Characterization of the Post-Assembly Line ... - ACS Publications

Articles pubs.acs.org/acschemicalbiology

Characterization of the Post-Assembly Line Tailoring Processes in Teicoplanin Biosynthesis Oleksandr Yushchuk,† Bohdan Ostash,† Thu H. Pham,‡ Andriy Luzhetskyy,§,∥ Victor Fedorenko,† Andrew W. Truman,*,‡ and Liliya Horbal*,†,§ †

Department of Genetics and Biotechnology, Ivan Franko National University of Lviv, Lviv, Ukraine Department of Molecular Microbiology, John Innes Centre, Colney Lane, Norwich, United Kingdom § Department of Pharmaceutical Biotechnology, Saarland University, Campus, Saarbrucken, Germany ∥ Helmholtz-Institute for Pharmaceutical Research Saarland (HIPS) Helmholtz Center for Infectious Research (HZI), Saarbrucken, Germany ‡

S Supporting Information *

ABSTRACT: Actinoplanes teichomyceticus produces teicoplanin (Tcp), a “last resort” lipoglycopeptide antibiotic used to treat severe multidrug resistant infections such as methicillin-resistant Staphylococcus aureus (MRSA). A number of studies have addressed various steps of Tcp biosynthesis using in vitro assays, although the exact sequence of Tcp peptide core tailoring reactions remained speculative. Here, we describe the generation and analysis of a set of A. teichomyceticus mutant strains that have been used to elucidate the sequence of reactions from the Tcp aglycone to mature Tcp. By combining these results with previously published data, we propose an updated order of post-assembly line tailoring processes in Tcp biosynthesis. We also demonstrate that the acyl-CoA-synthetase Tei13* and the type II thioesterase Tei30* are dispensable for Tcp production. Five Tcp derivatives featuring hitherto undescribed combinations of glycosylation and acylation patterns are described. The generation of strains that produce novel Tcp analogues now provides a platform for the production of additional Tcp-like molecules via combinatorial biosynthesis or chemical derivatization.

M

acyl chain attached to a glucosaminyl group (Figure 1a). The Tcp gene cluster was first described in 2004 independently by two research teams,24,25 and at least 49 genes were predicted to be involved in Tcp biosynthesis (Figure 2). However, progress in elucidating the Tcp biosynthetic pathway has been hindered by the refractory nature of NRRL-B16726 toward genetic manipulations. Consequently, experiments on the elucidation of Tcp biosynthesis have been mainly limited to in vitro assays.24,26−30 Recently, significant progress has been achieved in the development of a molecular toolkit for NRRL-B16726, which enables the deletion or overexpression of genes, and the analysis of promoter activity.31−34 The biosynthesis of Tcp can be divided into a three-stage process: (a) production of dedicated nonproteinogenic amino acid precursors;35,36 (b) peptide assembly, halogenation, and oxidative cross-linking of the heptapeptide scaffold;22,30,36−39 and (c) modification of the scaffold via glycosylation and acylation.24,26,40−43 These late-stage tailoring reactions are essential for the optimal biological activity of Tcp;9,15,17,44,45 the acyl chain is even a major determinant of Tcp activity against certain vancomycin-resistant strains.46 Lipidated glycopeptides

ultidrug-resistant bacteria in both clinical and community settings is a major global health problem.1−5 Currently, there is no class of clinically useful antibiotic to which resistance among pathogenic bacteria has not been detected.4,6 Worryingly, very few options remain to treat coccal infections that are resistant to vancomycin, a glycopeptide antibiotic once thought to be an ultimate solution to the problem of drug-resistant Grampositive infections.7 Teicoplanin (Tcp) is a lipoglycopeptide antibiotic that has been widely used since the mid-1980s for the treatment of the life-threatening infections caused by resistant Gram-positive pathogens, including vancomycin- and methicillin-resistant strains.8,9 The emergence and rise of Tcp resistance has prompted the search for new derivatives of this and other glycopeptides and has recently led to the clinical approval of three semisynthetic glycopeptide derivatives: telavancin,10 oritavancin,11 and dalbavancin.12 Glycopeptide antibiotics possess a complicated chemical structure that makes their total chemical synthesis a formidable challenge.13−18 Therefore, the only feasible source of glycopeptides for medical use and for further semisynthesis studies19−21 is by the fermentation of soil-dwelling actinomycetes that naturally produce glycopeptide antibiotics. There is only one known Tcp producer, Actinoplanes teichomyceticus, (NRRL-B16726 = ATCC 31121),22,23 which produces a mixture of teicoplanins that differ in the nature of the © 2016 American Chemical Society

Received: January 8, 2016 Accepted: June 10, 2016 Published: June 10, 2016 2254

DOI: 10.1021/acschembio.6b00018 ACS Chem. Biol. 2016, 11, 2254−2264

Articles

ACS Chemical Biology

Figure 1. Production of teicoplanin in wild type A. teichomyceticus grown in TM1 medium for 7 days. (a) Teicoplanin is produced as a mixture of acylated components and the characterized forms are shown here. The seven amino acids of teicoplanin from the N-terminus to the C-terminus are shown as AA1 to AA-7. (b) Analysis of teicoplanin production using LC-MS method 1. A species not shown in panel A with m/z 1850 was reliably produced and is consistent with a C8 acyl chain. (c) Mass spectra for each teicoplanin component, featuring clear [M + H]+ and [M+2H]2+ peaks for each species.

Figure 2. Teicoplanin gene cluster. Genes investigated in this study are denoted with red triangles, and the coverage of cosmids used in this study are shown.

of the modifications involved in the conversion of the aglycone into active teicoplanin. Consequently, the entire order of in vivo Tcp aglycone (AGT) glycosylation and acylation remains speculative.22,27 Additionally, some putative tailoring enzymes, such as orf 3* (hereafter tei3*), orf13* (tei13*), and orf 30* (tei30*), have not been characterized at all. A comparison of metabolites accumulated by various NRRL-B16726 strains deficient in different Tcp biosynthetic (tei) genes would provide valuable information about the sequence of tailoring reactions in Tcp biosynthesis under in vivo conditions. Therefore, we investigated the functions of the glycosyltransferase genes tei3* and orf10* (hereafter tei10*), the

are believed to anchor to the membrane, which enhances their ability to bind lipid II and to interfere with the transglycosylation step of peptidoglycan biosynthesis,9,15 as well as offering an alternative antimicrobial mechanism by disrupting bacterial membranes.47 Hence, there is an enormous practical interest in a detailed understanding of the post-assembly line tailoring processes required for Tcp biosynthesis. The functions of some Tcp tailoring enzymes have previously been investigated in vitro,24,26−29 and these have been exploited for the in vitro production of Tcp analogues.28,48 However, these analyses were limited by the number of substrates available for testing and therefore do not provide complete information on the sequence 2255


Articles


Figure 3. Metabolite profile of the A. teichomyceticus Δtei10* mutant grown in TM1 medium for 7 days and analyzed using LC-MS method 2. (a) Extracted ion chromatogram showing the relative proportion of AGT-Man (1) and AGT (2). (b) MS profiles for 1 and 2 showing the characteristic isotope distribution for teicoplanin derivatives. (c) Structures of 1 and 2.

