Chemoenzymatic Synthesis and Antibody Detection of DNA

1314

Bioconjugate Chem. 2003, 14, 1314−1322

Chemoenzymatic Synthesis and Antibody Detection of DNA Glycoconjugates Yingli Wang and Terry L. Sheppard* Department of Chemistry and The Robert H. Lurie Comprehensive Cancer Center, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208-3113. Received August 20, 2003; Revised Manuscript Received October 14, 2003

A chemoenzymatic approach for the efficient synthesis of DNA-carbohydrate conjugates was developed and applied to an antibody-based strategy for the detection of DNA glycoconjugates. A phosphoramidite derivative of N-acetylglucosamine (GlcNAc) was synthesized and utilized to attach GlcNAc sugars to the 5′-terminus of DNA oligonucleotides by solid-phase DNA synthesis. The resulting GlcNAc-DNA conjugates were used as substrates for glycosyl transferase enzymes to synthesize DNA glycoconjugates. Treatment of GlcNAc-DNA with β-1,4-galactosyl transferase (GalT) and UDP-Gal produced N-acetyllactosamine-modified DNA (LacNAc-DNA), which could be converted quantitatively to the trisaccharide Lewis X (LeX)-DNA conjugate by R-1,3-fucosyltransferase VI (FucT) and GDP-Fuc. The facile enzymatic synthesis of LeX-DNA from GlcNAc-DNA also was accomplished in a one-pot reaction by the combined action of GalT and FucT. The resulting glycoconjugates were characterized by gel electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), and glycosidase digestion experiments. Covalent modification of the 5′-terminus of DNA with carbohydrates did not interfere with the ability of DNA glycoconjugates to hybridize with complementary DNA, as indicated by UV thermal denaturation analysis. The trisaccharide DNA glycoconjugate, LeX-DNA, was detected by a dual DNA hybridization/monoclonal antibody (mAb) detection protocol (“Southwestern”): membrane-immobilized LeX-DNA was visualized by Southern detection with a radiolabeled complementary DNA probe and by Western chemiluminescence detection with a mAb specific for the LeX antigen. The efficient chemoenzymatic synthesis of DNA glycoconjugates and the Southwestern detection protocol may facilitate the application of glycosylated DNA to cellular targeting and DNA glycoconjugate detection strategies.

INTRODUCTION

Cell surface glycoconjugates, composed of carbohydrates covalently linked to biomolecules such as lipids or proteins, are key elements in biological molecular recognition processes (1). Glycoconjugates have been implicated in cancer metastasis (2), immune response to pathogenic infection (3), and inflammation (4). For example, the Lewis X (LeX) blood group antigen (BGA) represents an important and well-characterized oligosaccharide in human biology (5). The LeX trisaccharide, Galβ1-4(FucR1-3)GlcNAc, and its BGA analogues are involved in the infection of human cells by parasites (6) and bacteria (7). LeX antigens also serve as tumor markers, since their presence appears to correlate with the metastatic potential of tumor cells (8). The readout and response to cell surface glycoconjugates are performed largely by specific carbohydrate binding proteins, called lectins (9). In addition to naturally occurring lectins, monoclonal antibodies (mAb’s) that bind specifically to oligosaccharide structures in glycoconjugates have been isolated. The availability of mAb’s specific to carbohydrate antigens has enhanced the understanding of the biological roles of glycoconjugates (10) and formed the basis for antibody-based detection methods for cellular glycosylation states (11, 12). Because of the specificity inherent in protein-carbohydrate interactions, syn* To whom correspondence should be addressed. Tel: 847-467-7636; Fax: 847-491-7713; E-mail: t-sheppard@ northwestern.edu.

thetic carbohydrate mimics (13), carbohydrate-anchored liposomes (14), and carbohydrate-modified dendrimers (15, 16) have been prepared to investigate carbohydratelectin interactions and drug development applications. In contrast to the abundance of glycosylated proteins and lipids in biological systems, few examples of glycosylated nucleic acids have been reported (17-19). An interesting counterexample was provided by Borst and co-workers, who discovered the existence of 5-(β-D-glucosylhydroxymethyl)-2′-deoxyuridine, the “J” nucleoside, in the DNA of Trypanosoma brucei (20) and other kinetoplastids (21). Although the biological role of the J-base remains under investigation, it has been implicated in gene expression regulation (22, 23). The discovery of glycosylated DNA and the importance of carbohydrates in cellular molecular recognition processes have spurred the design, synthesis, and evaluation of artificial DNA glycoconjugates that combine the desirable recognition properties of DNA and carbohydrates. Two main approaches for the conjugation of carbohydrate moieties to DNA recently have been developed: (1) incorporation of glycosylated phosphoramidite building blocks into DNA through solid-phase DNA synthesis (2428) and (2) postsynthetic glycosylation of a reactive site on synthetic or plasmid DNA (29-31). Despite the reported successes for decoration of DNA with carbohydrates, all current methods require laborious chemical synthesis of a carbohydrate derivative suitable for conjugation to DNA. Although synthesis of monosaccharide derivatives is relatively straightforward, the attachment

10.1021/bc034144p CCC: $25.00 © 2003 American Chemical Society Published on Web 11/19/2003

Synthesis and Detection of DNA Glycoconjugates Scheme 1. Chemoenzymatic Synthesis of DNA Glycoconjugates

