Characterization of Plasmodium falciparum Atypical Kinase PfPK7

Subscriber access provided by University of Newcastle, Australia

Characterization of Plasmodium falciparum Atypical Kinase PfPK7-Dependent Phosphoproteome Brittany N. Pease, Edward L. Huttlin, Mark P Jedrychowski, Dominique DorinSemblat, Daniela Sebastiani, Daniel T. Segarra, Bracken F. Roberts, Ratna Chakrabarti, Christian Doerig, Steven P. Gygi, and Debopam Chakrabarti J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.8b00062 • Publication Date (Web): 20 Apr 2018 Downloaded from http://pubs.acs.org on April 22, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Characterization of Plasmodium falciparum Atypical Kinase PfPK7Dependent Phosphoproteome Brittany N. Pease1, Edward L. Huttlin2, Mark P. Jedrychowski2, Dominique DorinSemblat3, Daniela Sebastiani1, Daniel T. Segarra1, Bracken F. Roberts1, Ratna Chakrabarti1, Christian Doerig4, Steven P. Gygi2, and Debopam Chakrabarti1* 1

Division of Molecular Biology and Microbiology, Burnett School of Biomedical

Sciences, University of Central Florida, Orlando, FL 32826, USA 2

Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA

3

Inserm U665, Institut National de Transfusion Sanguine, 6, rue Alexandre Cabanel,

75739 Paris Cedex 5, France 4

Infection and Immunity Program, Biomedicine Discovery Institute and Department of

Microbiology, Monash University, Clayton, Victoria 3800, Australia

*

Corresponding Author: [email protected]; 407-882-2256

1

ACS Paragon Plus Environment

Journal of Proteome Research 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT PfPK7 is an “orphan” kinase displaying regions of homology to multiple protein kinase families. PfPK7 functions in regulating parasite proliferation/development as evident from the phenotype analysis of knockout parasites. Despite this regulatory role, the functions of PfPK7 in signaling pathways are not known. To better understand PfPK7regulated phosphorylation events, we performed isobaric tag-based quantitative comparative phosphoproteomics of the schizont and segmenter stages from wild-type and pfpk7- parasite lines. This analysis identified 3,875 phosphorylation sites on 1,047 proteins. Among these phosphorylation events, 146 proteins with 239 phosphorylation sites displayed reduction in phosphorylation in the absence of PfPK7. Further analysis of the phosphopeptides revealed three motifs whose phosphorylation was down regulated in the pfpk7- cell line in both schizonts and segmenters. Decreased phosphorylation following loss of PfPK7 indicates that these proteins may function as direct substrates of PfPK7. We demonstrated that PfPK7 is active towards three of these potential novel substrates; however, PfPK7 did not phosphorylate many of the other proteins, suggesting that decreased phosphorylation in these proteins is an indirect effect. Our phosphoproteomics analysis is the first study to identify direct substrates of PfPK7 and reveals potential downstream or compensatory signaling pathways.

KEYWORDS

2


Page 2 of 41

Page 3 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Malaria, Plasmodium falciparum, intraerythrocytic cycle, phosphoproteomics, isobaric tags, TMT, phosphorylation, PfPK7, kinase-substrate pairs. INTRODUCTION Malaria continues to be one of the most prevalent infectious diseases, with half of the world’s population at risk of infection. Because of the wide prevalence of drugresistant Plasmodium falciparum strains that mitigate the efficacy of existing drugs, there is an urgent need to identify new drug targets for therapeutic intervention. Protein kinases (PKs) have become valuable assets as drug targets for their importance in a variety of cellular functions. There are >30 approved drugs for various ailments that target cellular kinases [1-3]. Protein kinases have also been proposed as targets for the development of novel antimalarial therapies [4-6]. Sequencing of the P. falciparum genome [7] has led to the identification of the complete repertoire of parasite PKs based on homology searches. Surprisingly, malaria genome sequence analysis revealed the presence of only 65 PKs, a small number compared to other free living alveolates [8, 9]. Many of the identified protein kinases exhibit temporal and spatial patterns of expression throughout the P. falciparum life cycle [10, 11]. Upon analysis and classification of the P. falciparum kinome, many homologs of eukaryotic PKs (ePKs) were found, while other P. falciparum kinases were classified as “orphan” kinases due to the inability to assign them to an ePK family through phylogenetic analysis [8, 12]. Kinases belonging to “orphan” kinase groups are of particular interest because they represent potential targets for selective interevention, in view of the absence of a human homolog [11, 13]. Additionally, it is of interest to

3



develop an understanding of the role of atypical Plasmodium kinases in regulating parasite cell growth and differentiation. Plasmodium falciparum protein kinase 7 (PfPK7) is one of the “orphan” kinases that displays regions of homology to more than one protein kinase family. The Cterminal lobe of PfPK7 has maximal homology to the MEK family, whereas the Nterminal lobe is related to the fungal cyclic AMP-dependent kinases [14]. Sequence analysis revealed that the two closest human homologs are dual specificity mitogenactivated protein kinase 3 (MAP2K3) and serine/threonine-protein kinase 6 with 33% and 26% sequence homology, respectively [11]. Previous studies have demonstrated that recombinant PfPK7 autophosphorylates and phosphorylates a number of generic substrates e.g., myelin basic protein, histone H2A, and β-casein [14]. Despite its homology to the MEK family of kinases, PfPK7 was not able to phosphorylate MAPK homologues and was not inhibited by MEK inhibitors; therefore, PfPK7 is not likely to function as a MEK homolog in P. falciparum [11]. PfPK7 is expressed in both the asexual and sexual stages of the parasite’s life cycle that occur in the human host, as well as in the mosquito stages. Dorin-Semblat et al. disrupted the pfpk7 gene, which resulted in a reduction in the parasite proliferation rate in human erythrocytes, an effect that is mediated through a reduction in the number of merozoites produced by each schizont. Interestingly, the knock-out of the cyclindependent kinase Pfcrk-5 results in a very similar phenotype [15]. Furthermore, the pfpk7- parasites were severely impaired in their ability to produce oocysts in the mosquito [16]. Taken together, the phenotypes in both schizogony and sporogony suggest that PfPK7 is involved in parasite proliferation and development.

4


Page 4 of 41

Page 5 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To better understand the involvement of PfPK7 in P. falciparum cell proliferation, we performed quantitative phosphoproteomics analysis in the wild type and pfpk7- cell lines. This analysis was conducted with samples from schizont and segmenter intraerythrocytic stages of the malaria parasite, because in the absence of a functional PfPK7 there is a decreased merozoite production by individual schizonts, suggesting functional impairment at the late stages of the asexual cycle. Here we present a comprehensive analysis of the PfPK7-regulated phosphoproteome during the schizont and segmenter asexual stages using isobaric labeling [14, 16].