Figure 4. Production of 3 and 4 by A. teichomyceticus Δtei3* grown in TM1 medium for 7 days and analyzed using LC-MS method 2. (a) Extracted ion chromatogram for 3 and 4. (b) The structures of these compounds. (c) MS profiles of these compounds. The panels on the right show a magnified image of the [M+2H]2+ spectra of each compound.

acyltransferase gene orf11* (hereafter tei11*), the putative acylCoA-synthetase gene tei13*, and the putative type II thioesterase gene tei30* (Figure 2). To achieve this, we constructed a series of mutant strains and analyzed their teicoplanin production patterns. Based on these results, we are now able to outline the entire sequence of the Tcp glycosylation and acylation steps and

show that some genes in the cluster are not essential for teicoplanin production.

■

RESULTS AND DISCUSSION Order of Glycosylation Steps in Tcp Biosynthesis. Three glycosyltransferase genes are found in the tei cluster: tei1, tei3*, and tei10*.24,25 Biochemical studies showed that Tei1 and

2256


Articles


Figure 5. Production of teicoplanin derivatives by the A. teichomyceticus Δtei11* mutant grown in TM1 medium for 7 days and analyzed using LC-MS method 1. (a) Extracted ion chromatogram for compounds 5 and 6. (b) LC-MS spectra for each of these compounds. (c) Proposed structures for 5 and 6.

Tei10* transfer N-acetylglucosamine (GlcNAc) to amino acids 6 and 4, respectively.24,25 Tei3* is a member of glycosyltransferase family 39 (inverting GT-C fold protein) and is predicted to utilize undecaprenyl-phospho-mannose as a donor for the mannosylation of amino acid 7. However, this protein is membrane associated, which hampers the in vitro analysis of Tei3* function and specificity. In order to study the function of above-mentioned enzymes in vivo, their respective mutants were generated (for details see Methods section) in the A. teichomyceticus strain. LC-MS analysis of NRRL-B16726 extracts revealed the expected array of teicoplanins, which differ in the structure of the acyl chain attached to the glucosamine sugar on amino acid 4 (Figure 1b). The most abundant teicoplanin in the extract has a mass of 1878 Da ([M + H]+), which is consistent with the masses of Tcp A2−2 and A2−3 (Figure 1a). The common identity of each of these components was verified by MS/MS (Figure S2) and by the characteristic isotopic distribution observed for dichlorinated teicoplanin. In contrast, two independent clones of the Δtei10* strain predominantly accumulated a single Tcp-like molecule with a mass of 1360 Da (Figure 3), which corresponds to mannosylated teicoplanin aglycone (1, AGT-Man). No other glycosylated forms of Tcp were observed, although a small amount of AGT (2) was detected (m/z 1198, Figure 3), implying that the mannosyltransferase Tei3* is highly active toward AGT. As before, this assignment was consistent with predicted isotope patterns, exact masses, and MS/MS data for these compounds (Figure S3). To address polar effects that might affect the expression of glycosyltransferase Tei1, these mutant strains were complemented in trans with a plasmid-borne copy of tei10* (see Methods section). We observed the restoration of the wild type pattern of Tcp production, ruling out the possibility that unanticipated genomic rearrangements could distort our results. Our data agree with the past kinetic studies showing that glycosyltransferase Tei1 has poor catalytic efficiency in transferring GlcNAc to amino acid 6 of AGT.27 Hence, the attachment of GlcNAc to amino acid 4 is a prerequisite for GlcNAc transfer

to amino acid 6. Nevertheless, the timing of mannosylation remained unknown. We therefore generated the A. teichomyceticus Δtei3* mutant and analyzed its Tcp production pattern. As expected, this mutant was unable to produce full Tcp. Instead, two novel compounds with m/z 1716 and 1730 were observed (Figure 4), which correspond to demannosylated teicoplanin with C10 and C11 acyl chains attached, respectively (3 and 4, Figure 4b). This was confirmed by MS2 analysis (Figure S4). There were no other partially glycosylated lipoglycopeptides in any Δtei3* extracts, which indicates that all other tailoring enzymes function efficiently in the absence of mannosylation. The data from the Δtei10* and Δtei3* mutants support previous in vitro results that show that there is a strict ordering of glycosylation by Tei10* and Tei1.27 In contrast, the data do not confirm the timing of mannosylation, as this could feasibly happen before or after Tei1-catalyzed glycosylatation. Inactivation of Acyltransferase Gene tei11* Led to the Accumulation of Multiple Teicoplanin Derivatives. Previous in vitro assays have firmly established the acyltransferase function of Tei11*,24,26,27,50 although the impact of tei11* inactivation on the production of teicoplanins in vivo has not been studied. We therefore analyzed two independent A. teichomyceticus Δtei11* mutants for teicoplanin-like compounds. These both revealed two new compounds with mass to charge ratios of 1521 and 1724, which are consistent with Tcp derivatives lacking acyl side chains (5 and 6, Figures 5 and S5), along with a small amount of m/z 1487, which is a dechlorinated form of m/z 1521 (Figure S6). The compound with m/z 1724 is deacyl teicoplanin (6, [M + H]+ = 1724), while the compound with m/z 1521 correlates with a Tcp derivative that lacks both an acyl chain and the N-acetylglucosaminyl group on amino acid 6 (5, [M + H]+ = 1521). The relative yields of these compounds were investigated by LC-MS analysis of triplicate cultures (Figure S7). This showed that 5 is clearly the major metabolite produced by Δtei11*, implying that, under in vivo conditions, Tei1 preferentially attaches GlcNAc to amino acid 6 of an acylated Tcp substrate. It is also interesting to note the residual 2257


Articles

ACS Chemical Biology production of partially dechlorinated Tcp analog(s) upon tei11* disruption. Based on studies on balhimycin, chlorination is thought to take place during nonribosomal synthesis of the peptide chain.30,51 It remains to be determined as to whether the same mechanism operates during Tcp biosynthesis, and if so, what links exist between acylation and chlorination events. These data clearly show a previously unidentified preference of Tei1 for a glycopeptide acceptor that is acylated. Prior in vitro analyses of Tei1 glycosylation activity have not had access to acylated substrates for testing, so we have overlooked this possibility. Interestingly, the recently published structure of Tei11* shows that it is capable of binding a Tcp derivative that is glycosylated at amino acid 6.50 Tei13* and Tei30* Are Putative acyl-CoA Biosynthesis Enzymes but Are Dispensable for Tcp Production. The function of tei13* and tei30* genes has not previously been investigated but could plausibly participate in the biosynthesis of an acyl-CoA substrate for Tei11*. The tei13* gene encodes a putative acyl-CoA synthetase, so it is possible that Tei13* could catalyze the ATP-dependent ligation of a free fatty acid chain to coenzyme A, thus providing sufficient donor substrates for the acyltransferase Tei11* to function properly. A homologue of Tei13* is encoded within a putative lipoglycopeptide gene cluster from an environment isolate (uncultured bacterium esnapd15), but it is not present in any other sequenced glycopeptide gene clusters. However, Tei13* is 42% identical to DptE (Figures S8 and S9), a well-characterized protein involved in daptomycin biosynthesis that activates C8−C12 fatty acids.52 Detailed sequence analysis (Figure S8) shows that Tei13* features all the characterized sequence motifs that are consistent with fatty acyl-AMP ligases (FAALs) and fatty acylcoenzyme A (CoA) ligases (FACLs).53 The presence of an insertion motif indicates that it could be a FAAL (thus not capable of transferring an acid to CoA), but this is also found in RevS from the reveromycin pathway, which is a FACL that catalyzes the production of C8−C10 acyl-CoAs.54 Surprisingly, Tcp production did not appear to differ between the Δtei13* mutant and wild type A. teichomyceticus. Given the putative role of Tei13* as a producer of substrates for Tei11*, the distribution of acyl chain lengths attached to teicoplanin was assessed using LC-MS of the wild type and Δtei13* in two established teicoplanin production media. In TM1 medium,23 the wild type strain produced teicoplanin in the range of 80−120 mg/L, whereas the Δtei13* mutant provided erratic production levels, which varied from no teicoplanin derivatives to levels close to the wild type. After three independent replicates in this medium, we did not detect any reliable influence of the mutations in the tei13* gene on acyl chain distribution attached to teicoplanin (Figure 6a). However, in the medium described by Lee et al.,55 which also provides a high titer of teicoplanin production (30− 50 mg/L), a significant change in the distribution of acyl chain lengths was observed (Figure 6b). In this medium, there was a small but significant drop in specificity for C10 acyl chains (67% versus 49% total acyl chains). We therefore postulate that, under certain conditions, Tei13* can assist in the production of C10 acyl-CoA donors for Tei11*. Tei30* is a putative type II thioesterase that is 41% identical to the well-defined type II thioesterase (TEII) RifR from Amycolatopsis mediterranei56 (Figure S10). Therefore, two possible roles of Tei30* can be envisaged: (a) hydrolysis of acyl chains from fatty acid synthases or from acyl-CoA intermediates during beta oxidation of fatty acids to supply free fatty acids for Tei13* (see above) or (b) removal of aberrant