Bioconjugate Chem., Vol. 14, No. 6, 2003 1315

DNA glycoconjugates to base pair with complementary DNA. In addition, the LeX-DNA offers a new orthogonal detection method for glycosylated DNA, the “Southwestern” detection, in which the oligonucleotide domain is detected by hybridization with a complementary labeled DNA probe, and the LeX-trisaccharide is specifically recognized by an anti-LeX mAb and coupled to a chemiluminescence detection scheme. EXPERIMENTAL PROCEDURES

of complex carbohydrates to DNA is hampered by the synthetic effort required to prepare the oligosaccharide portion with appropriate stereo- and regiochemical control. Chemoenzymatic synthesis was developed recently to streamline the synthesis of complex carbohydrates (32), glycopeptides (33), and glycopolymers (34). The approach involves the synthesis of a core carbohydrate that serves as a glycosyl acceptor for a glycosyl transferase enzyme. The glycosyl transferase, which utilizes a sugar-nucleotide donor, catalyzes the stereo- and regiospecific glycosylation of the acceptor sugar with the donor carbohydrate. The chemoenzymatic method was successfully employed for the synthesis of sialyl Lewis X (sLeX) BGA (35) and for conjugating sLeX antigens to glycoproteins (36, 37) and synthetic peptides (38). The chemoenzymatic method offers the advantages of enzymatic selectivity, rate acceleration, and compatibility with aqueous reaction media, while avoiding complex protection and deprotection strategies that are required for chemical synthesis of carbohydrates (32). Furthermore, the approach is quite general, provided that the glycosyltransferase enzymes with the desired carbohydrate specificity are available. Herein we describe a chemoenzymatic approach for the synthesis of DNA glycoconjugates that combines the advantages of chemical synthesis of glycosylated DNA with the efficiency and selectivity conferred by glycosyl transferase enzymes. Our approach is outlined in Scheme 1. We selected LeX-DNA as our initial chemoenzymatic target because of the important role of LeX antigens in several biological recognition events. In addition, its sialylated derivative (sLeX) was synthesized previously by both conventional synthetic organic approaches (39, 40) and chemoenzymatic methods (35). Finally, the LeX antigen offers the potential for lectin or antibody-based detection of the LeX-trisaccharide conjugated to DNA. As illustrated in Scheme 1, the target LeX-trisaccharide antigen is tethered to the 5′-end of the DNA oligonucleotide through organic spacers designed to ensure independent functioning of the carbohydrate and DNA portions of the hybrid molecule. We envisaged that LeXDNA would be derived from the sequential enzymatic glycosylation of a monosaccharide-derivatized, GlcNAcDNA. The GlcNAc-DNA would be obtained by coupling of the GlcNAc phosphoramidite (1) to the 5′-end of a DNA oligonucleotide during solid-phase DNA synthesis. We now report the successful chemoenzymatic synthesis of DNA glycoconjugates, according to Scheme 1, and describe the properties of these hybrid bioconjugates. Our studies show that glycosylation of the 5′-end of DNA oligonucleotides does not interfere with the ability of

General Procedures. All glassware was oven-dried (140 °C). Anhydrous reagents were supplied by Aldrich in Sure-Seal bottles. N2 was used as an inert atmosphere. All reagents were supplied by Aldrich and were used without further purification unless otherwise noted. Silica gel (40-63 µm, EM Science) was used for flash column chromatography. EM Science Kieselgel 60 F254 plates (0.25 mm) were used for analytical thin-layer chromatography (TLC). Compounds on TLC were visualized by staining with Verghn’s reagent (0.26 M ammonium molybdate, 6.0 mM ceric sulfate in 10% aqueous H2SO4) (41) followed by warming of the silica gel plate. 1H and 13C NMR spectra were recorded at 500 and 125 MHz, respectively, on a Varian 500 instrument, unless noted otherwise. Chemical shift values are reported in parts per million (ppm) in the following format: chemical shift (multiplicity, integration, coupling constant in Hertz, proton assignment). Proton assignments for 1H spectra were determined using 1H-1H NMR COSY data. 31P NMR data were recorded at 162 MHz on a Varian 400 spectrometer and were referenced to an external standard of 85% phosphoric acid. Mass spectral data for small molecules were obtained by FAB on a Micromass 70SE-4F spectrometer with 3-nitrobenzyl alcohol or glycerol as the matrix. T4 polynucleotide kinase was obtained from US Biochemical (USB). Terminal deoxytransferase was purchased from Promega. [R-32P]-dATP (3000 Ci/mmol) and [γ-32P]-ATP (7000 Ci/mmol) were purchased from ICN. Radioactive bands in polyacrylamide gels were visualized using a Molecular Dynamics Storm Phosphorimager and quantitated using Molecular Dynamics ImageQuant software. LeX-conjugated bovine serum albumin (LeX-BSA), bovine recombinant β-1,4galactosyltransferase expressed from Spodoptera frugiperda, human recombinant R-1,3-fucosyltransferase (VI) expressed from Spodoptera frugiperda, UDP-R-Dgalactose disodium salt, GDP-β-L-fucose disodium salt, anti-LeX (mouse, 32.7 µg/mL), and anti-mouse IgM (goat, peroxidase conjugate, 1 mg/mL) were purchased from Calbiochem. Zeta-probe GT membrane was purchased from Biorad. ECL PLUS western blotting detection kit was purchased from Amersham. Molecular biology grade 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) was purchased from Sigma. 6-Benzyloxyhexyl 2-Acetamido-3,4,6-tri-O-acetyl2-deoxy-β-D-glucopyranoside (3) (42). 1-Chloro-2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-R-D-glucopyranoside (43) (2) (1 g, 2.73 mmol) and 6-benzyloxyhexanol (44) (700 mg, 3.31 mmol) were dissolved in anhydrous CH2Cl2 (27 mL) under N2. AgOTf (912.3 mg, 3.55 mmol) was added, and the solution was stirred for 30 min at 25 °C in the dark. The reaction was filtered through a 1 cm Celite pad, and the pad was washed with EtOAc (200 mL). The filtrate was concentrated to 100 mL and washed consecutively with saturated aqueous NaHCO3 (30 mL), H2O (30 mL) and saturated aqueous NaCl (30 mL). The organic layer was dried over MgSO4, filtered, concentrated, and purified by flash chromatography (30% hexane/EtOAc) to yield 3 (392.6 mg, 27%). 1H NMR (CDCl3): δ 7.34 (m,

