of six Amaranthus species in Missouri. Weed Sci. 2003, 51, 329−333. (5) Costea, M.; Weaver, S. E.; Tardif, F. J. The biology of invasive alien plants in Canada. 3. Amaranthus tuberculatus (Moq.) Sauer var. rudis (Sauer) Costea & Tardif. Can. J. Plant Sci. 2005, 85, 507−522. (6) Steckel, L. E.; Sprague, C. L. Common waterhemp (Amaranthus rudis) interference in corn. Weed Sci. 2004, 52, 359−364. (7) Bell, M. S.; Hager, A. G.; Tranel, P. J. Multiple resistance to herbicides from four site-of-action groups in waterhemp (Amaranthus tuberculatus). Weed Sci. 2013, 61, 460−468. (8) Foes, M. J.; Liu, L. X.; Tranel, P. J.; Wax, L. M.; Stoller, E. W. A biotype of common waterhemp (Amaranthus rudis) resistant to triazine and ALS herbicides. Weed Sci. 1998, 46, 514−520. (9) Heap, I. The International Survey of Herbicide Resistant Weeds; available at www.weedscience.com (accessed May 14, 2013). (10) Legleiter, T. R.; Bradley, K. W. Glyphosate and multiple herbicide resistance in waterhemp (Amaranthus rudis) populations from Missouri. Weed Sci. 2008, 56, 582−587. (11) Sprague, C. L.; Stoller, E. W.; Wax, L. M.; Horak, M. J. Palmer amaranth (Amaranthus palmeri) and common waterhemp (Amaranthus rudis) resistance to selected ALS-inhibiting herbicides. Weed Sci. 1997, 45, 192−197. (12) Ma, R.; Kaundun, S. S.; Tranel, P. J.; Riggins, C. W.; McGinness, D. L.; Hager, A. G.; Hawkes, T.; McIndoe, E.; Riechers, D. E. Distinct detoxification mechanisms confer resistance to mesotrione and atrazine in a population of waterhemp. Plant Physiol. 2013, 163, 363−377. (13) Nandula, V. K.; Ray, J. D.; Ribeiro, D. N.; Pan, Z.; Reddy, K. N. Glyphosate resistance in tall waterhemp (Amaranthus tuberculatus) from Mississippi is due to both altered target-site and nontarget-site mechanisms. Weed Sci. 2013, 61, 374−383. (14) McCue, K. F.; Conn, E. E. Induction of shikimic acid pathway enzymes by light in suspension cultured cells of parsley (Petroselinum crispum). Plant Physiol. 1990, 94, 507−510. (15) Weaver, L. M.; Herrmann, K. M. Dynamics of the shikimate pathway in plants. Trends Plant Sci. 1997, 2, 346−351. (16) Herrmann, K. M.; Weaver, L. M. The shikimate pathway. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 473−503. (17) Harring, T.; Streibig, J. C.; Husted, S. Accumulation of shikimic acid: a technique for screening glyphosate efficacy. J. Agric. Food Chem. 1998, 46, 4406−4412. (18) Cromartie, T. H.; Polge, N. D. An improved assay for shikimic acid and its use as a monitor for the activity of sulfosate. Proc. Weed Sci. Soc. Am. 2000, 40, 291. (19) Koger, C. H.; Shaner, D. L.; Henry, W. B.; Nadler-Hassar, T.; Thomas, W. E.; Wilcut, J. W. Assessment of two nondestructive assays for detecting glyphosate resistance in horseweed (Conyza canadensis). Weed Sci. 2005, 53, 438−445. (20) Pline, W. A.; Wilcut, J. W.; Duke, S. O.; Edmisten, K. L.; Wells, R. Tolerance and accumulation of shikimic acid in response to glyphosate applications in glyphosate-resistant and nonglyphosateresistant cotton (Gossypium hirsutum L.). J. Agric. Food Chem. 2002, 50, 506−512. (21) Singh, B. K.; Shaner, D. L. Rapid determination of glyphosate injury to plants and identification of glyphosate-resistant plants. Weed Technol. 1998, 12, 527−530. (22) Lorentz, L.; Beffa, R.; Kraehmer, H. Recovery of plants and histological observations on advanced weed stages after glyphosate treatment. Weed Res. 2011, 51, 333−343. (23) Shaner, D. L.; Nadler-Hassar, T.; Henry, W. B.; Koger, C. H. A rapid in vivo shikimate accumulation assay with excised leaf discs. Weed Sci. 2005, 53, 769−774. (24) Powles, S. B.; Yu, Q. Evolution in action: plants resistant to herbicides. Annu. Rev. Plant Biol. 2010, 61, 317−347. (25) Baerson, S. R.; Rodriguez, D. J.; Tran, M.; Feng, Y. M.; Biest, N. A.; Dill, G. M. Glyphosate-resistant goosegrass. Identification of a mutation in the target enzyme 5-enolpyruvylshikimate-3-phosphate synthase. Plant Physiol. 2002, 129, 1265−1275.