Figure 6. Analysis of acyl chain length distribution from teicoplanin production cultures from wild type, Δtei13*, and Δtei30* strains. (a) Data for Tcp production in TM1 medium. (b) Data for Tcp production in a medium described by Lee et al. The data represent the average of triplicate fermentation experiments, with error bars reflecting the standard deviation of these data. All data are normalized so that total teicoplanins in each strain = 1.

units from peptide carrier proteins on the Tcp NRPS. The first role correlates with the mammary gland rat fatty acid synthase TEII in lactating rats, which hydrolyses C8−C12 fatty acids from the synthase,57 while the second role would be consistent with the homology with RifR, which has a housekeeping function to remove aberrant acyl groups from the rifamycin PKS. No other glycopeptide biosynthetic gene clusters contain tei30* homologues. Wild type A. teichomyceticus and the Δtei30* mutant were compared to show that deletion of tei30* did not alter the composition or yield of teicoplanin in TM1 medium (Figure 6a), but in the Lee et al. medium, there was a change in acyl group profile similar to Δtei13* (Figure 6b). This shows that Tei30* is also not essential for teicoplanin biosynthesis but may have a role in teicoplanin production when C10-fatty acid concentrations are limiting, which appears to be the case for the production medium described by Lee et al. However, we cannot rule out the possibility that thioesterases encoded elsewhere in the A. teichomyceticus genome might compensate the loss of tei30* in 2258


Articles

ACS Chemical Biology the Δtei30* mutant. This mode of gene complementation was shown to operate in natamycin biosynthesis.58 Our analysis of a draft NRRL-B16726 genome revealed the presence of three genes for potential type II thioesterases (Horbal, unpublished). Alternatively, it is possible that tei30* does not encode functional protein product, although a comparative sequence analysis of Tei30* with RifR from the rifamycin gene cluster58 and SrfA from the surfactin gene cluster59 showed that Tei30* contains the same Ser-Asp-His catalytic triad found in RifR and SrfA (Figure S10). A conserved motif surrounding the active site Ser residue (Gly-His-Ser-X-Gly) is also present in Tei30*. Therefore, taking into account in silico and in vivo data described above, we propose that Tei30* is functional but not essential for teicoplanin biosynthesis. The Products of Δtei3* and Δtei10* Retain Activity toward MRSA but Cannot Overcome Teicoplanin Resistance in the Vancomycin-Resistant Enterococci (VRE) VanA Phenotype. Pure AGT-Man (1, produced by Δtei10*) and a mixture of 3 and 4 (produced by Δtei3* and only differing by a CH2 group in their acyl chain) were assessed for their antimicrobial activity compared to teicoplanin in assays against MRSA and vancomycin-resistant Enterococcus (VRE) that possesses the VanA phenotype. VanA VRE strains are resistant to both multiple glycopeptides, including teicoplanin, so the compounds were tested to determine whether they could overcome this resistance. Both samples exhibited potent activity toward MRSA, with MICs that were marginally better than teicoplanin, but could not overcome teicoplanin resistance in VRE (Table 1).

and the in vivo substrate preferences of glycosyltransferases Tei10* and Tei1. We also showed that both tei13* and tei30* genes are not essential for Tcp biosynthesis but may participate in the biosynthesis of C10 acyl-CoA donors for Tei11*, since their deletion had a small but reproducible effect on acyl chain distribution in one medium tested. Several novel Tcp analogues are described for the first time, and the described results, strains, and compounds are of interest in the context of ongoing efforts to produce novel teicoplanin analogues with improved activities via biosynthetic and chemoenzymatic approaches. Biosynthetic engineering of the teicoplanin pathway is particularly attractive, as reliable genetic tools to significantly upregulate the teicoplanin pathway have recently been developed and could be applied to biosynthetic mutants to improve the production of novel teicoplanin derivatives.32−34

■

Table 1. Antibacterial Activity of Teicoplanin Derivatives Towards MRSA and VRE compound

MRSAa,b

VREa (VanA)

teicoplanin 1 3/4

0.5 0.25 0.25

>64 >64 >64

METHODS

Bacterial Strains and Growth Conditions. The bacterial strains used in this study are listed in Table 2. Escherichia coli strains were grown in Luria−Bertani (LB) broth medium. When required, the antibiotics were added to cultures at the following concentrations per milliliter: ampicillin 65 μg, kanamycin 50 μg, chloramphenicol 25 μg, apramycin 50 μg, and hygromycin 120 μg. Medium components and antibiotics were purchased from Sigma-Aldrich (St. Louis, MO, USA). For conjugation the A. teichomyceticus strains were grown on oatmeal60 or mannitol-soy (MS) medium60 for vigorous sporulation. Selection of the exconjugants was performed on the above-mentioned media supplemented with appropriate antibiotic. For DNA isolation, transconjugants and mutants were grown in 25 mL liquid seed medium (g/L: glucose 30, yeast extract 5, pepton 5, K2HPO4 4, KH2PO4 2, MgSO4·7H2O 0.5, pH 7.2). A. teichomyceticus and its mutant strains were maintained at −80 °C in 15% v/v glycerol at a biomass concentration of approximately 0.08 g/mL dry weight. Working cell banks (WCB) were prepared as previously described23 for A. teichomyceticus and its mutant strains, which were maintained at −80 °C in 15% v/v glycerol. Recombinant DNA Techniques. Isolation of genomic DNA from A. tecihomyceticus and plasmid DNA from E. coli was carried out using standard protocols.58 Restriction enzymes and molecular biology reagents were used according to recommendation of suppliers Thermo Scientific (Schwerte, Germany) and Promega (Madison, USA). Cosmid Construction. The majority of Tcp tailoring genes are located across two cosmids, 4B2 and JB7 (Figure 2). Since there is no efficient selection for kanamycin resistance in A. teichomyceticus NRRLB16726, we first replaced the kanamycin resistance marker within the vector backbone of the cosmids with the hygromycin resistance cassette hyg. To investigate the functions of the tei genes, we constructed a series of derivatives carrying λ-RED induced single gene deletions in the cosmids. In all cases, the tei gene of interest was replaced with an apramycin resistance cassette aac(3)IV-oriT from plasmid pIJ774.49 The tei10* Gene Inactivation. The tei10* gene was replaced with the aac(3)IV cassette within the cosmid 4B2hyg (Table 2) using the λRed recombination process.49 The primers tei10*delForw and tei10*delRev used for replacement are listed in Table 3. The cosmid 4B2del10* was generated. The tei3* Gene Inactivation. The tei3* gene was replaced with the aac(3)IV cassette within the cosmid 4B2hyg (Table 2) using the λRed recombination process. The primers tei3*delForw and tei3*delRev used for replacement are listed in Table 3. The cosmid 4B2del3* was obtained. The tei11* Gene Inactivation. The tei11* gene was replaced with the aac(3)IV cassette within the cosmid 4B2hyg (Table 2) using the λRed recombination process. The primers tei11*delForw and tei11*delRev used for replacement are listed in Table 3. The cosmid 4B2del11* was produced. The tei13* Gene Inactivation. The tei13* gene was replaced with the aac(3)IV cassette within the cosmid 4B2hyg (Table 2) using the λRed recombination process. The primers tei13*delForw and tei13*delRev