1316 Bioconjugate Chem., Vol. 14, No. 6, 2003

5H, Ar-H), 5.52 (d, 1H, JNH,2 ) 8.2 Hz, NHAc), 5.31 (dd, 1H, J3,4 ) 9.6 Hz, J3,2 ) 9.6 Hz, H3), 5.07 (dd, 1H, J4,3 ) 9.6 Hz, J4,5 ) 9.6 Hz, H4), 4.68 (d, 1H, J1,2 ) 8.8 Hz, H1), 4.50 (s, 2H, ArCH2), 4.27 (dd, 1H, J6,5 ) 4.5 Hz, J6,6′ ) 12.5 Hz, H6), 4.13 (dd, 1H, J6′,5 ) 1.5 Hz, J6′,6 ) 12.5 Hz, H6′), 3.87 (m, 1H, H5), 3.78 (m, 1H, H2), 3.69 (m, 1H, OCH2(CH2)5OBn), 3.46 (t, 2H, J ) 6.8 Hz, CH2OBn), 3.43 (m, 1H, OCH2(CH2)5OBn), 2.09 (s, 3H, AcO), 2.05(s, 3H, AcO), 2.03 (s, 3H, AcO), 1.93 (s, 3H, AcN), 1.60 (m, 4H, OCH2CH2(CH2)2CH2CH2OBn), 1.36 (m, 4H, O(CH2)2(CH2)2(CH2)2OBn). 13C NMR (CDCl3): δ 170.7, 170.6, 170.1, 169.3, 138.5, 128.3, 127.6, 127.5, 100.7, 73.0, 72.5, 71.8, 70.4, 69.9, 68.9, 62.3, 55.0, 29.9, 29.5, 26.1, 25.9, 23.5, 21.0, 21.0, 20.9. HRMS-FAB (m/z): [M + Na]+ calcd, 560.2472; found, 560.2473. 6-Hydroxyhexyl 2-Acetamido-3,4,6-tri-O-acetyl-2deoxy-β-D-glucopyranoside (4) (45). A solution of 3 (200 mg, 0.37 mmol) in 2 mL of 95% EtOH was stirred at RT under 250 psi H2 in the presence of 10% Pd/C (35 mg) for 72 h. The solution was filtered, concentrated, and purified by flash chromatography to yield 4 (163.1 mg, 98%). 1H NMR (CDCl3): δ 5.54 (d, 1H, J ) 8.5 Hz, NHAc), 5.30 (dd, 1H, J3,2 ) 10 Hz, J3,4 ) 10 Hz, H3), 5.08 (dd, 1H, J4,3 ) 10 Hz, J4,5 ) 10 Hz, H4), 4.68 (d, 1H, J1,2 ) 8.0 Hz, H1), 4.27 (dd, 1H, J6,5 ) 4.5 Hz, J6,6′ ) 12.5 Hz, H6), 4.13 (dd, 1H, J6′,5 ) 1.5 Hz, J6′,6 ) 12.5 Hz, H6′), 3.89 (m, 1H, H5), 3.83 (m, 1H, H2), 3.72 (m, 1H, OCH2(CH2)5OH), 3.65 (t, 2H, J ) 6.4 Hz, OCH2(CH2)4CH2OH), 3.49 (m, 1H, OCH2(CH2)5OH), 2.10 (s, 3H, AcO), 2.04 (s, 3H, AcO), 2.03 (s, 3H, AcO), 1.96 (s, 3H, AcN), 1.58 (m, 4H, OCH2CH2(CH2)2CH2 CH2OH), 1.38 (m, 4H, O(CH2)2(CH2)2(CH2)2OH). 13C NMR (CDCl3): δ 170.8, 170.7, 170.4, 169.4, 100.8, 72.5, 71.8, 69.8, 68.9, 62.7, 62.4, 54.8, 32.8, 29.4, 25.9, 25.6, 23.5, 21.1, 21.0, 20.9. HRMS-FAB (m/z): [M + Na]+ calcd, 470.2002; found, 470.2003. 6-O-(2-Cyanoethyl-N-N-diisopropylphosphoroamidityl)hexyl 2-Acetamido-3,4,6-tri-O-acetyl-2-deoxyβ-D-glucopyranoside (1). 2-Cyanoethyl-N,N-tetraisopropylphosphorodiamidite (92.4 µL, 0.29 mmol) was added to a solution of 4 (100 mg, 0.22 mmol) and diisopropylammonium tetrazolide (23 mg, 0.13 mmol) in anhydrous CH2Cl2 (5.5 mL) under N2. The reaction was stirred at 25 °C for 30 min and quenched by addition of CH2Cl2 (5.5 mL) and H2O (5.5 mL). The phases were separated, and the aqueous phase was back-extracted twice with CH2Cl2 (5.5 mL). The combined organic layers were washed consecutively with saturated aqueous NaHCO3 (2 × 11 mL), H2O (2 × 5.5 mL), and saturated aqueous NaCl (5.5 mL). The solution was dried over MgSO4, filtered, concentrated, and purified by flash chromatography (1% Et3N, 20% acetone/EtOAc) to yield 1 (111.1 mg, 77%). The final product was coevaporated with anhydrous acetonitrile and dried in vacuo for 12 h. Compound 1 was stored at -20 °C. 1H NMR (CD3CN): δ 6.39 (d, 1H, J ) 9.2 Hz, NHAc), 5.12 (t, 1H, J3,4 ) 10 Hz, H3), 4.92 (t, 1H, J4,3 ) 10 Hz, H4), 4.84 (d, 1H, J ) 8.0 Hz, H1), 4.21 (dd, 1H, J5,6 ) 4.0 Hz, J6,6′ ) 10.8 Hz, H6), 4.13 (dd, 1H, J6′,6 ) 10.8 Hz, H6′), 3.75 (m, 4H, H5, N[CH(CH3)2]2, OCH2CH2CN), 3.60 (m, 4H, H2, OCH2(CH2)5OP, OCH2(CH2)4CH2OP), 3.48 (m, 1H, OCH2(CH2)5OP), 2.16 (s, 3H, AcO), 2.13 (s, 3H, AcO), 2.01 (s, 3H, AcO), 1.80 (s, 3H, AcN), 1.58 (m, 4H, OCH2CH2(CH2)2CH2 CH2OH), 1.35 (m, 4H, O(CH2)2(CH2)2(CH2)2OH), 1.17 (t, 12H, J ) 6.5 Hz, N[CH(CH3)2]2). 13C NMR (CDCl3): δ 170.8, 170.5, 170.1, 170.0, 101.3, 73.3, 72.0, 70.2, 69.5, 64.1, 63.9, 62.7, 59.0, 58.8, 54.5, 43.6, 43.4, 31.8, 31.7, 29.9, 26.2, 26.1, 24.8, 24.7, 23.0, 20.9, 20.8, 20.8, 20.8,