of Vmax and Kcat values is slightly lower than the R/S ratio of EPSPS gene expression results. This slight reduction could be caused by regulatory mechanisms of protein translation or turnover. In plants, the variability of protein levels in relation to the genome or the transcriptome is unknown.77,78 In mouse cells, mRNA levels can explain about 40% of the variability in the protein level.77 In A. tuberculatus this relationship is unknown. Nevertheless, the different Vmax and Kcat values indicate an increased amount of active EPSPS in the protein pool of resistant plants and emphasize gene amplification as the glyphosate resistance mechanism in A. tuberculatus populations. The results of this work strongly suggest that EPSPS gene amplification and the higher content and activity of the EPSPS enzyme in glyphosate-resistant plants are the main mechanisms involved in the glyphosate resistance in the tested A. tuberculatus populations. In conclusion, we have compared glyphosate susceptibility of several A. tuberculatus populations from Missouri and Illinois, USA. Glyphosate resistance was observed in each population, either confirming previous reports10 or reported for the first time. Physiological, biochemical, and molecular approaches showed that the resistance mechanisms of altered glyphosate absorption and translocation and target-site mutations in the EPSPS coding sequence could be excluded as the cause of the observed glyphosate resistance in these populations. We showed that EPSPS gene amplification occurred in several of these A. tuberculatus populations from the areas most affected by resistance, and the amplified EPSPS genes resulted in higher EPSPS mRNA expression and higher EPSPS protein activity. On the basis of these results we propose that glyphosate resistance in these A. tuberculatus populations is mainly based on amplification of the EPSPS gene.

■

ASSOCIATED CONTENT

S Supporting Information *

Name, origin, and year of collection for A. tuberculatus populations; glyphosate dose response data; glyphosate absorption and translocation data. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*(R.B.) Phone: +49 69 305 14887. Fax: +49 69 305 34676. Email: roland.beff[email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The seeds of the different A. tuberculatus populations were kindly provided by B. Young, A. Hager, A. York, and K. Bradley for further work.

■

REFERENCES

(1) Costea, M.; DeMason, D. A. Stem morphology and anatomy in Amaranthus L. (Amaranthaceae) − taxonomic significance. J. Torrey Bot. Soc. 2001, 128, 254−281. (2) Horak, M. J.; Loughin, T. M. Growth analysis of four Amaranthus species. Weed Sci. 2000, 48, 347−355. (3) Tranel, P. J.; Riggins, C. W.; Bell, M. S.; Hager, A. G. Herbicide resistances in Amaranthus tuberculatus: a call for new options. J. Agric. Food Chem. 2011, 59, 5808−5812. 8140