MIC values reported in μg/mL. bMRSA = methicillin-resistant S. aureus. VRE = vancomycin-resistant enterococci, VanA phenotype. Additional experimental details are provided in the methods.

a

Conclusion. For the first time, we have been able to identify the likely sequence of acylation and glycosylation reactions required to convert, in vivo, AGT (2) into mature teicoplanin. This was achieved through comparison of glycopeptides accumulated by a set of genetically engineered Actinoplanes teichomyceticus mutants. This sequence is summarized in Figure 7. Our data indicate that Tei10* first transfers N-acetylglucosamine (GlcNAc) to AGT at amino acid 4 to produce GlcNAcAGT. Following deacetylation of the GlcNAc moiety by Tei2*,28,42 Tei11* then transfers an acyl group from an acylCoA donor to produce N-acylglucosaminyl-AGT. Tei1 then transfers N-acetylglucosamine to amino acid 6. Finally, Tei3* mannosylates amino acid 7 to produce mature Tcp. Due to the apparent substrate promiscuity of Tei3*, it was difficult to prove the timing of mannosylation and it could feasibly occur earlier in the pathway (Figure 7). In this case, AGT (2) itself might be a substrate for Tei3* to generate AGT-Man (1), which could serve as a substrate for Tei10* and undergo further modifications. The reported data are in accord with the published biochemical studies of teicoplanin tailoring enzymes,24,26−28,42 but it also provides additional data to improve our understanding of teicoplanin maturation, such as a putative time point of acylation 2259


Articles


Figure 7. Proposed order of tailoring steps required to convert the teicoplanin aglycone (AGT) into teicoplanin and the novel (lipo)glycopeptides described in this work. Putative roles for Tei13* and Tei30* are shown in gray, although our data show that these are nonessential enzymes. Alternative biosynthetic routes to convert AGT into mature teicoplanin via metabolites found in Δtei10* and Δtei11* are indicated as blue and green pathways, respectively. were used for replacement (Table 3). As a result, the cosmid 4B2del13* was produced. The tei30* Gene Inactivation. The kanamycin resistance gene in cosmid JB7 (Table 2) was replaced with the hyg cassette (pHYG1) by the use of the λRed recombination process49 and the primers HygRVSKm Forw and HygRVSKmRev (Table 3). As a result, the cosmid JB7hyg was obtained. The tei30* gene was replaced with the aac(3)IV cassette within the cosmid JB7hyg (Table 2) using the λRed recombination process. The primer pair tei30*delForw and tei30*delRev was used for replacement (Table 3). As a result, the cosmid JB7del30* was obtained. Construction of the Chromosomal Mutants of A. teichomyceticus NRRL-B16726. The above-described gene disruption cosmids were individually transferred from E. coli ET12567/pUZ8002 into A. teichomyceticus NRRL-B16726 by means of conjugation.31,32 Transconjugants were selected for resistance to apramycin (10 μg mL−1). For the generation of A. teichomyceticus Δtei10*, Δtei3*, Δtei11*, Δtei13*, and Δtei30* mutants, single-crossover apramycin and hygromycin resistant mutants were screened for the loss of hygromycin resistance that is the result of a double-crossover event. Further analysis showed that, for all mutants, 97−100% of the apramycin resistant (Amr) transconjugants (on average, 100 colonies tested) were sensitive to hygromycin, confirming the loss of vector sequences. Replacement of all genes was confirmed by PCR using the primer pairs tei10*Forw and tei10*Rev, tei3*Forw and tei3*Rev, tei11*Forw and tei11*Rev, tei13*Forw and tei13*Rev, and tei30*Forw and tei30*Rev, respectively

(Table 3). The size of PCR fragments was approximately 1.5 kb when chromosomal DNA of A. teichomyceticus Δtei10*, Δtei13*, and Δtei30* mutants were used, while the same primers for tei10*, tei13*, and tei30* genes produced amplicons 1.25, 1.94, and 0.92 kb, respectively, when genomic DNA of the wild-type strain was used as a template (Figure S1). In the case of Δtei11* and Δtei3* mutants, 1.5 kb DNA fragments were obtained, whereas the same primers yielded amplicons 1.14 and 1.94 kb, respectively, when the chromosomal DNA of the wild type was used (Figure S1). Complementation of the tei10* Mutant. A 1.5 kb DNA fragment containing the tei10* gene was amplified from the cosmid 4B2 using primers tei10*KpnIF and tei10*EVRev (Table 3), digested with KpnI/ EcoRV and cloned into respective sites of pSETPmoE5. As a result the pSETPmoetei10* plasmid was obtained. Replacement of the apramycin resistance gene with hygromycin (pHYG1) in the plasmid pSETPmoetei10* using the λRed recombination process and the primers P1AmHyg-up and P2Am-Hyg-rp (Table 3) gave pSETPtei10*hyg. Production of Teicoplanin by A. teichomyceticus Strains. A total of 0.5 mL of WCB was inoculated into 250 mL baffled flasks containing either 50 mL of vegetative medium E2561 (g L−1: dextrose 25, meat extract 4, yeast autolysate 1, soybean meal 10, peptone 4, NaCl 2.5, CaCO3 5, deionized water to 1 L) or 50 mL of the seed medium described in Lee et al.55 (w/v: 1% glucose, 0.4% yeast extract, 0.4% peptone, 0.05% MgSO4·7H2O, 0.2% KH2PO4, and 0.4% K2HPO4, pH 7). Flask cultures were incubated for 48 h on a rotary shaker at 220 rpm and 28 °C and were then used to inoculate 50 mL of production medium 2260