Wang and Sheppard

20.7. 31P NMR (CD3CN): δ 147.549 (s, P-1). HRMS-FAB (m/z): [M + H]+ calcd, 648.3261; found, 648.3263. DNA Synthesis, Deprotection, and Purification. Unmodified DNA oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA), purified by 20% denaturing polyacrylamide gel electrophoresis (dPAGE), and characterized by MALDI-TOF MS. Carbohydrate-modified DNA oligonucleotides were synthesized by automated methods on a Pharmacia Gene Assembler at the 1.3 µmol scale. The triethyleneglycol phosphoramidite and natural nucleoside phosphoramidites, utilizing labile base protecting groups (Pac-dA-CE, Ac-dc-CE, iPr-Pac-dG-CE and dT-CE), were obtained from Glen Research (Sterling, VA). Phosphoramidite 1 was used at a concentration of 0.1 M in anhydrous CH3CN for DNA synthesis. After synthesis, the DNAcarbohydrate conjugates were deprotected in 28% ammonium hydroxide for 24 h at 37 °C. The ammonia solution was removed using a Speedvac concentrator, and the residue was redissolved in 200 µL of TE Buffer (10 mM Tris, 1 mM EDTA, pH 7.5) and combined with 200 µL of 2x gel loading buffer (2x GLB: 20% (v/v) sucrose, 0.1 M EDTA, 0.1% (w/v) SDS, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol, 16 M Urea). The DNA glycoconjugates were purified using 20% dPAGE (29:1 acrylamide:bisacrylamide, 8 M urea, 89 mM Tris, 89 mM borate, 1 mM Na2EDTA) with 1x TBE (89 mM Tris, 89 mM borate, 1 mM Na2EDTA) as a running buffer. DNA in gels was imaged by short-wave UV shadowing, excised with a flame-sterilized razor blade, and eluted from the gel pieces with crush and soak buffer (10 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA, pH 7.5) at 25 °C for 12 h. The eluent and the gel pieces were combined and filtered through a 0.2 µm filter. NaOAc (3 M, pH 5.2, 0.1x v:v) and ethanol (3.0x v:v) were added into the filtrate, and the precipitation solution was incubated at -20 °C for 2 h. The supernatant was removed, and the pellets were dried on a Speedvac concentrator, redissolved in 500 µL ddH2O, and desalted on a G-25 Sephadex column (NAP, Amersham). Purified DNA glycoconjugates were quantitated by UV absorption at 260 nm using extinction coefficients based on nearest-neighbors method (46). 3′-Radiolabeling of DNA Glycoconjugates. DNA glycoconjugate (∼100 pmol) was incubated at 37 °C for 45 min with 50 units of terminal deoxytransferase (TDT) in a 20 µL reaction containing 100 mM cacodylate pH 6.8, 0.1 mM DTT, 1 mM CoCl2, and 40 pmol [R-32P]-dATP. 2x GLB (20 µL) was added to the reaction, and the sample was purified by nondenaturing 20% PAGE (29:1 acrylamide:bisacrylamide, 89 mM Tris, 89 mM borate) with 1x TB (89 mM Tris, 89 mM borate) as running buffer. The gel was imaged onto film, and the band corresponding to radiolabeled DNA conjugate was excised with a flamesterilized razor blade. The DNA was removed from the gel slices by elution into 300 µL of ddH2O for 12 h at 4 °C. 5′-Radiolabeling of DNA Oligonucleotides. DNA oligonucleotide (100 pmol) was incubated at 37 °C for 40 min with 24.5 units of polynucleotide kinase (USB) in a 20 µL reaction containing 10 mM Tris-acetate, 10 mM magnesium acetate, 50 mM potassium acetate, and 24 pmol (8.4 Ci/µL) of [γ-32P]-ATP (7000 Ci/mmol). 2x GLB (25 µL) then was added to the reaction, and the sample was purified by nondenaturing 20% PAGE and isolated as described for 3′-radiolabeling. Synthesis of LacNAc-DNA by β-1,4-Galactosyltransferase-Catalyzed Glycosylation of GlcNAcDNA. GlcNAc-DNA (40 nmol) was incubated at 37 °C for 8 h with 0.1 unit of β-1,4-galactosyltransferase in a