MATERIALS AND METHODS P. falciparum Culture Both the P. falciparum parasite pfpk7- line and its parental 3D7 clone were grown at a 4-10% parasitemia and 4% hematocrit in RPMI 1640 culture medium supplemented with A+ erythrocytes and 0.5% Albumax as previously described [17]. Generation of the PfPK7 knockout line has been reported previously [16]. Cultures of the pfpk7- line were maintained in the presence of blasticidin S (2.5µg/ml). Parasites were doubly synchronized as described by Pease et al. [12]. First, schizont stage parasites were magnetically synchronized using a MACS LD (Miltenyi Biotec, Auburn, CA) column with a Midi-MACS Separator. Secondly, approximately 8h after MACS synchronization, the parasites had re-infected fresh red blood cells and entered the ring stage. Parasites were then re-synchronized by treatment with 5% sorbitol (w/v).

5



Parasite growth and parasitemia were periodically monitored by Giemsa-stained blood smears. Tightly synchronized rings (approximately 16h ± 4h post-invasion), trophozoites (26h ± 4h post-invasion), schizonts (approximately 36h ± 4h post-invasion), and segmenters (approximately 46h ± 4h post-invasion) were harvested for pfpk7parasites while tightly synchronized schizonts (approximately 36h ± 4h post-invasion), and segmenters (approximately 46h ± 4h post-invasion) were harvested for 3D7 parasites following established protocols [18]. Parasites were isolated by lysing the red blood cells in 0.1% saponin followed by thorough washing in PBS to remove as much RBC contaminants as possible. The subsequent parasite pellets were weighed and proteins were immediately extracted by lysis in an 8M urea lysis buffer supplemented with protease and phosphatase inhibitors (8M urea, 75mM Tris, pH 8.2, 1X HALT protease inhibitor, 1X HALT phosphatase inhibitor) [12]. Lysates were cleared by centrifugation for 10 min at 4°C at 14,000 rpm. Protein concentration was determined for each sample by BioRad Bradford Assay. Duplicate samples were prepared for each developmental stage and pooled. PfPK7 Knock Out Verification through Southern Blot Analysis and PCR Analysis The genotype of the pfpk7- clone had been thoroughly characterized as described in the original publication [16]; nevertheless, since the inactivation of the gene was achieved though single cross-over insertion of a plasmid, resulting in a pseudodiploid locus, rather than through double-cross-over gene deletion, it was important to verify that the pfpk7- genotype had been maintained prior to starting the experiments described below. Therefore, genomic DNA was isolated from wild type 3D7 and pfpk7parasites. A washed pellet of parasites obtained by saponin lysis was treated with

6


Page 6 of 41

Page 7 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


250mM EDTA, 2% sodium dodecyl sulfate, and 150µg/ml RNAse at 37°C for 1h. Next, the pellet was treated with 150µg/ml proteinase K at 60°C for 2h. The DNA was extracted with chloroform: phenol: isoamyl alcohol (25:24:1) and chloroform: isoamyl alcohol (24:1) followed by precipitation with ethanol and 0.3M sodium acetate. One microgram of each wild type 3D7 and pfpk7- DNA was digested with EcoRV and NcoI. The digested DNA was then fractionated on a 0.8% agarose gel and transferred to a Nytran SPC membrane (Schleicher and Schuell). Full length PfPK7 was used as the probe.

The

probe

was

generated

using

ATGAAGGATATTTTATCTAATTATTC

the

following

and

primers: primer

primer

1: 2:

TTATAATTTTTTCCTCTTTTTATAAAG. The full length PfPK7 gene was labeled with (32P)dCTP using the Prime-it II random primer labeling kit following the manufacturer’s instructions (Stratagene). After the probe was labeled, it was purified using the QIAquick Nucleotide Removal kit as instructed (QIAgen). Hybridization was carried out at 60°C overnight as described [19]. After thorough washing, autoradiograms of hybridized blots were prepared using Kodak Biomax MS film exposed at -80°C with the use of an intensifying screen. To further verify the presence of PfPK7 in the wild type 3D7 cell line and the absence of PfPK7 in the knock out cell line, genotype characterization through PCR analysis was performed. To verify creation of a pfpk7- cell line, genomic DNA was extracted from putative pfpk7- cells and their wild-type counterparts (3D7) and screened for presence of a partial PfPK7 gene [20]. The sequences for the primers had minor modifications, compared to that published earlier [16], to remove the cut sites and amplify only the PfPK7 partial gene. The primers were designed as follows: primer 1:

7



ATGAAGGATATTTTATCTAATTATTCAAAC

and

Page 8 of 41

primer

2:

ACCCAAACTCCATATATCCACCTTTGC. The resulting PCR product would be 702bp in size. To verify that the pfpk7- cell line had lost the wild type gene, we used both PCR (Figure S1A) and Southern blot analysis (Figures S1B and S1C). Either 50ng or 25ng of genomic DNA was used for the detection of a partial PfPK7 product (702bp) similar to the genotype characterization carried out in the creation of the pfpk7- cell line [16]. Determination of Changes in the Intraerythrocytic Cell Cycle in pfpk7- Cells P. falciparum 3D7 wild type and pfpk7- cultures were tightly synchronized using MACS column followed 8h later by sorbitol treatment. Cultures were plated into a 96well plate (Santacruz Biotechnology) at the early ring stage. Every 8h samples were collected and evaluated by Giemsa staining or fixed with 0.04% glutaraldehyde in PBS for flow cytometry analysis. Fixed samples were permeabilized with 0.25% Triton X-100, RNase treated (50 µg/ml), and stained with 10.25µM YOYO-I (Invitrogen) [21]. Flow cytometry data acquisition was done in CytoFLEX flow cytometer (Beckman Coulter) at an excitation wavelength of 488nM and an optical filter 530/30. The data was analyzed using the Cytexpert software. Phosphopeptide Enrichment and Identification For phoshopeptide identification, duplicate samples were harvested for each time point of each parasite line. After cell lysis and protein extraction, samples containing 1mg of protein per stage for the wild type 3D7 P. falciparum and pfpk7- samples underwent reduction, alkylation, and Trypsin digestion prior to labeling with TMT isobaric labeling reagents [12, 22]. All time points for the wild type 3D7 parasites and

8


Page 9 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


pfpk7- parasites were combined after labeling. This ensured that all samples were processed simultaneously, using the same criteria, and normalized to one another during the processing step. The resulting peptide mixtures were then fractionated via strong cation exchange chromatography (SCX) to produce 20 fractions which were subjected to immobilized metal affinity chromatography (IMAC) to specifically isolate phosphorylated peptides [16]. An LTQ-Velos-Orbitrap mass spectrometer was used to analyze phosphopeptides via LC-MS/MS as described previously [17]. Peptides were identified by associating individual MS/MS spectra with their closest matching peptide sequences using SEQUEST [20]. All MS-MS data were searched against a composite database that combined Plasmodium sequences from NCBI [12] with human protein sequences from the International Protein Index [23] and common contaminants (e.g. Trypsin). The peptides were filtered using linear discriminant analysis to remove questionable identifications based on a target-decoy strategy [24, 25]. After peptides were assembled into proteins, the resulting dataset was filtered to a final protein-level false discovery rate of 1%. Phosphorylation sites were scored to assess confidence of localization using AScore [22, 26]. Finally, the peptides and proteins were filtered to account for protein redundancy according to the principles of parsimony. To quantify individual phosphorylation sites, TMT reporter ion intensities were extracted from MS/MS spectra and normalized assuming equal protein loading in each channel. Each site was quantified by gathering together all matching peptides, filtering out peptides that failed to meet our quantification standards (isolation specificity > 0.8; summed signal-to-noise > 100), and normalizing samples assuming equal total phosphoprotein abundance. Although all four intraerythrocytic stages of pfpk7- parasites