Articles

ACS Chemical Biology Table 2. Bacterial Strains and Plasmids Used in This Study strains and plasmids

description

source or reference

A. teichomyceticus A. teichomyceticus Δtei3* A. teichomyceticus Δtei10* A. teichomyceticus Δtei11* A. teichomyceticus Δtei13* A. teichomyceticus Δtei30* E. coli DH5α E. coli ET12567 (pUZ8002) E. coli DH5α/pSC101- BADgbaA JB7

producer of teicoplanin derivative of A. teichomyceticus with inactivated tei3* gene derivative of A. teichomyceticus with inactivated tei10* gene derivative of A. teichomyceticus with inactivated tei11* gene derivative of A. teichomyceticus with inactivated tei13* gene derivative of A. teichomyceticus with inactivated tei30* gene Host for routine subcloning experiments (dam-13::Tn9 dcm-6), pUZ8002+ (ΔoriT). Used for conjugative transfer of DNA supE44 ΔlacU169(φ80lacZΔM15), harbors pRedαβγ on the basis pSC101 with thermosensitive replicon; Tetr Supercos1 containing part of the teicoplanin gene cluster

JB7hyg

Supercos1 containing part of the teicoplanin gene cluster with hygromycin resistance gene instead of neomycin Supercos1 containing part of the teicoplanin gene cluster with hygromycin resistance gene instead of neomycin derivative of 4B2hyg with the inactivated tei3* gene derivative of 4B2hyg with the inactivated tei10* gene derivative of 4B2hyg with the inactivated tei11* gene derivative of 4B2hyg with the inactivated tei13* gene derivative of 4B2hyg with the inactivated tei30* gene derivative of pGUS containing gusA gene under the control of moeE5p from S. ghanaensis

4B2hyg 4B2del3* 4B2del10* 4B2del11* 4B2del13* JB7del30* pSETPmoeE5 pSETPmoetei10* pSETPtei10*hyg

derivative of pSETPmoeE5 containing tei10* gene under the control of moeE5p from S. ghanaensis derivative of pSETPmoetei10* containing hygromycin resistance gene instead of apramycin

NRRL-B16726 this work this work this work this work this work MBI Fermentas 57 46 Dr. A. Truman, John Innes Center, England this work 31 this work this work this work this work this work Dr. R. Makitrynskyy, Lviv University, Ukraine this work this work

Table 3. Primers Used in This Work primer

nucleotide sequence (5′−3′)

utility

gene name

tei10*delForw tei10*delRev tei3*delForw tei3*delRev tei11*delForw tei11*delForw tei13*delForw tei13*delRev tei30*delForw tei30*delForw tei10*Forw tei10*Rev tei3*Forw tei3*Rev tei11*Forw tei11*Rev tei13*ForwEV tei13*RevEI tei30ForwEV tei30RevEI HygRVSKm Forw HygRVSKm Rev

CGGCCGACGCCGGAGCCTACCGAATGGGGATGCGAGATGATTCCGGGGATCCGTCGACC CGCCGCCCACCGGTGCGGGCCGACAGCCGGTGCGGTTCATGTAGGCTGGAGCTGCTTC TCCCGCCATCGACGCCGTATCACGCCTGGAGGTTACGTGATTCCGGGGATCCGTCGACC CAGCCCGCGGGGCGGTGACGGATCCACCGGCTCGCCTTATGTAGGCTGGAGCTGCTTC GCGGGTTTCGCTGGAGGTGCAGGAGAGCGTGAAGGAGTGATTCCGGGGATCCGTCGACC CGTGGCCGGGCTCGCCGGCAGCGGCTCCGCCGCCGCTTATGTAGGCTGGAGCTGCTTC CGATGAGCAGGGAGGGAATCCCCGATGGGCTACGACATGATTCCGGGGATCCGTCGACC CGGCAACCGCGTCGGTCCGGATCCCGGCGACACCCGTCATGTAGGCTGGAGCTGCTTC TCCGTCGGCCGTCCGGAGCGGCGGAGGGGGAGAGGAATGATTCCGGGGATCCGTCGACC GGTGACCGGGGACGCGCCAGCCGGCCCGCTGCCGGCTCATGTAGGCTGGAGCTGCTTC GAGCCTACCGAATGGGGATG CGCTTCGACGAACGTCATGG GCGACGACAGCTGACTTCTG CGAAGCGGAAGGGTCAGCGACCA TTTGGTACCATGACGTTCGTCGAAGCGATG TTTGATATCTTCCACAAATGTGTCCAGCGTC AAAAGATATCAACCGATGAGCAGGGAGGGAA AAAAGAATTCGAGACCGAAGGGTGCGTGTCA TTTTGATATCCGTCGGCCGTCCGGAGCGG TTTTGAATTCTACACCGTGACGAACTGCCTC ATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGAT GCCCGTAGAGATTGGCGATCCC TCGCTTGGTCGGTCATTTCGAACCCCAGAGTCCCGCTCACAGGCGCCGGGGGCGGTGTC TTGGTACCTGGAGGAGCCTACCGAATGGGGATG TTTTTTTTTTTTGATATCGCTTCGACGAACGTCATGG GTGCAATACGAATGGCGAAAAGCCGAGCTCATCGGTCA GCCCGTAGAGATTGGCGATCCC TCATGAGCTCAGCCAATCGACTGGCGAGCGGCATCGCATCAGGCGCCGGGGGCGGTGTC

tei10* gene inactivation

tei10*


tei3*


tei11*


tei13*


tei30*

gene inactivation confirmation gene inactivation confirmation gene inactivation confirmation gene inactivation confirmation gene inactivation confirmation replacement of the neomycin resistance gene tei10* gene amplification replacement of the apramycin resistance gene

tei10*

tei10*KpnIF tei10*EVRev P1Am-Hyg-up P2Am-Hyg-rp

in (5% v/v) 250 mL Erlenmeyer flasks containing spring wire baffles. The seed culture in E25 medium was used to inoculate TM1 production

tei3* tei11* tei13* tei30* hyg

tei10* hyg

medium (g/L: malt extract 30, glucose 10, soybean meal 15, yeast extract 5, CaCO3 4, deionized water to 1 L),23 while the Lee et al. seed culture 2261