Synthesis and Detection of DNA Glycoconjugates

60 µL solution containing 50 mM HEPES pH 7.5, 20 mM Mn(OAc)2, 0.5 mg/mL R-lactalbumin, and 0.13 mM GalUDP. 2x GLB (60 µL) was added to the reaction, and the sample was purified by nondenaturing 20% PAGE with 1x TB as the running buffer. The DNA glycoconjugates were imaged by short-wave UV shadowing, excised with a flame-sterilized razor blade, and retrieved from the gel pieces by soaking in 300 µL of ddH2O at 4 °C for 12 h. The purified DNA glycoconjugate was desalted by reverse phase HPLC (RP-HPLC). DNA Desalting by RP-HPLC. Gel purified DNA glycoconjugates were desalted by RP-HPLC on a Waters series 600 HPLC system using an XTerra reverse-phase C-18 column (3.5 µm, 4.6 mm × 50 mm). After injection of the oligonucleotide, a 30 min 100% water wash at 1 mL/min was used to elute buffer salts. The desalted DNA glycoconjugates then were eluted with 95% CH3CN/H2O. DNA-containing peaks (254 nm absorption) were collected and dried by lyophilization. Synthesis of LeX-DNA by r-1,3-Fucosyltransferase (VI)-Catalyzed Glycosylation of LacNAcDNA. LacNAc-DNA (40 nmol) was incubated at 37 °C for 8 h with 1.4 mU of R-1,3-fucosyltransferase (VI) in a 60 µL of solution containing 50 mM HEPES, pH 7.5, 20 mM Mn(OAc)2, 0.5 mg/mL R-lactalbumin, and 0.13 mM Fuc-GDP. 2x GLB (60 µL) was added to the reaction, and the sample was purified by a nondenaturing 20% PAGE with 1x TB as the running buffer. The glycoconjugates were recovered and desalted as described previously. Synthesis of LeX-DNA by r-1,3-Fucosyltransferase (VI)- and β-1,4-Galactosyltransferase-Catalyzed Glycosylation of GlcNAc-DNA. GlcNAc-DNA (40 nmol) was incubated at 37 °C for 8 h with 0.1 unit of β-1,4-galactosyltransferase and 1.4 mU of R-1,3-fucosyltransferase (VI) in a 60 µL solution containing 50 mM HEPES pH 7.5, 20 mM Mn(OAc)2, 0.5 mg/mL R-lactalbumin, 0.13 mM Fuc-GDP, and 0.13 mM Gal-UDP. 2x GLB (60 µL) was added to the reaction, and the sample was purified and isolated as described previously. MALDI-TOF MS. Mass spectral data for oligonucleotides were obtained on a PerSeptive Biosystems, Inc. (Foster City, CA), Voyager-DE PRO Biospectrometry Workstation MALDI-TOF mass spectrometer. An N2 laser was used (337 nm wavelength, 3 ns pulse). All spectra were acquired in the negative ion mode averaging 300 shots. Matrix for GlcNAc-DNA-1, LacNAc-DNA1, and LeX-DNA-1 was prepared by mixing 80 µL of a 0.2 M solution of 2,4,6-trihydroxyacetophenone in 1:1 CH3CN:H2O and 10 µL of 0.3 M aqueous ammonium citrate. Matrix for GlcNAc-DNA-2, LacNAc-DNA-2, and LeX-DNA-2 was prepared by mixing 20 µL of a 0.2 M solution of 2,4,6-trihydroxyacetophenone in 1:1 CH3CN:H2O, 10 µL of a 0.2 M solution of 2,3,4-trihydroxyacetophenone in 1:1 CH3CN:H2O, and 10 µL of 0.2 M aqueous ammonium citrate. Poly(dT)10, poly(dT)24 and poly(dT)37 were obtained from Integrated DNA Technologies and used for internal calibration. All observed masses were in agreement with calculated values (m/z): GlcNAc-DNA-1: calcd, 5084.39; found, 5084.15. LacNAc-DNA-1: calcd, 5246.53; found, 5247.15. LeXDNA-1: calcd, 5392.67; found, 5389.94. GlcNAc-DNA2: calcd, 9498.19; found, 9499.58. LacNAc-DNA-2: calcd, 9660.33; found, 9657.92. LeX-DNA-2: calcd, 9806.47; found, 9806.62. UV Thermal Denaturation Analysis. Thermal denaturation data were acquired on a Cary 500 spectrophotometer equipped with a multicuvette thermoelectric controller in 10 mm quartz cuvettes. Duplex oligonucleo-


tides were prepared from 2 µM of each strand in buffer consisting of 10 mM sodium phosphate, 0.1 mM EDTA, 150 mM NaCl, pH 7.0. Strands were annealed by heating to 95 °C for 15 min and cooling to 25 °C over 2 h. The samples were degassed under vacuum for 3 min prior to melting analysis. The absorbance was measured at 260 nm as the samples were heated from 25 °C to 98 °C at 0.5 °C/min. Melting temperatures (Tm) were determined from plots of dA260/dT vs T and are derived from replicate melting experiments using two independent samples. Membrane Blotting of DNA Glycoconjugates, DNA Oligonucleotides, and LeX-BSA. A wet Zetaprobe GT membrane was placed on top of a moist 3MM Whatman filter paper, and all air bubbles were removed. DNA glycoconjugates (50 pmol), standard DNA oligonucleotides (50 pmol), and LeX-BSA (50 pmol) were spotted on the membrane by pipetting. The membrane then was heated at 80 °C for 45 min and cooled to RT. Detection of DNA Glycoconjugates with Anti-LeX Antibody. Blotted membranes were incubated in 5% nonfat dry milk (NFDM) in TTBS (0.02 M Tris, 0.5 M NaCl, 0.05% Tween 20, pH 7.5) and shaken at 25 °C for 1 h to block nonspecific binding. The membrane was transferred to a solution of 5% NFDM/TTBS with antiLeX antibody (mouse, 65.4 ng/mL) and incubated at 25 °C for 1 h. The membrane was washed with 0.2% NFDM/ TTBS for 3 × 5 min and incubated in a solution of antimouse IgM (goat, HRP conjugate, 200 ng/mL) in 5% NFDM/TTBS at 25 °C for 1 h. The membrane was washed 3 times for 5 min each in 0.2% NFDM/TTBS, then for 15 min with TBS (0.02 M Tris base, 0.5 M NaCl, pH 7.5). The membrane was developed for 5 min using an ECL PLUS western blotting detection kit. The wet membrane was wrapped with plastic wrap and exposed to film (KODAK O-XMAT-LS). Detection of DNA Glycoconjugates with Radiolabeled Complementary DNA Probes. Blotted membranes were incubated in hybridization buffer (0.5 M phosphate buffer, 1 mM EDTA, 7% SDS, pH 7.2) at 65 °C for 30 min. The membrane was transferred to hybridization buffer containing radiolabeled (400 kcpm) complementary DNA oligonucleotide and incubated at 55 °C for 30 min. The membrane was washed consecutively with wash buffer I (40 mM phosphate, 1 mM EDTA, 5% SDS, pH 7.2) for 3 min at 55 °C, and wash buffer II (40 mM phosphate, 1 mM EDTA, 1% SDS, pH 7.2) for 3 min at 55 °C. The membrane was air-dried, wrapped with plastic, and imaged with a phosphor screen. RESULTS AND DISCUSSION