9



were subjected to MS/MS analysis, we used only schizont and segmenter stages used for quantitative comparisons as the parasite maturation from early ring to schizont stages in the absence of PfPK7 was not affected and there were no significant phenotypic differences between the wild type 3D7 and pfpk7-. Accordingly, only schizont and segementer stages were analyzed for the 3D7 control parasites. However, the phosphoproteomic data of the ring and trophozoite pfpk7- parasites is included in Supplemental Data 1. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner [27] repository with the dataset identifier PXD009465. Identification of PfPK7 Substrate Phosphorylation Motifs To identify primary sequence motifs directly or indirectly associated with PfPK7 activity, phosphorylation sites whose abundance decreased in the absence of PfPK7 were extracted. Sites were separated according to the residue phosphorylated (Ser, Thr, or Tyr) and enriched motifs were identified using the algorithm Motif-X [28] to compare down-regulated sites with all Ser, Thr, and Tyr residues in the Plasmodium proteome. Motifs were required to occur at least 10 times among down-regulated sites and the minimum significance was set to 1e-5. While no significant motifs were observed for Thr and Tyr sites due to their infrequent detection, three motifs were detected for Ser phosphorylation sites. Assignment as a Potential Substrate and Generation of Expression Constructs When analyzing the wild type 3D7 and pfpk7- phosphoproteomic data sets, we compared phosphorylation levels by calculating two ratios among the two cell lines and

10


Page 10 of 41

Page 11 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


developmental stages (pfpk7- schizont: 3D7 schizont and pfpk7- segmenter: 3D7 segmenter). Phosphorylation events exhibiting greater than 1.5-fold differences in abundance between the two cell lines were considered enriched in that particular cell line, while phosphorylation events showing less than 1.5-fold changes for both comparisons were considered phosphorylated equally in both cell lines. In order to investigate if any of the phosphoproteins are in fact substrates of PfPK7, we generated His-tagged constructs of the potential substrates with the largest decrease in phosphorylation in the pfpk7- cell line for both the schizont and segmenter stages and three potential substrates containing the identified RxxS* (S* denotes phosphorylated residue) motif that were under 670 aa in size. The following proteins were cloned into the pET30 EK/LIC vector following the manufacturer’s instructions (EMD Millipore): PFB0100c, PF10_0257, PF14_0068, PF10_0068, PFD0960c, PFI1555w, PF13_0102, PFB0490c, and PF14_0190. Bacterial Expression and Purification of the Recombinant Proteins The potential PfPK7 substrates were optimally expressed in E.coli BL21CodonPlus (RIPL) cells (Stratagene) and purified from the soluble fraction by affinity chromatography using HisLink resin and following the manufacturer’s instructions (Promega). The plasmid encoding GST-PfPK7 was kindly provided by C. Doerig (Monash University, Clayton Australia). The expression and purification of GST-PfPK7 was performed following published procedures [29]. In vitro Kinase Assays

11



Page 12 of 41

Kinase reactions to measure PfPK7 auto-phosphorylation and activity toward the potential substrates were performed by using 1µg of recombinant PfPK7 and 5µg of recombinant substrate in a total volume of 30µl as described previously [30, 31]. A standard kinase buffer containing 20mM Tris/HCl (pH 7.5), 20mM MgCl2, 2mM MnCl2, 10µM ATP, and 5µCi [γ-32P]ATP was used. Kinase reactions were incubated for 30 mins at 30°C and stopped by the addition of 5X gel loading buffer. The entire kinase reaction was loaded on a 12% SDS/polyacrylamide gel. The gels were then stained with Coomassie blue stain, destained using a 30% methanol and 10% glacial acetic acid solution, dried, and exposed for autoradiography. Signal intensity values were obtained and normalized by using the kinase buffer control as the 0% value and PfPK7 autophosphorylation as the 100% value. The ability of PfPK7 to phosphorylate potential substrates was determined by the normalized percent signal intensity compared to the 100% value of PfPK7 auto-phosphorylation.

RESULTS AND DISCUSSION Impact of the Absence of PfPK7 on the Intraerythrocytic Cell Cycle Previous studies [16] demonstrated that the intraerythrocytic proliferation rate was decreased in the pfpk7- line. To further analyze the mechanism behind its slower growth rate, tightly synchronized cultures of both 3D7 wild type and pfpk7-

were

subjected to both microscopic and flow cytometric analysis at 12h intervals beginning at the early ring stage (6h post invasion). Giemsa-stained thin smears from pfpk7- and 3D7 wild type parasites (Figure 1A) show that progression from early ring to schizont stages in the absence of PfPK7 was not affected as there are no significant phenotypic 12


Page 13 of 41

differences between the two lines. However, as the parasites continue to develop and form merozoites in the segmenter stage it is apparent that pfpk7- produces significantly fewer merozoites than 3D7 wildtype parasites. Flow cytometry analysis demonstrates reduced ring populations in the subsequent pfpk7- life cycle compared to 3D7 wild type (Figure 1B), corroborating our microscopy results and confirming the results of the initial phenotypic study [16], which was conducted without the benefits of a flow cytometry approach. A

Early Ring

Late Ring

Trophozoite

Late Trophozoite

Schizont

Segmenter

Schizont

Segmenter

3D7

PfPK7-

Early Ring

B

Late Ring

Ring

Late Ring

Trophozoite

Schizont

Trophozoite

Schizont

Reinvasion Ring

3D7

Merozoite

YoYo-I

YoYo-I

Ring

Late Ring

YoYo-I

YoYo-I

Trophozoite

Schizont

PK7-

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Merozoite

YoYo-I

YoYo-I

YoYo-I

YoYo-I

YoYo-I

Ring

Merozoite

YoYo-I

Schizont

Late Ring

YoYo-I

YoYo-I

Ring

Ring

Merozoite

YoYo-I

YoYo-I

-

Figure 1. pfpk7 cell line produces less merozoites and results in decreased ring populations in subsequent life cycles Characterization of the Phosphoproteome from the Schizont and Segmenter Intraerythrocytic Stages of P. falciparum 3D7 and pfpk7-

13



To gain insight into how the absence of PfPK7 contributes to a reduction in the number of merozoites, we compared the phosphoproteome landscapes of 3D7 and pfpk7- parasite lines in the schizont and segmenter stages. We focused on quantitative comparison of these two stages between the two lines because there were no phenotypic differences between them prior to the schizont stage. To this end, we used isobaric labeling for quantitative analysis of Trypsin-digested parasite extracts prepared from tightly synchronized rings (approximately 16h ± 4h post-invasion), trophozoites (26h ± 4h post-invasion), schizonts (approximately 36h ± 4h post-invasion), and segmenters (approximately 46h ± 4h post-invasion) for pfpk7- parasites and tightly synchronized schizonts (approximately 36h ± 4h post-invasion), and segmenters (approximately 46h ± 4h post-invasion) for 3D7 parasites. A workflow depicting the phosphoproteomic analysis on the schizont and segmenter stages of both pfpk7- and 3D7 parasites is outlined in Figure 2A. The quantitative phosphoproteomic analysis on these two parasite stages identified a total of 1,047 proteins and 6,795 phosphorylation sites across both cell lines and both intraerythrocytic cell cycle stages. Of these phosphorylation events, only 3,875 met our strict quantification standards at a proteinlevel FDR of 1.5-fold increase or decrease between the cell lines. Phosphorylation events exhibiting greater than a 1.5-fold