Articles

ACS Chemical Biology was used to inoculate a production medium also described by Lee et al. (w/v: 3% mannose, 0.5% yeast extract, 0.15% asparagine, 0.05% MgSO4· 7H2O, 0.01% NaCl, and 0.01% CaCl2·2H2O).53 Flasks were incubated at 28 °C with shaking at 220 rpm for 6−7 days. Teicoplanin and its analogues were extracted by using two methods. First, one volume of culture was vigorously mixed with one volume of acetonitrile and then centrifuged (13 000g for 5 min). The supernatant was directly analyzed by LC-MS. An alternative procedure was used to extract glycopeptides that adhered to the A. teichomyceticus cell walls. Here, the culture broth was centrifuged and the cell pellet was extracted with 1% NH4OH (1 mL per 1 g wet pellet). This mixture was centrifuged and the alkaline supernatant harvested and neutralized with HCl. This was then centrifuged (13 000g for 5 min) prior to LC-MS analysis. The original supernatant and the pellet extract were combined for the quantitative analysis of acyl chain lengths. LC-MS Analysis of Glycopeptides. Two different methods were used to analyze glycopeptides by LC-MS. Method 1 used a Thermo Finnigan Surveyor HPLC system coupled to a Thermo Finnigan LCQ Deca ion trap mass spectrometer fitted with an ESI source. Samples were injected onto a Phenomenex Kinetex 2.6 μm XB-C18 column (50 mm × 2.1 mm, 100 Å) set at a temperature of 30 °C, eluting with a linear gradient of 5 to 95% acetonitrile (MeCN) in water + 0.1% formic acid (FA) over 12 min with a flow rate of 0.35 mL min−1, which was then held at 95% MeCN for 3 min and switched back to 5% MeCN for an additional 4 min. Positive mode mass spectrometry data were collected between m/z 200 and 2000. Method 2 used a Shimadzu Nexera X2 UHPLC coupled to a Shimadzu IT-TOF mass spectrometer. Samples were injected onto a Phenomenex Kinetex 2.6 μm XB-C18 column (50 mm × 2.1 mm, 100 Å) set at a temperature of 40 °C, eluting with a linear gradient of 5 to 95% acetonitrile in water + 0.1% FA over 10 min with a flow-rate of 0.6 mL min−1. The system was held at 95% MeCN until 12 min before switching back to 5% MeCN for a total run time of 14 min. Positive mode mass spectrometry data were collected between m/z 500 and 2000. Data-dependent MS/MS spectra were obtained for each method with isolation widths of m/z 3. Acyl chain length distribution was calculated as the mean values of data from three replica fermentations per strain. Relative proportions of metabolites were calculated as the area from extracted ion chromatograms, where a m/z window of 4 was used to calculate the quantity of the [M + H]+ species and a m/z window of 3 was used to calculate the quantity of the [M + 2H]2+ species. These were summed, and the areas of the resulting peaks were then calculated. The extracted ion chromatograms shown in various figures used the same m/z windows. Purification of Glycopeptides for Antimicrobial Activity Testing. Glycopeptides were produced as described in the Production of Teicoplanin by A. teichomyceticus Strains section using 20 flasks per strain to provide a total of 400 mL of culture. The supernatant and cell pellet extracts were combined and purified using a D-alanine-D-alaninebased affinity resin. This was prepared as described by Holding and Spencer.40 The crude mixture of the supernatant and cell pellet extract was pelleted by centrifugation (×5000g) and then filtered through a GF/ A glass fiber filter under suction. The filtrate was adjusted to pH 7.0 and loaded onto the D-alanine-D-alanine resin using a peristaltic pump at a flow rate of 0.5 mL/min. The column was washed sequentially with aqueous sodium phosphate (40 mL, 0.2 M, pH 7.0), then aqueous ammonium acetate (40 mL, 0.4 M, pH 7.8), and then 10% acetonitrile in water (40 mL). The glycopeptide was eluted with 0.1 M NH4OH/ acetonitrile (1:1, 40 mL), and the eluate was lyophilized. This sample was redissolved in 50% methanol in water and further purified by HPLC (Shimadzu LC-MS 2020). Samples were injected onto a Phenomenex Luna 5 μm C18(2) column (250 mm × 10 mm, 100 Å) running the following program using a flow rate of 3 mL/min with 0.1% formic acid in H2O (A) and CH3CN (B): 0−10 min, 5−30% B; 10−20 min, 30− 50% B; 20−25 min, 95% B; 25−30.5 min, 95% B, 30.5−35 min: 95−5% B. A total of 1.3 mg of Teico 3* and 3.6 mg of 1 and 1.3 mg of 3/4 were isolated, and purity was confirmed by LC-MS. Determination of Glycopeptide MIC toward MRSA and VRE. To determine the MIC of the target compounds, indicator strains of methicillin-resistant Staphlococcus aureus (MRSA) and vancomycinresistant Enterococcus (VRE), which are both clinical isolates from the

Norfolk and Norwich University Hospital, were incubated overnight in the presence of a known concentration of target compounds. Microtiter 24-well plates (Nunclon Delta Surface, Thermo Scientific) were used, each well containing a total volume of 1 mL of media (5 g L−1 yeast extract, 10 g L−1 tryptone, and 1 g L−1 glucose dissolved in deionized water) containing the antibiotic compound, and MRSA or VRE cells to a starting measurement of 0.1 OD600. Media and cell only controls were also included. Plates were measured to establish a 0 h time point, grown overnight at 30 °C, and resuspended, then the OD600 was measured once more. Cell growth was assessed with glycopeptide concentrations tested in 2-fold increments (e.g., 0.125, 0.5, 1, 2, up to 64 μg mL−1) with the MIC defined as the lowest concentration where no cellular growth was observed.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acschembio.6b00018.

■

Figures S1−S10 (PDF)

AUTHOR INFORMATION

Corresponding Authors

*For chemistry, e-mail: [email protected]. *For genetics, e-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by grant Bg-98 F of the Ministry of Education and Science of Ukraine (to V.F.), a Royal Society University Research Fellowship to A.W.T., by the BBSRC MET Institute Strategic Program Grant to the John Innes Centre, and by the DAAD Research Fellowship to L.H. (PKZ A/13/03150). We thank J. Munnoch and M. Hutchings (UEA) for support in carrying out the bioassays.

■

REFERENCES

(1) Tillotson, G. S., and Theriault, N. (2013) New and alternative approaches to tackling antibiotic resistance. F1000Prime Rep. 7, 1−7. (2) Orsi, G. B., and Ciorba, V. (2013) Vancomycin resistant enterococci healthcare associated infections. Ann. Iq. 25, 485−492. (3) Taylor, A. R. (2013) Methicillin-resistant Staphylococcus aureus infections. Prim. Care 40, 637−654. (4) Laxminarayan, R., Duse, A., Wattal, C., Zaidi, A. K., Wertheim, H. F., Sumpradit, N., Vlieghe, E., Hara, G. L., Gould, I. M., Goossens, H., Greko, C., So, A. D., Bigdeli, M., Tomson, G., Woodhouse, W., Ombaka, E., Peralta, A. Q., Qamar, F. N., Mir, F., Kariuki, S., Bhutta, Z. A., Coates, A., Bergstrom, R., Wright, G. D., Brown, E. D., and Cars, O. (2013) Antibiotic resistance-the need for global solutions. Lancet Infect. Dis. 13, 1057−1098. (5) Fair, R. J., and Tor, Y. (2014) Antibiotics and bacterial resistance in the 21st century. Perspect. Med. Chem. 6, 25−64. (6) Paphitou, N. I. (2013) Antimicrobial resistance: action to combat the rising microbial challenges. Int. J. Antimicrob. Agents 42, S25. (7) Cooper, G. L., and Given, D. B. (1986) The Development of Vancomycin, in Vancomycin, a Comprehensive Review of 30 Years of Clinical Experience, pp 1−5, Park Row Publications, Indianapolis, IN. (8) Chow, A. V., Jewesson, P. J., Kureishi, A., and Phillips, G. L. (1993) Teicoplanin versus vancomycin in the empirical treatment of febrile neutropenic patients. Eur. J. Haematol. 54, 18−24. (9) Van Bambeke, F., Van Laethem, Y., Courvalin, P., and Tulkens, P. M. (2004) Glycopeptide antibiotics from conventional molecules to new derivatives. Drugs 64, 913−936.