Synthesis of GlcNAc Phosphoramidite (1). The chemical component of the chemoenzymatic approach, outlined in Scheme 1, involved the synthesis of GlcNAc phosphoramidite (1) and preparation of GlcNAc-DNA. Our carbohydrate target (1) featured a GlcNAc sugar with a linker that originated at the glycosidic position of the sugar and terminated in a phosphoramidite group for use in standard solid-phase DNA synthesis. The glycosidic linker site was chosen for two major reasons. First, literature precedent (24, 47-49) suggested that stereocontrolled incorporation of linker groups at glycosidic sites would be accessible by standard glycosylation methods. Second, since our enzymatic approach relied on the availability of unmodified sugar hydroxyls for optimal activity of the glycosyl transferases, attachment of DNA to the nonreducing end of the glycoconjugate offered considerable advantages. The GlcNAc phosphoramidite (1) was prepared using the route detailed in Scheme 2. The anomeric chloride


Wang and Sheppard

Scheme 2. Synthesis of GlcNAc Phosphoramidite Derivative 1

Scheme 3. Chemoenzymatic Synthesis of LeX-DNA

starting material (2) was synthesized from D-glucosamine in 76% yield as described (43). The known monobenzyl ether of 1,6-hexanediol (44) was glycosylated with GlcNAc donor 2 in the presence of silver triflate to form 6-benzyloxyhexyl 2-acetamido-3,4,6-tri-O-acetyl -2-deoxy-β-Dglucopyranoside (3) (24). The anomeric configuration for 3 was confirmed as β, based on the inferred trans diaxial orientation of H1 and H2 by 1H NMR experiments (J1,2 ) 8.8 Hz). Isomeric structures (such as ortho ester) were ruled out by 13C NMR chemical shift analysis. The benzyl group was removed from 3 by hydrogenolysis (50) using Pd/C catalyst to provide alcohol 4 in 98% yield. Finally, the protected GlcNAc derivative 4 was converted to the phosphoramidite target (1) by standard methods (51). All synthetic intermediates were characterized by 1H and 13C NMR and HRMS-FAB MS. Phosphoramidite 1 also was characterized by 31P NMR. Synthesis of GlcNAc-DNA Glycoconjugates. The GlcNAc phosphoramidite (1) was used for the synthesis of GlcNAc-modified oligonucleotides by solid-phase DNA synthesis. Two sequences were synthesized, GlcNAcDNA-1 and GlcNAc-DNA-2, as shown in Scheme 3. A water-soluble and biologically compatible triethylene glycol linker was inserted between GlcNAc and the DNA sequence to prevent steric interference between the carbohydrate and the DNA oligonucleotide. After synthesis, oligonucleotides were deprotected in 28% aqueous ammonia for 24 h at 37 °C, which also removed the O-acetyl protecting groups from the GlcNAc precursor. The coupling yield of 1 during DNA synthesis could not be determined directly by standard assays, due to the

Figure 1. Stepwise enzymatic synthesis of LeX-DNA-1. (A) Galactosyl transfer to GlcNAc-DNA-1. Lane 1: GlcNAcDNA-1; lanes 2-5: GalT-catalyzed glycosylation of GlcNAcDNA-1 for 30 s, 1, 2, and 3 min; (B) Fucosyl transfer to LacNAc-DNA-1. Lane 1: LacNAc-DNA-1; lanes 2-5: FucTcatalyzed glycosylation of LacNAc-DNA-1 for 30 s, 1, 2, and 3 min.

lack of a dimethoxytrityl protecting group. However, in all cases, only one DNA product was observed during the gel electrophoresis purification of GlcNAc-DNA, indicating that the coupling efficiency of 1 was comparable to that of the natural nucleotides (>90%). GlcNAc-DNA was further characterized by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). The DNA glycoconjugates gave the expected masses: GlcNAc-DNA-1, [M]- calcd, 5084.39; found, 5084.15; GlcNAc-DNA-2, [M]- calcd, 9498.19; found, 9499.58. Enzymatic Synthesis and Characterization of DNA Glycoconjugates. The enzymatic conversion of GlcNAc-DNA into LeX-DNA, described in Scheme 3, proceeds by two sequential glycosyl transfer reactions: β-1,4-galactosyltransferase (GalT) catalyzed conversion of GlcNAc-DNA to LacNAc-DNA and R-1,3-fucosyltransferase VI (FucT) mediated transformation of LacNAc-DNA to LeX-DNA. We envisaged two possible reaction sequences for the enzymatic synthesis of LeXDNA from GlcNAc-DNA. The first was a stepwise route, in which LacNAc-DNA would be synthesized using GalT, and the disaccharide-DNA hybrid would be isolated and utilized in a FucT-catalyzed step to synthesize LeX-DNA. The sequence of these two reaction steps could not be exchanged because the substrate of FucT is LacNAc-DNA (52). A second approach, commonly used for the chemoenzymatic synthesis of glycosylated peptides and proteins (32), was a one-pot, two-step reaction sequence in which the two enzymes were incubated simultaneously with UDP-Gal, GDP-Fuc, and the GlcNAc-DNA substrate. In this approach, LacNAcDNA, produced by the GalT reaction, would be glycosylated in situ by FucT to provide LeX-DNA. Both approaches proved successful for the enzymatic synthesis of LeX-DNA from GlcNAc-DNA. The synthesis of LacNAc-DNA and LeX-DNA by stepwise action of GalT and FucT is detailed in Figure 1 for DNA glycoconjugates based on sequence DNA-1 (Scheme 3). Enzymatic glycosylation reactions were performed on GlcNAc-DNA-1 that had been labeled at its 3′-end with a 32P tracer, and were assayed by denaturing polyacrylamide gel electrophoresis (dPAGE). Figure 1A illustrates the time course for the conversion of GlcNAc-DNA-1 (0.1 µM) to LacNAc-DNA-1 at 37 °C (50 mM HEPES pH 7.5, 20 mM Mn(OAc)2, 0.5 mg/ mL R-lactalbumin, 2.5 µM Gal-UDP, and 25 units/µL


Figure 2. One-pot enzymatic synthesis of LeX-DNA-1. Lane 1: GlcNAc-DNA-1; lanes 2-5: GalT-catalyzed glycosylation of GlcNAc-DNA-1 for 15 s, 45 s, 1 min, 10 min; lane 6: GlcNAc-DNA-1; lanes 7-10: GalT- and FucT-catalyzed onepot glycosylation of GlcNAc-DNA-1 for 15 s, 45 s, 1 min, 10 min.