14


Page 14 of 41

Page 15 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


difference in abundance between the two were considered to be enriched in that particular cell line. Figure 2B demonstrates the distribution of phosphorylation events for each of the cell lines. At the schizont stage, a total of 1,490 phosphorylation events were classified as enriched in the 3D7 wild type cell line, as per the criterion outlined above. Furthermore, 609 phosphorylation events were enriched in 3D7 cells at the segmenter stage. Interestingly, 794 phosphorylation events at the schizont stage and 1,027

phosphorylation

15



Figure 2. Identification of the phosphoproteome from schizonts and segmenters in the presence or absence of PfPK7

(Figure 2A) events at the segmenter stage were upregulated in the absence of PfPK7

16


Page 16 of 41

Page 17 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Figure 2B). The increase in phosphorylation seen on some proteins that occurs in the absence of PfPK7 could possibly be a compensatory mechanism (e.g. overexpression/mobilization of one or more other kinase[s]) that the parasite uses to ensure survival in the absence of PfPK7; such a compensatory mechanism has been observed in other instances, e.g. the overexpression of Pfmap-2 in pfmap-1- parasites [32]. Approximately 41% of the schizont stage phosphorylation events and 58% of the segmenter phosphorylation events were detected at similar levels in both cell lines, while 20.5% of phosphorylation events at the schizont stage and 26.5% of phosphorylation events at the segmenter stage display decreased phosphorylation in the absence of PfPK7 (Figure 2C).

Analysis of Decreased Phosphorylation Events and the Identification of Unique Phosphorylation Motifs To analyze phosphorylation events that are dependent on PfPK7 activity, we examined the phosphoproteomic data for proteins with > 1.5-fold decrease in phosphorylation in schizonts and segmenters in the absence of PfPK7 (Supplemental Data 3). A total of 239 phosphorylation events on 146 phosphoproteins exhibited decreased phosphorylation at both stages (Figure 3A). The five phosphoproteins with the largest decrease in phosphorylation at the schizont and segmenter stages are shown in Table 1A and Table 1B, respectively. We sorted proteins into functional classes using the Munich Information Centre for Protein Sequences (MIPS) catalog with some adaptations for Plasmodium-specific

17



Page 18 of 41

classes, such as proteins pertaining to malaria pathogenesis [33]. Functional

Table 1A: Quantification of the Top Five Decreased Phosphorylation Events in the pfpk7- Cell Line at the Schizont Stage

PfPK7-

3D7 Wild Type Accession Number

C6KT20 Q8IC01 Q9TY99 Q8I5E2 Q8IDF2

Annotation

Site

Motif Peptide

Schizont Score

Segmenter Score

Schizont Score

Segmenter Score

Schizont Comparison

Segmenter Comparison

Conserved Plasmodium Membrane Protein

S489

YLKDKKSLILEKK

244.08

1300.64

5.80

784.94

0.02377

0.60349

T863

EEKENSTKNENSA

91.53

394.09

2.37

90.28

0.02593

0.22909

EATKEASTSKEAT

6.95

1278.25

0.195

398.84

0.02799

0.31202

S688

VKNDLESEKGRGR

114.56

580.33

4.39

126.73

0.03838

0.21837

S193

PKNLQHSDNEKNQ

199.88

618.91

7.72

129.03

0.03860

0.20847

Cg4 Protein Knob-associated Histidine-Rich Protein Cyclin Related Protein Conserved Plasmodium Protein

S558

!

Table 1B: Quantification of the Top Five Decreased Phosphorylation Events in the pfpk7- Cell Line at the Segmenter Stage 3D7 Wild Type Accession Number

PfPK7

-

Annotation

Site

Motif Peptide

Schizont Score

Segmenter Score

Schizont Score

Segmenter Score

Schizont Comparison


C6KT82

Smarca-Related Protein

S1327

DDDDDNSVDAKYN

127.64

11.46

15.87

0

0.12431

0

Q8IBZ5

Cg7 Protein

S171

KNKNLSSYEEKKL

418.79

183.79

218.22

13.30

0.52108

0.07236

ELFDGKSEEWEEK

872.13

73.64

236.55

10.13

0.27123

0.13761

S2073

ISNNNKSISSNNK

482.59

1251.63

41.47

202.91

0.08592

0.16212

S1049

NDGDNKSQEDDDG

67.78

297.39

11.13

49.79

0.16414

0.16742

Q8IFM2

Q8IID3 O77384

SurfaceAssociated Interspersed Gene 4.2 Myb-like DNAbinding Domain Conserved Plasmodium Protein

S1395

!

18


Page 19 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Number of Phosphorylation Sites Decreased upon PfPK7 Knock-out

classification was carried out on the entire phosphoproteomic dataset, which was then compared to the functional classification of the 146 phosphoproteins with decreased phosphorylation in the absence of PfPK7 in both schizonts and segmenters (Figure 3B).

19



The comparison of functional profiles did not result in any marked differences. For example, 3% of the phosphoproteins from the overall data set and 3% of the phosphoproteins with decreased phosphorylation at both intraerythrocytic stages in the absence of PfPK7 are involved in the cell cycle and DNA processing category. This suggests that proteins whose phosphorylation is PfPK7-dependent are not enriched in any given functional category. The presence of the Kelch 13 protein in the list of potential targets of PfPK7 is intriguing. A number of mutations in K13 are strongly associated with decreased susceptibility to artemisinin-based antimalarials. It would be of great interest to determine whether the pfpk7- parasites differ from the wild-type parental line with respect to artemisinin susceptibility. The MotifX analysis was performed to identify primary sequence motifs directly or indirectly associated with PfPK7 activity. Three motifs were identified that are enriched among pS sites in P. falciparum that were decreased in pfpk7- parasites (Figure 3C). When compared to the Plasmodium proteome, the RxxS* (* denotes phosphorylated residue) motif had the greatest fold increase in representation (4.12-fold) among the decreased phosphorylation sites in pfpk7- parasites. The RxxS* motif is a well-known phosphorylation target for the AGC- kinases, which includes cAMP-dependent protein kinase (PKA), cGMP-dependent protein kinase (PKG), protein kinase C, AKT, and RSK [12, 33]. AKT has been shown to play a central role in the mediation of cellular processes such as cell growth and survival and transcriptional regulation [34]. The fact that PfPK7 also recognizes the RxxS* motif is consistent with a role in the regulation of cell growth and proliferation of Plasmodium that is suggested by the observed phenotype of null mutant parasites (see above).