2262


Articles

ACS Chemical Biology (10) Higgins, D. L., Chang, R., Debabov, D. V., Leung, J., Wu, T., Krause, K. M., Sandvik, E., Hubbard, J. M., Kaniga, K., Schmidt, D. E., Jr., Gao, Q., Cass, R. T., Karr, D. E., Benton, B. M., and Humphrey, P. P. (2005) Telavancin, a multifunctional lipoglycopeptide, disrupts both cell wall synthesis and cell membrane integrity in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 49, 1127−1134. (11) Belley, A., McKay, G. A., Arhin, F. F., Sarmiento, I., Beaulieu, S., Fadhil, I., Parr, T. R., Jr., and Moeck, G. (2010) Oritavancin disrupts membrane integrity of Staphylococcus aureus and vancomycin-resistant enterococci to effect rapid bacterial killing. Antimicrob. Agents Chemother. 54, 5369−5371. (12) Chen, A. Y., Zervos, M. J., and Vazquez, J. A. (2007) Dalbavancin: a novel antimicrobial. Int. J. Clin Pract. 61, 853−863. (13) Boger, D. L., Kim, S. H., Mori, Y., Weng, J. H., Rogel, O., Castle, S. L., and McAtee, J. J. (2001) First and second generation total synthesis of the teicoplanin aglycon. J. Am. Chem. Soc. 123, 1862−1871. (14) Hubbard, B. K., and Walsh, C. T. (2003) Vancomycin assembly: nature’s way. Angew. Chem., Int. Ed. 42, 730−765. (15) Kahne, D., Leimkuhler, C., Lu, W., and Walsh, C. (2005) Glycopeptide and lipoglycopeptide antibiotics. Chem. Rev. 105, 425− 448. (16) Wolter, F., Schoof, S., and Süssmuth, R. D. (2007) Synopsis of structural, biosynthetic and chemical aspects of glycopeptide antibiotics. Top Curr. Chem. 267, 143−185. (17) James, R. C., Pierce, J. G., Okano, A., Xie, J., and Boger, D. L. (2012) Redesign of glycopeptides antibiotics: back to the future. ACS Chem. Biol. 7, 797−804. (18) Xie, J., Okano, A., Pierce, J. G., James, R. C., Stamm, S., Crane, C. M., and Boger, D. L. (2012) Total synthesis of [Ψ[C(S)NH]Tpg4] vancomycin aglycon, [Ψ[C(NH)NH]Tpg4] vancomycin aglycon, and related key compounds: reengineering vancomycin for dual D-AlaD-Ala and D-Ala-D-Lac binding. J. Am. Chem. Soc. 134, 1284−1297. (19) Pathak, T. P., and Miller, S. J. (2013) Chemical Tailoring of Teicoplanin with Site-Selective Reactions. J. Am. Chem. Soc. 135, 8415− 8422. (20) Han, S., and Miller, S. J. (2013) Asymmetric Catalysis at a Distance: Catalytic, Site-Selective Phosphorylation of Teicoplanin. J. Am. Chem. Soc. 135, 12414−12421. (21) Han, S., Le, B. V., Hajare, H. S., Baxter, R. H. G., and Miller, S. J. (2014) X-ray Crystal Structure of Teicoplanin A2−2 Bound to a Catalytic Peptide Sequence via the Carrier Protein Strategy. J. Org. Chem. 79, 8550−8556. (22) Jung, H. M., Jeya, M., Kim, S. Y., Moon, H. J., Kumar Singh, R., Zhang, Y. W., and Lee, J. K. (2009) Biosynthesis, biotechnological production, and application of teicoplanin: current state and perspectives. Appl. Microbiol. Biotechnol. 84, 417−428. (23) Taurino, C., Frattini, L., Marcone, G. L., Gastaldo, L., and Marinelli, F. (2011) Actinoplanes teichomyceticus ATCC 31121 as a cell factory for producing teicoplanin. Microb. Cell Fact. 10, 1−13. (24) Li, T. L., Huang, F., Haydock, S. F., Mironenko, T., Leadlay, P. F., and Spencer, J. B. (2004) Biosynthetic gene cluster of the glycopeptide antibiotic teicoplanin: characterization of two glycosyltransferases and the key acyltransferase. Chem. Biol. 11, 107−119. (25) Sosio, M., Kloosterman, H., Bianchi, A., de Vreugd, P., Dijkhuizen, L., and Donadio, S. (2004) Organization of the teicoplanin gene cluster in Actinoplanes teichomyceticus. Microbiology 150, 95−102. (26) Kruger, R. G., Lu, W., Oberthür, M., Tao, J., Kahne, D., and Walsh, C. T. (2005) Tailoring of glycopeptide scaffolds by the acyltransferases from the teicoplanin and A-40,926 biosynthetic operons. Chem. Biol. 12, 131−140. (27) Howard-Jones, A. R., Kruger, R. G., Lu, W., Tao, J., Leimkuhler, C., Kahne, D., and Walsh, C. T. (2007) Kinetic analysis of teicoplanin glycosyltransferases and acyltransferase reveal ordered tailoring of aglyconescaffold to reconstitute mature teicoplanin. J. Am. Chem. Soc. 129, 10082−10083. (28) Truman, A. W., Fan, Q., Röttgen, M., Stegmann, E., Leadlay, P. F., and Spencer, J. B. (2008) The role of Cep15 in the biosynthesis of chloroeremomycin: reactivation of an ancestral catalytic function. Chem. Biol. 15, 476−484.