GalT). Under these conditions, GlcNAc-DNA-1 (lane 1) was transformed to a product with lower gel mobility (lanes 2-5). More than 50% of GlcNAc-DNA-1 was converted to product in the first 30 s (lane 2), and the GalT-dependent reaction was >90% complete within 3 min (lanes 3-5). The product (top band, lanes 2-5) showed a mobility shift corresponding to an increase in molecular weight, which was consistent with the synthesis of LacNAc-DNA-1. To verify the identity of the lower mobility product, a preparative scale (40 nmole) GalT reaction was performed on unlabeled GlcNAcDNA-1 to provide adequate material for further characterization. The product was purified by nondenaturing PAGE, desalted by RP-HPLC, and analyzed by MALDITOF MS. The isolated product gave the expected mass for LacNAc-DNA-1: [M]- calcd, 5246.53; found, 5247.15. Purified LacNAc-DNA-1, which had been synthesized by enzymatic galactosyl transfer, was utilized as a substrate for the FucT-mediated conversion to LeXDNA-1. The reaction mixture (0.1 µM 3′-labeled LacNAc-DNA-1, 50 mM HEPES, 20 mM Mn(OAc)2, 0.5 mg/ mL R-lactalbumin, 2.5 µM Fuc-GDP, and 0.35 units/µL FucT) was incubated at 37 °C. Reaction aliquots were removed at specific intervals across 30 s-3 min and analyzed by dPAGE. The results are shown in Figure 1B. The FucT reaction led to a fucosylated DNA product shown by a lower gel mobility band (top band, lanes 2-5), compared with LacNAc-DNA-1 (lane 1). The reaction proceeded efficiently and was >90% complete in less than 3 min (lane 5). To demonstrate that the product of the FucT reaction was indeed LeX-DNA-1, a preparative scale (40 nmole) enzymatic fucosylation reaction was performed. The product was purified by nondenaturing PAGE/RP-HPLC and characterized by MALDI-TOF MS. As was the case for the GalT chemistry, the FucT reaction led to the expected product: LeX-DNA-1 ([M]- calcd, 5392.67; found, 5389.94). Having demonstrated the efficient stepwise synthesis of LeX-DNA-1 from GlcNAc-DNA-1, we examined the potential for one-pot assembly of LeX-DNA by tandem action of GalT and FucT. The time course of the one-pot reaction was analyzed by dPAGE. The left panel of Figure 2 (lanes 1-5) demonstrates the stepwise conversion of GlcNAc-DNA-1 to LacNAcDNA-1, which serves as a control for the one-pot reaction. The results of the one-pot tandem reaction are shown in the right panel of Figure 2 (lanes 6-10). Based on gel mobility shifts, the GlcNAc-DNA-1 starting material (lane 6) was first transformed to LacNAc-DNA-1 (lane 7). The resulting LacNAc-DNA-1 underwent further conversion to LeX-DNA-1 (lanes 8-10). The one-pot reaction led to complete conversion of GlcNAc-DNA-1 to LeX-DNA-1 within minutes. Consistent with the substrate specificity of FucT (52), incubation of GlcNAcDNA with FucT produced no new products.


To assess the generality of enzymatic glycosylation of chemically synthesized DNA glycoconjugates, the GalT and FucT experiments were repeated for GlcNAc conjugated to a second DNA sequence (GlcNAc-DNA-2). LacNAc-DNA-2, obtained from a GalT reaction, and LeX-DNA-2, derived from a one-pot tandem reaction of GlcNAc-DNA-2 with GalT and FucT, showed gel shift profiles (Supporting Information) similar to those observed for the DNA-1 glycoconjugates (Figure 2). Preparative enzymatic glycosylations of GlcNAc-DNA-2 produced DNA glycoconjugates that gave the expected masses by MALDI-TOF MS: LacNAc-DNA-2 ([M]calcd, 9660.33; found, 9657.92); LeX-DNA-2, ([M]- calcd, 9806.47; found, 9806.62). Characterization of DNA Glycoconjugates by Glycosidase Digestion. To further characterize the identity and specificity of glycosyl transfer reactions of DNA glycoconjugates, “on target” enzymatic digestion experiments (53) were performed. In this approach, DNA glycoconjugates were subjected to digestion by specific glycosidase enzymes on MALDI-TOF MS sample preparation plates. MALDI-TOF mass spectra were obtained for the DNA glycoconjugates before and after digestion with an exoglycosidase specific for a terminal sugar. Successful digestion of the terminal glycosidic bond would reveal the precursor DNA glycoconjugate by MALDI-TOF MS and validate the regiochemistry and stereochemistry of the glycosyl transfer reaction. For compatibility with the MALDI-TOF MS conditions, ammonium acetate (25 mM) was used as the digestion buffer. The on-target digestion of GlcNAc-DNA-1 was carried out with β-Nacetylglucosaminidase, which specifically cleaves β-linked GlcNAc residues. Incubation of GlcNAc-DNA-1 at 37 °C for 26 h and subsequent MALDI-TOF MS analysis showed conversion of GlcNAc-DNA-1 to the DNA-1 glycol linker conjugate (Supporting Information). The conversion of GlcNAc-DNA-1 to the parent DNA-1 structure validates the β-stereochemistry of GlcNAc attachment to the linker. The on-target digestion of LacNAc-DNA-1 with β-1,4-galactosidase was performed at 37 °C for 14 h. The post-digestion MALDI-TOF MS revealed a peak with the same m/z as GlcNAc-DNA-1, which indicated that the galactose residue was attached to the 4-position of the GlcNAc sugar with β-stereochemistry. Taken together, “on target digestion” of DNA glycoconjugates supports our previous assignments of the identities of GlcNAc-DNA and LacNAc-DNA. Duplex Stability of DNA Glycoconjugates. Applications of DNA glycoconjugates that take advantage of DNA’s coding potential require that DNA glycosylation does not interfere with the base pairing properties of DNA. To assess the effect of carbohydrate modifications on DNA duplex stability, UV thermal denaturation analysis was undertaken with DNA duplexes containing GlcNAc-DNA, LacNAc-DNA, and LeX-DNA strands. The glycosylated DNA sequences were annealed with a complementary DNA strand (DNA-1′, Figure 3) at 95 °C for 15 min and cooled to RT over 2 h in a solution containing 2 µM of each single strand, 10 mM phosphate buffer, 0.1 mM EDTA and 150 mM NaCl at pH 7.0. For comparison, unmodified DNA-1 was annealed with DNA1′ under identical conditions. As demonstrated in Figure 3, UV thermal denaturation analysis of the unmodified DNA-1/DNA-1′ (solid squares) duplex showed a cooperative denaturation profile, with a melting temperature (Tm) of 63 °C. The duplexes comprised of DNA-1 glycoconjugates with DNA-1′ (open symbols, Figure 3) showed no significant destabilization of the duplex due to the carbohydrate modifications (Tm 63-65 °C). Similarly,