20


Page 20 of 41

Page 21 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The MotifX analysis also identified > 3-fold enrichment of the S*xD and RxxxxxS* motifs among the proteins with decreased phosphorylation in schizonts and segmenters in the absence of PfPK7 (Figure 3C). The S*xD motif is traditionally utilized by casein kinase 1 (CK1) and casein kinase 2 (CK2), while the RxxxxxS* motif is commonly recognized by protein kinase C (PKC) or CDC2-like kinases (CLK). The CK1 and CK2 protein kinases are evolutionarily conserved serine/threonine protein kinases [35], which phosphorylate key regulatory proteins in the control of cell differentiation, proliferation, DNA repair, and chromosome segregation [36]. The CLKs are an evolutionarily conserved group of dual specificity kinases belonging to the CMGC group of kinases that interact with and/or phosphorylate serine/arginine-rich (SR) proteins of the spliceosomal complex. CLK2 is involved in the regulation of several cellular processes including cell cycle progression [37, 38]. Identification and Characterization of Putative PfPK7 Substrates In our effort to identify putative substrates of PfPK7, we examined all of the phosphorylation sites displaying decreased phosphorylation at both the schizont and segmenter stages in the absence of PfPK7. A total of 146 phosphoproteins fit this criterion and represent potential substrates for PfPK7. The phosphoproteins with the largest decrease in phosphorylation at both intraerythrocytic stages are more likely to be direct substrates of PfPK7 than those with only small decreases in phosphorylation. We generated His-tagged recombinant forms of the six proteins with the largest decrease in phosphorylation in schizonts and segmenters. Table 2A lists the cloned proteins as well as the phosphorylated peptides that exhibited a significant decrease in phosphorylation, the biological process the proteins are involved in, and their molecular function. Next,

21



we identified the top three RxxS* phosphorylation events with the largest decrease in phosphorylation, and recombinant His-tagged forms of these proteins were generated.

Table 2B shows the recombinant proteins and their phosphorylated peptide, the

22


Page 22 of 41

Page 23 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


biological process the protein is involved in, and the protein’s molecular function. The phosphorylated peptides were then subjected to motif analysis in order to predict the protein kinase that may be responsible for the phosphorylation events. Significantly, the majority of phosphorylated peptides with large decreases in phosphorylation in the absence of PfPK7 are predicted to be recognized by CK1, CK2, and AKT (Table 2A and 2B). This prediction and the fact that motifs recognized by CK1, CK2, and AKT kinases are enriched among phosphopeptides with decreased phosphorylation when PfPK7 is absent, suggests the functional similarities of PfPK7 to CK1, CK2 and AKT protein kinases. Alternatively, PfPK7 may act upstream of PfCK1, PfCK2, and PfPKB (Plasmodium homologue of AKT), thus regulating their downstream activities. In order to better define the role of PfPK7 in P. falciparum we performed in vitro kinase assays to test if the identified substrates are utilized by the kinase. Figure 4A and 4C show the coomassie blue-stained gel of the kinase assay reactions in which 1µg of recombinant PfPK7 and 5µg of recombinant substrates were used. After five independent kinase assays, it was apparent that PfPK7 was able to directly phosphorylate a conserved Plasmodium protein (PF10_0257) to a greater extent than the control substrate MBP (Figure 4B). PfPK7 was also able to directly phosphorylate 60s ribosomal protein L7Ae/L30e, putative (PFD0960c) and a conserved Plasmodium protein (PFB0490c) to a lesser extent (Figure 4D). The ability of PfPK7 to phosphorylate these substrates was determined by normalizing signal intensity values to the master mix alone (0% value) and PfPK7 auto-phosphorylation (100% value). PfPK7 phosphorylation of PF10_0257 was 59%, which is greater than PfPK7-dependent

23



phosphorylation of the control substrate MBP (38%) (Figure 4E). The phosphorylation of PFD0960c and PFB0490c by PfPK7 was inefficient (7%) (Figure 4E).

24


Page 24 of 41

Page 25 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Validation of putative PfPK7 Substrates

25



Understanding the composition of P. falciparum Signaling Pathways in which PfPK7 operates The function of the protein PF10_0257, which is strongly phosphorylated by PfPK7 in vitro, is unknown. However, PF10_0257 has some similarity to Myb-like protein X, GATA zinc finger domain containing protein, and DNA ligase 1. Myb-like transcription factors are common in plants and contribute to a variety of cellular responses, including differentiation [39]. Transcription factors of the GATA family contain zinc finger motifs and are involved in development and differentiation in fungi, vertebrates, and plants [40]. Reversible phosphorylation regulates the activity of these transcription factors. For example, the DNA binding activity of Myb in hematopoietic cells is modulated by amino-terminal phosphorylation by CK2 [41]. PKA-mediated phosphorylation of GATA-4 leads to an increase in the activity of the steroidogenic acute regulatory protein promoter [42]. It is possible that the lack of Ser6 phosphorylation in PF10_0257, as observed in our study, affects development/ontogeny of merozoites, thereby mediating the observed phenotype of pfpk7- parasites in proliferation rate. Microarray data in PlasmoDB shows that the protein is abundant in all asexual stages, and is expressed in sexual stages as well. Although this phosphorylation event has not been detected in our study, PF10_0257 is also phosphorylated at the COOH-terminus [43]. It is intriguing that PfPK7 was able to directly phosphorylate only three out of seven of the tested potential substrates. Of the three phosphorylated proteins, two contained the S*xD motif and one contained the RxxS* motif. The ability of PfPK7 to utilize the RxxS* motif was tested on three different proteins containing this motif, and

26


Page 26 of 41

Page 27 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


only one was phosphorylated, suggesting that PfPK7 does not have strong preference for the RxxS* over the S*xD motif. Further support for PfPK7’s preference for the S*xD is the fact that the substrate with the most robust phosphorylation (PF10_0257) contained this phosphorylation motif. We cannot exclude that the recombinant potential substrate proteins are not in their native conformation, which may result in their lack of utilization

as

Figure 5. PfPK7's potential regulatory role in Plasmodium signaling networks

a

substrate by PfPK7. The inability of PfPK7 to directly phosphorylate all the proteins with decreased phosphorylation in pfpk7- parasites, suggests that PfPK7 acts as an upstream activator of other kinases, as depicted in Figure 5. PfCK1, PfCK2, PfPKB (P. falciparum homologue of AKT), or PfPK2 (Plasmodium falciparum homologue of CLK2) 27



Page 28 of 41

may thus represent the intermediary kinases, whose lack of activation by PfPK7 in pfpk7- cells

resulted

in

decreased

phosphorylation

of

candidate

substrates.

Furthermore, PfCK1, PfCK2, and PfPKB are expected to have a role in the PfPK7 signaling pathway because the phosphorylated peptides with the largest decreases in phosphorylation in the absence of PfPK7 are predicted to be phosphorylated by PfCK1, PfCK2, and PfPKB.

Conclusions A major challenge in understanding the noncanonical nature of the P. falciparum cell cycle is the fact that very little is currently known about malaria signaling cascades. A significant obstacle in defining cellular signaling networks is to establish physiological kinase-substrate

relationships.