Article

(45) Ritz, C.; Streibig, J. C. Bioassay analysis using R. J. Statist. Software 2005, 12. (46) Hess, M.; Barralis, G.; Bleiholder, H.; Buhr, L.; Eggers, T.; Hack, H.; Stauss, R. Use of the extended BBCH scale − general for the descriptions of the growth stages of mono- and dicotyledonous weed species. Weed Res. 1997, 37, 433−441. (47) R Development Core Team (2012). R: A Language and Environment for Statistical Computing, version 2.15.0; R Foundation for Statistical Computing: Vienna, Austria, 2012; ISBN 3-900051-07-0, http://www.R-project.org. (48) Kniss, A. R.; Vassios, J. D.; Nissen, S. J.; Ritz, C. Nonlinear regression analysis of herbicide absorption studies. Weed Sci. 2011, 59, 601−610. (49) Beffa, R.; Figge, A.; Lorentz, L.; Hess, M.; Laber, B.; RuizSantaella, J. P. Weed resistance diagnostic technologies to detect herbicide resistance in cereal growing areas. A review (25th German Conference on Weed Biology and Weed Control). Julius-Kühn-Arch. 2012, 434, 75. (50) Larionov, A.; Krause, A.; Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinf. 2005, 6, 62. (51) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−DDCt method. Methods 2001, 25, 402−408. (52) Zhu, J.; Patzoldt, W. L.; Shealy, R. T.; Vodkin, L. O.; Clough, S. J.; Tranel, P. J. Transcriptome response to glyphosate in sensitive and resistant soybean. J. Agric. Food Chem. 2008, 56, 6355−6363. (53) Arnaud, L.; Sailland, A.; Lebrun, M.; Pallett, K.; Ravanel, P.; Nurit, F.; Tissut, M. Physiological behavior of two tobacco lines expressing EPSP synthase resistant to glyphosate. Pestic. Biochem. Physiol. 1998, 62, 27−39. (54) Bradford, M. M. Rapid and sensitive method for quantitation of microgram quantities of protein utilizing principle of protein-dye binding. Anal. Biochem. 1976, 72, 248−254. (55) Lineweaver, H.; Burk, D. The determination of enzyme dissociation constants. J. Am. Chem. Soc. 1934, 56, 658−666. (56) Culpepper, A. S.; Grey, T. L.; Vencill, W. K.; Kichler, J. M.; Webster, T. M.; Brown, S. M.; York, A. C.; Davis, J. W.; Hanna, W. W. Glyphosate-resistant Palmer amaranth (Amaranthus palmeri) confirmed in Georgia. Weed Sci. 2006, 54, 620−626. (57) Salas, R. A.; Dayan, F. E.; Pan, Z.; Watson, S. B.; Dickson, J. W.; Scott, R. C.; Burgos, N. R. EPSPS gene amplification in glyphosateresistant Italian ryegrass (Lolium perenne ssp. multif lorum) from Arkansas. Pest Manag. Sci. 2012, 68, 1223−1230. (58) Shaner, D. L. Role of translocation as a mechanism of resistance to glyphosate. Weed Sci. 2009, 57, 118−123. (59) Geiger, D. R.; Bestman, H. D. Self-limitation of herbicide mobility by phytotoxic action. Weed Sci. 1990, 38, 324−329. (60) Li, J. M.; Smeda, R. J.; Sellers, B. A.; Johnson, W. G. Influence of formulation and glyphosate salt on absorption and translocation in three annual weeds. Weed Sci. 2005, 53, 153−159. (61) Koger, C. H.; Reddy, K. N. Role of absorption and translocation in the mechanism of glyphosate resistance in horseweed (Conyza canadensis). Weed Sci. 2005, 53, 84−89. (62) Cruz-Hipolito, H.; Osuna, M. D.; Heredia, A.; Ruiz-Santaella, J. P.; De Prado, R. Nontarget mechanisms involved in glyphosate tolerance found in Canavalia ensiformis plants. J. Agric. Food Chem. 2009, 57, 4844−4848. (63) Gaines, T. A.; Shaner, D. L.; Ward, S. M.; Leach, J. E.; Preston, C.; Westra, P. Mechanism of resistance of evolved glyphosate-resistant Palmer amaranth (Amaranthus palmeri). J. Agric. Food Chem. 2011, 59, 5886−5889. (64) Franssen, A. S.; Skinner, D. Z.; Al-Khatib, K.; Horak, M. J.; Kulakow, P. A. Interspecific hybridization and gene flow of ALS resistance in Amaranthus species. Weed Sci. 2001, 49, 598−606. (65) Gaines, T. A.; Ward, S. M.; Bukun, B.; Preston, C.; Leach, J. E.; Westra, P. Interspecific hybridization transfers a previously unknown glyphosate resistance mechanism in Amaranthus species. Evol. Appl. 2012, 5, 29−38.