(29) Truman, A. W., Dias, M. V., Wu, S., Blundell, T. L., Huang, F., and Spencer, J. B. (2009) Chimeric glycosyltransferases for the generation of hybrid glycopeptides. Chem. Biol. 16, 676−685. (30) Wohlleben, W., Stegmann, E., and Süssmuth, R. D. (2009) Molecular genetic approaches to analyze glycopeptide biosynthesis. Methods Enzymol. 458, 459−486. (31) Ha, H. S., Hwang, Y. I., and Choi, S. U. (2008) Application of conjugation using phiC31 att/int system for Actinoplanes teichomyceticus, a producer of teicoplanin. Biotechnol. Lett. 30, 1233−1238. (32) Horbal, L., Zaburannyy, N., Ostash, B., Shulga, S., and Fedorenko, V. (2012) Manipulating the regulatory genes for teicoplanin production in Actinoplanes teichomyceticus. World J. Microbiol. Biotechnol. 28, 2095− 2100. (33) Horbal, L., Kobylyanskyy, A., Yushchuk, O., Zaburannyi, N., Luzhetskyy, A., Ostash, B., Marinelli, F., and Fedorenko, V. (2013) Evaluation of heterologous promoters for genetic analysis of Actinoplanes teichomyceticus–Producer of teicoplanin, drug of last defense. J. Biotechnol. 168, 367−372. (34) Horbal, L., Kobylyanskyy, A., Truman, A. W., Zaburranyi, N., Ostash, B., Luzhetskyy, A., Marinelli, F., and Fedorenko, V. (2014) The pathway-specific regulatory genes, tei15* and tei16*, are the master switches of teicoplanin production in Actinoplanes teichomyceticus. Appl. Microbiol. Biotechnol. 98, 9295−9309. (35) Chen, H., Tseng, C. C., Hubbard, B. K., and Walsh, C. T. (2001) Glycopeptide antibiotic biosynthesis: enzymatic assembly of the dedicated amino acid monomer (S)-3,5-dihydroxyphenylglycine. Proc. Natl. Acad. Sci. U. S. A. 98, 14901−14906. (36) Tseng, C. C., Vaillancourt, F. H., Bruner, S. D., and Walsh, C. T. (2004) DpgC is a metal- and cofactor-free 3,5-dihydroxyphenylacetylCoA 1,2-dioxygenase in the vancomycin biosynthetic pathway. Chem. Biol. 11, 1195−1203. (37) Bischoff, D., Bister, B., Bertazzo, M., Pfeifer, V., Stegmann, E., Nicholson, G. J., Keller, S., Pelzer, S., Wohlleben, W., and Süssmuth, R. D. (2005) The biosynthesis of vancomycin-type glycopeptide antibioticsa model for oxidative side-chain crosslinking by oxygenases coupled to the action of peptide synthetases. ChemBioChem 6, 2267− 2272. (38) Widboom, P. F., and Bruner, S. D. (2009) Complex oxidation chemistry in the biosynthetic pathways to vancomycin/teicoplanin antibiotics. ChemBioChem 10, 1757−1764. (39) Haslinger, K., Maximowitsch, E., Brieke, C., Koch, A., and Cryle, M. J. (2014) Cytochrome P450 OxyBtei catalyzes the first phenolic coupling step in teicoplanin biosynthesis. ChemBioChem 15, 2719− 2728. (40) Holding, A. N., and Spencer, J. B. (2008) Investigation into the mechanism of phenolic couplings during the biosynthesis of glycopeptide antibiotics. ChemBioChem 9, 2209−2214. (41) Süssmuth, R. D., and Wohlleben, W. (2004) The biosynthesis of glycopeptides antibiotics − a model for complex, non-ribosomally synthesized, peptidic secondary metabolites. Appl. Microbiol. Biotechnol. 63, 344−350. (42) Truman, A. W., Robinson, L., and Spencer, J. B. (2006) Identification of a Deacetylase Involved in the Maturation of Teicoplanin. ChemBioChem 7, 1670−1675. (43) Yim, G., Thaker, M. N., Koteva, K., and Wright, G. (2014) Glycopeptide antibiotic biosynthesis. J. Antibiot. 67, 31−41. (44) Dong, S. D., Oberthür, M., Losey, H. C., Anderson, J. W., Eggert, U. S., Peczuh, M. W., Walsh, C. T., and Kahne, D. (2002) The structural basis for induction of VanB resistance. J. Am. Chem. Soc. 124, 9064− 9065. (45) Thayer, D. A., and Wong, C. H. (2006) Vancomycin analogues containing monosaccharides exhibit improved antibiotic activity: a combined one-pot enzymatic glycosylation and chemical diversification strategy. Chem. - Asian J. 1, 445−452. (46) Hill, C. M., Krause, K. M., Lewis, S. R., Blais, J., Benton, B. M., Mammen, M., Humphrey, P. P., Kinana, A., and Janc, J. W. (2010) Specificity of induction of the vanA and vanB operons in vancomycinresistant enterococci by telavancin. Antimicrob. Agents Chemother. 54, 2814−2818. 2263


Articles

ACS Chemical Biology (47) Yarlagadda, V., Samaddar, S., Paramanandham, K., Shome, B. R., and Haldar, J. (2015) Membrane Disruption and Enhanced Inhibition of Cell-Wall Biosynthesis: A Synergistic Approach to Tackle VancomycinResistant Bacteria. Angew. Chem., Int. Ed. 54, 13644−13649. (48) Liu, Y.-C., Li, Y.-S., Lyu, S.-Y., Hsu, L.-J., Chen, Y.-H., Huang, Y.T., Chan, H.-C., Huang, C.-J., Chen, G.-H., Chou, C.-C., Tsai, M.-D., and Li, T.-L. (2011) Interception of teicoplanin oxidation intermediates yields new antimicrobial scaffolds. Nat. Chem. Biol. 7, 304−309. (49) Gust, B., Kieser, T., and Chater, K. (2002) PCR Targeting System in Streptomyces coelicolor A3(2), The John Innes Foundation, Norwich. (50) Lyu, S. Y., Liu, Y. C., Chang, C. Y., Huang, C. J., Chiu, Y. H., Huang, C. M., Hsu, N. S., Lin, K. H., Wu, C. J., Tsai, M. D., and Li, T. L. (2014) Multiple complexes of long aliphatic N-acyltransferases lead to synthesis of 2,6-diacylated/2-acyl-substituted glycopeptide antibiotics, effectively killing vancomycin-resistant enterococcus. J. Am. Chem. Soc. 136, 10989−10995. (51) Puk, O., Huber, P., Bischoff, D., Recktenwald, J., Jung, G., Süssmuth, R. D., van Pée, K. H., Wohlleben, W., and Pelzer, S. (2002) Glycopeptie biosynthesis in Amycolatopsis mediterranei DSM5908: function of a halogenase and a haloperoxidase/perhydrolase. Chem. Biol. 9, 225−235. (52) Wittmann, M., Linne, U., Pohlmann, V., and Marahiel, M. A. (2008) Role of DptE and DptF in the lipidation reaction of daptomycin. FEBS J. 275, 5343−5354. (53) Zhang, Z., Zhou, R., Sauder, J. M., Tonge, P. J., Burley, S. K., and Swaminathan, S. (2011) Structural and functional studies of fatty acyl adenylate ligases from E. coli and L. pneumophila. J. Mol. Biol. 406, 313− 324. (54) Miyazawa, T., Takahashi, S., Kawata, A., Panthee, S., Hayashi, T., Shimizu, T., Nogawa, T., and Osada, H. (2015) Identification of Middle Chain Fatty Acyl-CoA Ligase Responsible for the Biosynthesis of 2Alkylmalonyl-CoAs for Polyketide Extender Unit. J. Biol. Chem. 290, 26994−27011. (55) Lee, J. C., Park, H. R., Park, D. J., Son, K. H., Yoon, K. H., Kim, Y. B., and Kim, C. J. (2003) Production of teicoplanin by a mutant of Actinoplanes teicomyceticus. Biotechnol. Lett. 25, 537−540. (56) Claxton, H. B., Akey, D. L., Silver, M. K., Admiraal, S. J., and Smith, J. L. (2009) Structure and functional analysis of RifR, the Type II thioesterase from the rifamycin biosynthetic pathway. J. Biol. Chem. 284, 5021−5029. (57) Libertini, L. J., and Smith, S. (1978) Purification and properties of a thioesterase from lactating rat mammary gland which modifies the product specificity of fatty acid synthetase. J. Biol. Chem. 253, 1393− 1401. (58) Wang, Y.-Y., Ran, X.-X., Chen, W.-B., Zhang, X.-S., Guo, Y.-Y., Jiang, X.-H., Jiang, H., Li, Y.-Q., and Liu, S.-P. (2014) Characterization of type II thioesterases involved in natamycin biosynthesis in Streptomyces chattanoogensis L10. FEBS Lett. 588, 3259−3264. (59) Linne, U., Schwarzer, D., Schroeder, G. N., and Marahiel, M. (2004) Mutational analysis of a type II thioesterase associated with nonribosomal peptide synthesis. Eur. J. Biochem. 271, 1536−1545. (60) Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000) Practical Streptomyces Genetics, John Innes Foundation, Norwich, United Kingdom. (61) Beltrametti, F., Jovetic, S., Feroggio, M., Gastaldo, L., Selva, E., and Marinelli, F. (2004) Valine influences production and complex composition of glycopeptide antibiotic A40926 in fermentations of Nonomuraea sp. ATCC 39727. J. Antibiot. 57, 37−44.

2264


Characterization of the Post-Assembly Line ... - ACS Publications

Recommend Documents