We

employed

a

comparative

quantitative

phosphoproteomic study to identify the phosphoproteome that is controlled directly or indirectly by PfPK7. In this study, 146 proteins with decreased phosphorylation at the schizont and segmenter stages were identified in the absence of PfPK7, suggesting the role of PfPK7 in their phosphorylation. Although phosphoproteome profiling may provide clues to substrate identification, establishing direct kinase substrate relationships require activity-based assays. Our analysis demonstrates that of the identified potential substrates, PfPK7 was only able to directly phosphorylate three of the seven tested proteins. Furthermore, of the three phosphorylation motifs that are enriched among phosphorylated sites in Plasmodium proteins that were down regulated following deletion of the pfpk7 gene, the S*xD motif is present in two of the substrates. The

28


Page 29 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


inability of PfPK7 to directly phosphorylate all of the phosphoproteins that displayed decreased phosphorylation in the absence of PfPK7, suggests a role of PfPK7 as an upstream regulatory kinase. Our phosphoproteomic analysis of the PfPK7 kinasedeficient cell line highlights the limitations of this approach because it is difficult to ascertain if a change in protein phosphorylation is a direct effect due to the loss of PfPK7 of the orchestration of events of a signaling cascade. Although it is beyond the scope of this work, a recently developed approach to experimentally determine kinasesubstrate pairs through the integration of data obtained from phosphorylation reactions on protein microarrays, bioinformatics, and phosphoproteomics [44] might be a powerful approach to generate a high resolution signaling network. Nevertheless, our data defines the proteomic landscape in Plasmodium whose phosphorylation is affected due to the loss of PfPK7 function and will likely be a valuable resource for future studies aimed at understanding the role of PfPK7 in cellular signaling in the parasite. Supporting Information The following supporting information is available free of charge on the ACS Publication website at ACS website http://pubs.acs.org: Supplemental Data 1. Phosphoproteomic data of the ring and trophozoite pfpk7parasites. Supplemental Data 2. Phosphorylation events from the schizont and segmenter stages for 3D7 wild type and pfpk7- parasites that met our strict quantification standards at a protein-level FDR 1.5-fold decrease in phosphorylation in schizonts and segmenters in the absence of PfPK7. Supplemental Figure S1: Verification of the Presence of PfPK7 in the Wild Type 3D7 and the Absence of PfPK7 in the pfpk7- Cell Lines Competing Interest The authors declare that they have no competing interests. Author’s Contributions Conceived and designed the experiments: BNP, ELH, CD, RC, SPG, DC. Performed the experiments: BNP, ELH, MPJ, BFR. Analyzed the data: BNP, ELH, MPJ, BFR, CD, RC, DC. Contributed reagents/materials/analysis tools: BNP, ELH, MPJ, CD, SPG, DC. Wrote the paper: BNP, ELH, CD, DC. Generation of knock-out cell line: DDS, CD. Production of P. falciparum parasites: BNP. Functional analysis studies: BNP. Phosphoproteome analyses: BNP, ELH. Generation of potential substrates: BNP, DMS, DTS. Verification of potential substrates: BNP, DTS. Acknowledgments This work was supported in part by an NIH/NIAID grant AI73795 (to DC). References 1. 2. 3.

Cohen, P. and D.R. Alessi, Kinase drug discovery--what's next in the field? ACS Chem Biol, 2013. 8(1): p. 96-104. Ventura, J.J. and A.R. Nebreda, Protein kinases and phosphatases as therapeutic targets in cancer. Clin Transl Oncol, 2006. 8(3): p. 153-60. Marmiroli, S., et al., Phosphorylation, Signaling, and Cancer: Targets and Targeting. Biomed Res Int, 2015. 2015: p. 601543.

30


Page 30 of 41

Page 31 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4.

5.

6. 7. 8.

9. 10. 11. 12.

13. 14.

15.

16.

17.

18.

19.

20.

Doerig, C., et al., Protein kinases as targets for antimalarial intervention: Kinomics, structure-based design, transmission-blockade, and targeting host cell enzymes. Biochim Biophys Acta, 2005. 1754(1-2): p. 132-50. Doerig, C. and C.G. Grevelding, Targeting kinases in Plasmodium and Schistosoma: Same goals, different challenges. Biochim Biophys Acta, 2015. 1854(10 Pt B): p. 1637-43. Derbyshire, E.R., et al., Chemical interrogation of the malaria kinome. Chembiochem, 2014. 15(13): p. 1920-30. Gardner, M.J., et al., Genome sequence of the human malaria parasite Plasmodium falciparum. Nature, 2002. 419(6906): p. 498-511. Ward, P., et al., Protein kinases of the human malaria parasite Plasmodium falciparum: the kinome of a divergent eukaryote. BMC Genomics, 2004. 5(1): p. 79. Anamika, N. Srinivasan, and A. Krupa, A genomic perspective of protein kinases in Plasmodium falciparum. Proteins, 2005. 58(1): p. 180-9. Talevich, E., et al., An evolutionary perspective on the kinome of malaria parasites. Philos Trans R Soc Lond B Biol Sci, 2012. 367(1602): p. 2607-18. Merckx, A., et al., Structures of P. falciparum protein kinase 7 identify an activation motif and leads for inhibitor design. Structure, 2008. 16(2): p. 228-38. Pease, B.N., et al., Global analysis of protein expression and phosphorylation of three stages of Plasmodium falciparum intraerythrocytic development. J Proteome Res, 2013. 12(9): p. 4028-45. Pattanaik, P., J. Raman, and H. Balaram, Perspectives in drug design against malaria. Curr Top Med Chem, 2002. 2(5): p. 483-505. Dorin, D., et al., PfPK7, an atypical MEK-related protein kinase, reflects the absence of classical three-component MAPK pathways in the human malaria parasite Plasmodium falciparum. Mol Microbiol, 2005. 55(1): p. 184-96. Dorin-Semblat, D., Carvalho, T., Nivex, M., et al, An atypical cyclin-dependent kinase controls Plasmodium falciparum proliferation rate. Kinome, 2013. 1: p. 416. Dorin-Semblat, D., et al., Disruption of the PfPK7 gene impairs schizogony and sporogony in the human malaria parasite Plasmodium falciparum. Eukaryot Cell, 2008. 7(2): p. 279-85. Thompson, A., et al., Tandem mass tags: a novel quantification strategy for comparative analysis of complex protein mixtures by MS/MS. Anal Chem, 2003. 75(8): p. 1895-904. Nirmalan, N., P.F. Sims, and J.E. Hyde, Quantitative proteomics of the human malaria parasite Plasmodium falciparum and its application to studies of development and inhibition. Mol Microbiol, 2004. 52(4): p. 1187-99. Chakrabarti, D., S.M. Schuster, and R. Chakrabarti, Cloning and characterization of subunit genes of ribonucleotide reductase, a cell-cycle-regulated enzyme, from Plasmodium falciparum. Proc Natl Acad Sci U S A, 1993. 90(24): p. 12020-4. Villen, J. and S.P. Gygi, The SCX/IMAC enrichment approach for global phosphorylation analysis by mass spectrometry. Nat Protoc, 2008. 3(10): p. 1630-8.