(26) Wakelin, A. M.; Preston, C. A target-site mutation is present in a glyphosate-resistant Lolium rigidum population. Weed Res. 2006, 46, 432−440. (27) Lorraine-Colwill, D. F.; Powles, S. B.; Hawkes, T. R.; Hollinshead, P. H.; Warner, S. A. J.; Preston, C. Investigations into the mechanism of glyphosate resistance in Lolium rigidum. Pestic. Biochem. Physiol. 2002, 74, 62−72. (28) Riar, D. S.; Norsworthy, J. K.; Johnson, D. B.; Scott, R. C.; Bagavathiannan, M. Glyphosate resistance in a Johnsongrass (Sorghum halepense) biotype from Arkansas. Weed Sci. 2011, 59, 299−304. (29) Perez-Jones, A.; Park, K.-W.; Polge, N.; Colquhoun, J.; MallorySmith, C. A. Investigating the mechanisms of glyphosate resistance in Lolium multif lorum. Planta 2007, 226, 395−404. (30) Feng, P. C. C.; Tran, M.; Chiu, T.; Sammons, R. D.; Heck, G. R.; CaJacob, C. A. Investigations into glyphosate-resistant horseweed (Conyza canadensis): retention, uptake, translocation, and metabolism. Weed Sci. 2004, 52, 498−505. (31) Ge, X.; d’Avignon, D. A.; Ackerman, J. J. H.; Sammons, R. D. Rapid vacuolar sequestration: the horseweed glyphosate resistance mechanism. Pest Manag. Sci. 2010, 66, 345−348. (32) Michitte, P.; De Prado, R.; Espinoza, N.; Ruiz-Santaella, J. P.; Gauvrit, C. Mechanisms of resistance to glyphosate in a ryegrass (Lolium multif lorum) biotype from Chile. Weed Sci. 2007, 55, 435− 440. (33) Culpepper, A. S.; Grey, T. L.; Vencill, W. K.; Kichler, J. M.; Webster, T. M.; Brown, S. M.; York, A. C.; Davis, J. W.; Hanna, W. W. Glyphosate-resistant Palmer amaranth (Amaranthus palmeri) confirmed in Georgia. Weed Sci. 2006, 54, 620−626. (34) Gaines, T. A.; Zhang, W.; Wang, D.; Bukun, B.; Chisholm, S. T.; Shaner, D. L.; Nissen, S. J.; Patzoldt, W. L.; Tranel, P. J.; Culpepper, A. S.; Grey, T. L.; Webster, T. M.; Vencill, W. K.; Sammons, R. D.; Jiang, J. M.; Preston, C.; Leach, J. E.; Westra, P. Gene amplification confers glyphosate resistance in Amaranthus palmeri. Proc. Natl. Acad. Sci. U.S.A. 2010, 107, 1029−1034. (35) Ribeiro, D. N.; Pan, Z.; Duke, S. O.; Nandula, V. K.; Baldwin, B. S.; Shaw, D. R.; Dayan, F. E. Involvement of facultative apomixis in inheritance of EPSPS gene amplification in glyphosate-resistant Amaranthus palmeri. Planta 2014, 239, 199−212. (36) Bass, C.; Field, L. M. Gene amplification and insecticide resistance. Pest Manag. Sci. 2011, 67, 886−890. (37) Goldsbrough, P. B.; Hatch, E. M.; Huang, B.; Kosinski, W. G.; Dyer, W. E.; Herrmann, K. M.; Weller, S. C. Gene amplification in glyphosate tolerant tobacco cells. Plant Sci. 1990, 72, 53−62. (38) Shah, D. M.; Horsch, R. B.; Klee, H. J.; Kishore, G. M.; Winter, J. A.; Tumer, N. E.; Hironaka, C. M.; Sanders, P. R.; Gasser, C. S.; Aykent, S.; Siegel, N. R.; Rogers, S. G.; Fraley, R. T. Engineering herbicide tolerance in transgenic plants. Science 1986, 233, 478−481. (39) Widholm, J. M.; Chinnala, A. R.; Ryu, J. H.; Song, H. S.; Eggett, T.; Brotherton, J. E. Glyphosate selection of gene amplification in suspension cultures of 3 plant species. Physiol. Plant. 2001, 112, 540− 545. (40) Nafziger, E. D.; Widholm, J. M.; Steinrucken, H. C.; Killmer, J. L. Selection and characterization of a carrot cell-line tolerant to glyphosate. Plant Physiol. 1984, 76, 571−574. (41) Smart, C. C.; Johanning, D.; Muller, G.; Amrhein, N. Selective overproduction of 5-enol-pyruvylshikimic acid 3-phosphate synthase in a plant-cell culture which tolerates high-doses of the herbicide glyphosate. J. Biol. Chem. 1985, 260, 6338−6346. (42) Knezevic, S. Z.; Streibig, J. C.; Ritz, C. Utilizing R software package for dose-response studies: the concept and data analysis. Weed Technol. 2007, 21, 840−848. (43) Michel, A.; Peterson, J.; Dogan, M. N.; Ernst, V. Anleitung zur Anlage und Auswertung von Versuchen zur Erstellung quantitativer Dosis-Wirkungsbeziehungen am Beispiel der Wirksamkeit von Herbiziden. Gesunde Pflanzen 1999, 51, 10−19. (44) Seefeldt, S. S.; Jensen, J. E.; Fuerst, E. P. Log-logistic analysis of herbicide dose-response relationships. Weed Technol. 1995, 9, 218− 227. 8141