31



21.

22. 23.

24. 25. 26.

27. 28.

29.

30.

31.

32.

33. 34. 35.

36. 37.

Bouillon, A., et al., Screening and evaluation of inhibitors of Plasmodium falciparum merozoite egress and invasion using cytometry. Methods Mol Biol, 2013. 923: p. 523-34. Huttlin, E.L., et al., A tissue-specific atlas of mouse protein phosphorylation and expression. Cell, 2010. 143(7): p. 1174-89. Eng, J.K., McCormack, A.L., and Yates, J.R., 3rd., An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. Journal of the American Society for Mass Spectrometry, 1994. 5(11): p. 976-989. Geer, L.Y., et al., The NCBI BioSystems database. Nucleic Acids Res, 2010. 38(Database issue): p. D492-6. Kersey, P.J., et al., The International Protein Index: an integrated database for proteomics experiments. Proteomics, 2004. 4(7): p. 1985-8. Beausoleil, S.A., et al., A probability-based approach for high-throughput protein phosphorylation analysis and site localization. Nat Biotechnol, 2006. 24(10): p. 1285-92. Vizcaino, J.A., et al., 2016 update of the PRIDE database and its related tools. Nucleic Acids Res, 2016. 44(22): p. 11033. Elias, J.E. and S.P. Gygi, Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry. Nat Methods, 2007. 4(3): p. 207-14. Beausoleil, A., P. Desjardins, and A. Rochefort, Effects of long jumps, reversible aggregation, and Meyer-Neldel rule on submonolayer epitaxial growth. Phys Rev E Stat Nonlin Soft Matter Phys, 2008. 78(2 Pt 1): p. 021604. Schwartz, D. and S.P. Gygi, An iterative statistical approach to the identification of protein phosphorylation motifs from large-scale data sets. Nat Biotechnol, 2005. 23(11): p. 1391-8. Dorin, D., et al., An atypical mitogen-activated protein kinase (MAPK) homologue expressed in gametocytes of the human malaria parasite Plasmodium falciparum. Identification of a MAPK signature. J Biol Chem, 1999. 274(42): p. 29912-20. Dorin-Semblat, D., et al., Functional characterization of both MAP kinases of the human malaria parasite Plasmodium falciparum by reverse genetics. Mol Microbiol, 2007. 65(5): p. 1170-80. Mewes, H.W., et al., MIPS: a database for genomes and protein sequences. Nucleic Acids Res, 2000. 28(1): p. 37-40. Montminy, M., Transcriptional regulation by cyclic AMP. Annu Rev Biochem, 1997. 66: p. 807-22. Pearson, R.B. and B.E. Kemp, Protein kinase phosphorylation site sequences and consensus specificity motifs: tabulations. Methods Enzymol, 1991. 200: p. 62-81. Marte, B.M. and J. Downward, PKB/Akt: connecting phosphoinositide 3-kinase to cell survival and beyond. Trends Biochem Sci, 1997. 22(9): p. 355-8. Knippschild, U., et al., The casein kinase 1 family: participation in multiple cellular processes in eukaryotes. Cell Signal, 2005. 17(6): p. 675-89.

32


Page 32 of 41

Page 33 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


38. 39. 40.

41.

42.

43.

44. 45.

Gao, Y. and H.Y. Wang, Casein kinase 2 Is activated and essential for Wnt/betacatenin signaling. J Biol Chem, 2006. 281(27): p. 18394-400. Ambawat, S., et al., MYB transcription factor genes as regulators for plant responses: an overview. Physiol Mol Biol Plants, 2013. 19(3): p. 307-21. Reyes, J.C., M.I. Muro-Pastor, and F.J. Florencio, The GATA family of transcription factors in Arabidopsis and rice. Plant Physiol, 2004. 134(4): p. 171832. Cures, A., et al., Constitutive c-Myb amino-terminal phosphorylation and DNA binding activity uncoupled during entry and passage through the cell cycle. Oncogene, 2001. 20(14): p. 1784-92. Tremblay, J.J., F. Hamel, and R.S. Viger, Protein kinase A-dependent cooperation between GATA and CCAAT/enhancer-binding protein transcription factors regulates steroidogenic acute regulatory protein promoter activity. Endocrinology, 2002. 143(10): p. 3935-45. Lasonder, E., et al., Extensive differential protein phosphorylation as intraerythrocytic Plasmodium falciparum schizonts develop into extracellular invasive merozoites. Proteomics, 2015. 15(15): p. 2716-29. Jain, P., et al., Human CDC2-like kinase 1 (CLK1): a novel target for Alzheimer's disease. Curr Drug Targets, 2014. 15(5): p. 539-50. Xue, Y., et al., GPS: a comprehensive www server for phosphorylation sites prediction. Nucleic Acids Res, 2005. 33(Web Server issue): p. W184-7.

FOR TOC ONLY

33



Figure Legends Figure 1. pfpk7- Cell Line Produces Fewer Merozoites and Results in Decreased Ring Populations in Subsequent Life Cycles (A) Microscopic assessment of Giemsa-stained thin smears from tightly synchronized cultures from wild-type 3D7 and pfpk7- lines harvested at 12h intervals. Representative images from >80% of the parasitized erythrocytes are shown. (B) Flow cytometry analysis of the YOYO-1 labeled samples. Tightly synchronized 3D7 and pfpk7- cultures were analyzed in CytoFLEX flow cytometer (Beckman Coulter) at an excitation wavelength of 488nM and an optical filter 530/30. For data analysis 100,000 events within the RBC gated population (P2) were recorded for each sample and are shown via histogram plots. Each peak segment is labeled with the corresponding parasite stage.

Figure 2. Identification of the Phosphoproteome from Schizonts and Segmenters in the Presence and Absence of PfPK7

(A) Overview of the phosphopeptide preparation and enrichment from 3D7 wild type and pfpk7- schizont and segmenter stage lysates. Duplicate samples from each time point for each cell line were pooled and processed to generate the list of phosphorylation sites in Supplemenal data 2. Protein samples were digested with trypsin, labeled with TMT, fractionated on a SCX column, and enriched for phosphopeptides using IMAC. The phosphopeptide samples were analyzed on an LTQVelos Obitrap mass spectrometer. SEQUEST was used to identify spectra and the data

34


Page 34 of 41

Page 35 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were filtered to a protein-level false discovery rate of 1%. Phosphorylation site localization was analyzed through AScore and phosphorylation sites with AScores above 13 were considered to be localized. Phosphorylation sites with a 1.5-fold decrease at both stages were classified as potential PfPK7 substrates and MotifX analysis was performed. (B) The table depicts the number of phosphorylation events that were classified as belonging to each cell line. The phosphorylation events that did not display >1.5-fold change between cell lines were classified as similar in both lines. Three phosphorylation events that were detected in the schizont stage were not detected at the segmenter stage; therefore, there were only 3,872 phosphorylation events detected at this stage. (C) Number of phosphorylation sites classified at the schizont and segmenter stages for the wild type 3D7 cell line, pfpk7- cell line, and both cell lines.

Figure 3. Number of Phosphorylation Sites Decreased upon PfPK7 Knock-out (A) A total of 1,490 phosphorylation events were decreased at the schizont stage, 609 were decreased at the segmenter stage, and 239 were decreased in the pfpk7- cell line at both stages when compared to the wild type. (B) Functional profiles of identified proteins using GO annotations downloaded from PlasmoDB (www.plasmodb.org) or UniProt (www.uniprot.org) as defined by the MIPS catalogue. To avoid redundancy, we assigned only one class per protein. The complete protein list is included in Supplemental data 2. A comparison of the percentage of proteins in each functional group in the overall phosphoproteomic data set compared to the proteins identified with

35



Page 36 of 41

decreased phosphorylation in the absence of PfPK7. The comparison shows that both data sets had the same relative distribution of proteins in each of the functional categories. (C) MotifX analysis was performed to identify primary sequence motifs that were

enriched

relative

to

the

entire

Plasmodium

proteome

among

those

phosphorylation sites whose levels decreased in the absence of PfPK7. Three motifs were identified that are enriched among pS sites in Plasmodium falciparum that were down-regulated. When compared to the entire Plasmodium proteome, the RxxS* motif had the best fold increase (4.12-fold) in the proteins with decreased phosphorylation when PfPK7 was knocked out.

Figure 4. Validation of Putative PfPK7 Substrates (A) Coomassie blue stained gel of the in vitro kinase assays. Lane 1: Master mix, Lane 2: MBP, Lane 3: PfPK7, Lane 4: PfPK7 + MBP, Lane 5: PF10_0257, Lane 6: PfPK7 + PF10_0257, Lane 7: PF14_0068, Lane 8: PfPK7 + PF14_0068, Lane 9: PF10_0068, Lane 10: PfPK7 + PF10_0068. (B) Phosphoimage of the in vitro kinase assay gel depicted in (A). (C) Coomassie blue stained gel of the in vitro kinase assays. Lane 1: PFD0960c, Lane 2: PfPK7 + PFD0960c, Lane 3: PFI1555w, Lane 4: PfPK7 + PFI1555w, Lane 5: PF13_0102, Lane 6: PfPK7 + PF13_0102, Lane 7: PFB0490c, Lane 8: PfPK7 + PFB0490c, Lane 9: PF14_0190, Lane 10: PfPK7 + PF14_0190. (D) Phosphoimage of the in vitro kinase assay gel depicted (C). (E) Normalized signal intensity values. Master mix alone was set as the 0% value and PfPK7 autophosphorylation was set as the 100% value.

36


Page 37 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. PfPK7’s Potential Regulatory Role in Plasmodium Signaling Networks Protein kinases are depicted in blue, proteins containing the S*xD motif are purple, proteins containing the RxxS* motif are green, and proteins containing the RxxxxxS* motif are orange. PfPK7 directly phosphorylates PF10_0257, PFD0960c, and PFB0490c. PfPK7 may act as an upstream regulatory kinase, phosphorylating PfCK1, PfCK2, PfPKB, PfPKC, and/or PfPK2 activating these kinases through phosphorylation (shown with dashed lines). The activated kinase/s may then phosphorylate the proteins identified with decreased phosphorylation in pfpk7- parasites.

37



Page 38 of 41

Table 1. Quantification of the Top Five Decreased Phosphorylation Events in the pfpk7- Cell Line A PfPK7-

3D7 Wild Type Accession Number

C6KT20 Q8IC01 Q9TY99 Q8I5E2 Q8IDF2

Annotation

Site

Motif Peptide

Schizont Score

Segmenter Score

Schizont Score

Segmenter Score

Schizont Comparison


Conserved Plasmodium Membrane Protein

S489

YLKDKKSLILEKK

244.08

1300.64

5.80

784.94

0.02377

0.60349

EEKENSTKNENSA

91.53

394.09

2.37

90.28

0.02593

0.22909

EATKEASTSKEAT

6.95

1278.25

0.195

398.84

0.02799

0.31202

Cg4 Protein

T863

Knob-associated Histidine-Rich Protein Cyclin Related Protein Conserved Plasmodium Protein

S558

S688

VKNDLESEKGRGR

114.56

580.33

4.39

126.73

0.03838

0.21837

S193

PKNLQHSDNEKNQ

199.88

618.91

7.72

129.03

0.03860

0.20847

B 3D7 Wild Type Accession Number

Annotation

Site

Motif Peptide

Schizont Score

C6KT82

Smarca-Related Protein

S1327

DDDDDNSVDAKYN

127.64

11.46

Q8IBZ5

Cg7 Protein

S171

KNKNLSSYEEKKL

418.79

183.79

ELFDGKSEEWEEK

872.13

73.64

S2073

ISNNNKSISSNNK

482.59

S1049

NDGDNKSQEDDDG

67.78

Q8IFM2

Q8IID3 O77384

SurfaceAssociated Interspersed Gene 4.2 Myb-like DNAbinding Domain Conserved Plasmodium Protein

S1395

Segmenter Score

PfPK7 Schizont Score

-

Segmenter Score

Schizont Comparison


15.87

0

0.12431

0

218.22

13.30

0.52108

0.07236

236.55

10.13

0.27123

0.13761

1251.63

41.47

202.91

0.08592

0.16212

297.39

11.13

49.79

0.16414

0.16742

(A) The top five phosporylation events exhibiting a greater than 1.5-fold difference between the wild type 3D7 cell line and the pfpk7- cell line at the schizont stage. The representative

phosphorylation

events

displayed

the

largest

decrease

in

phosphorylation in the absence of PfPK7 at the schizont stage. The columns corresponding to the schizont and segmenter scores for the 3D7 wild type and pfpk7cell lines are the normalized intensities associated with each particular stage. (B) The top five phosphorylation events exhibiting >1.5-fold difference between the wild type

38


Page 39 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3D7 cell line and the pfpk7- cell line at the segmenter stage. The representative phosphorylation events displayed the largest decrease in phosphorylation in the absence of PfPK7 at the segmenter stage. The columns corresponding to the schizont and segmenter scores for the 3D7 wild type and pfpk7- cell lines are the normalized intensities associated with each particular stage.

39



Table 2A: Identification of Putative PfPK7 Substrates

Table 2B: Identification of Putative PfPK7 Substrates with the RxxS* Motif

40


Page 40 of 41

Page 41 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(A) The top six proteins exhibiting the largest decrease in phosphorylation in the pfpk7cell line when compared to the wild type 3D7 cell line at the schizont and segmenter stages. The phosphorylated peptide was analyzed using GPS 3.0 (Group-based Prediction System) to predict the kinase/s that may be responsible for the phosphorylation event [45]. The columns also describe the biological process and molecular function of the phosphorylated protein as stated using GO term analysis. (B) The top three proteins exhibiting the largest decrease in phosphorylation at a peptide containing the RxxS* motif in the pfpk7- cell line when compared to the wild type 3D7 cell line at the schizont and segmenter stages. The phosphorylated peptide was analyzed using GPS 3.0 to predict the kinase/s that may be responsible for the phosphorylation event.

41


Characterization of Plasmodium falciparum Atypical Kinase PfPK7

Recommend Documents