Article

(66) Steinau, A. N.; Skinner, D. Z.; Steinau, M. Mechanism of extreme genetic recombination in weedy Amaranthus hybrids. Weed Sci. 2003, 51, 696−701. (67) Chandi, A.; Milla-Lewis, S. R.; Giacomini, D.; Westra, P.; Preston, C.; Jordan, D. L.; York, A. C.; Burton, J. D.; Whitaker, J. R. Inheritance of evolved glyphosate resistance in a North Carolina Palmer amaranth (Amaranthus palmeri) biotype. Int. J. Agron. 2012, DOI: 10.1155/2012/176108. (68) Mohseni-Moghadam, M.; Schroeder, J.; Ashigh, J. Mechanism of resistance and inheritance in glyphosate resistant Palmer amaranth (Amaranthus palmeri) populations from New Mexico, USA. Weed Sci. 2013, 61, 517−525. (69) Nandula, V. K.; Wright, A.; Molin, W.; Ray, J.; Bond, J.; Eubank, T. EPSPS amplification in glyphosate-resistant spiny amaranth (Amaranthus spinosus): a case of gene transfer via interspecific hybridization from glyphosate-resistant Palmer amaranth (Amaranthus palmeri). Pest Manag. Sci. 2014, DOI: 10.1002/ps.3754. (70) Zelaya, I. A.; Owen, M. D. K. Differential response of Amaranthus tuberculatus (Moq ex DC) JD Sauer to glyphosate. Pest Manag. Sci. 2005, 61, 936−950. (71) Vila-Aiub, M. M.; Goh, S. S.; Gaines, T. A.; Han, H.; Busi, R.; Yu, Q.; Powles, S. B. No fitness cost of glyphosate resistance endowed by massive EPSPS gene amplification in Amaranthus palmeri. Planta 2014, 239, 793−801. (72) Pline-Srnic, W. Physiological mechanisms of glyphosate resistance. Weed Technol. 2006, 20, 290−300. (73) Forlani, G.; Parisi, B.; Nielsen, E. 5-Enol-pyruvyl-shikimate-3phosphate synthase from Zea mays cultured cells. Plant Physiol. 1994, 105, 1107−1114. (74) Ream, J. E.; Steinrucken, H. C.; Porter, C. A.; Sikorski, J. A. Purification and properties of 5-enolpyruvylshikimate-3-phosphate synthase from dark-grown seedlings of Sorghum bicolor. Plant Physiol. 1988, 87, 232−238. (75) Vaithanomsat, P.; Brown, K. A. Isolation and mutation of recombinant EPSP synthase from pathogenic bacteria Pseudomonas aeruginosa. Process Biochem. 2007, 42, 592−598. (76) Sammons, D. R.; Gaines, T. A. Glyphosate resistance: state of knowledge. Pest Manag. Sci. 2014, 70, 1367−1377. (77) Schwanhaeusser, B.; Busse, D.; Li, N.; Dittmar, G.; Schuchhardt, J.; Wolf, J.; Chen, W.; Selbach, M. Global quantification of mammalian gene expression control. Nature 2011, 473, 337−342. (78) Muers, M. Gene expression: transcriptome to proteome and back to genome. Nat. Rev. Genet. 2011, 12, 518−518.

8142


Characterization of Glyphosate Resistance in Amaranthus

Recommend Documents