Figure 3. Thermal denaturation analysis of DNA-1 glycoconjugates. Conditions: 2 µM each single strand, 10 mM sodium phosphate, 0.1 mM EDTA, 150 mM NaCl, pH 7.0. Heating rate: 0.5 °C/min. DNA-1′: 5′ CGGTCGGCGAAGATG 3′. Legend: Solid squares: DNA-1/DNA-1′; Open circles: GlcNAcDNA-1/DNA-1′; Open triangles: LacNAc-DNA-1/DNA-1′; Inverted triangles: LeX-DNA-1/DNA-1′.

thermal denaturation analysis of duplexes composed of DNA-2 glycoconjugates and DNA-2′ under the same conditions showed that carbohydrate modification leads to a small decrease in the cooperativity of the DNA melting transition, but the duplex thermal stability was relatively unperturbed (Supporting Information). Southwestern Detection of LeX-DNA. DNA glyconjugates represent bioconjugates that possess the properties of both DNA and carbohydrates. Because of the central importance of these two classes of biomolecules, numerous approaches for the detection of DNA or glycoconjugates have been developed. Hybridization assays such as the Southern blot (54), in which a radiolabeled complementary nucleic acid probe binds specifically to a target DNA sequence, have been invaluable for DNA detection. In glycobiology, mAb’s have been used to detect the presence of specific carbohydrate antigens (55, 56). Much in the same way that mAb’s are used to detect proteins in “Western blots,” carbohydrate detection by antibodies involves readout of a primary mAb-carbohydrate binding event by a secondary labeled antibody. DNA glycoconjugates, by virtue of their carbohydrate and nucleic acid characteristics, offer a platform for orthogonal detection of either biomolecular component. To assess the feasibility of a combined “Southwestern” detection approach for DNA glycoconjugates, the LeX-DNA hybrid was used as a model system for antibody detection. DNA glycoconjugates were bound to nylon membranes and probed either with an antibody specific for the LeX trisaccharide or with a radiolabeled DNA probe complementary to the sequence of the DNA glycoconjugate. An assay for the antibody-based detection of LeX antigens was developed using two types of antibodies: (1) a primary anti-LeX antibody (derived from mouse), which interacts specifically with the LeX antigen, and (2) a secondary anti-mouse antibody (derived from goat), which was conjugated to horseradish peroxidase (HRP). Binding of the secondary antibody to the primary antibodyLeX complex would localize HRP to membrane spots bearing LeX antigens. Membranes then would be visualized using a HRP-catalyzed chemiluminescence assay. To demonstrate the antibody-based detection strategy, DNA glycoconjugates were spotted on a membrane (see Figure

Wang and Sheppard

Figure 4. Southwestern detection of DNA glycoconjugates. (A) Anti-LeX detection by chemiluminescence using anti-LeX antibody and (B) DNA detection using radiolabeled complementary DNA strands. Spot 1: LeX-BSA; spot 2: unmodified DNA-1; spot 3: GlcNAc-DNA-1; spot 4: LacNAc-DNA-1; spot 5: LeX-DNA-1; spot 6: LeX-BSA; spot 7: unmodified DNA-2; spot 8: GlcNAc-DNA-2; spot 9: LacNAc-DNA-2; spot10: LeX-DNA-2. DNA-1′: 5′ CGGTCGGCGAAGATG 3′; DNA-2′: 5′ CAAATCTTTGTCCCCGGTCGGCGAAGATG 3′.

4). A membrane was prepared for each DNA sequence (Figure 4, DNA-1, left panels; DNA-2, right panels). For each DNA series, unmodified DNA (spots 2 and 7), GlcNAc-DNA (spots 3 and 8), LacNAc-DNA (spots 4 and 9) and LeX-DNA (spots 5 and 10) were spotted on a Zeta-probe GT membrane. Figure 4A demonstrates the results of antibody detection of LeX antigens. As a positive control, LeX-conjugated bovine serum albumin protein (LeX-BSA) was spotted on each membrane (spots 1 and 6). As expected, spots containing materials with LeX trisaccharides, LeX-BSA (spots 1 and 6, Figure 4A) and LeX-DNA (spots 5 and 10, Figure 4A) were detected by chemiluminescence with the anti-LeX antibody. In contrast, unmodified DNA (spots 2 and 7) and glycosylated DNA that lacked the LeX antigen, GlcNAc-DNA (spots 3 and 8) and LacNAc-DNA (spots 4 and 9), were not detected by the antibody specific for LeX recognition (Figure 4A). To assess whether the same membrane spots could be visualized by nucleic acid hybridization, a Southern detection experiment was performed. The membranes from Figure 4A were stripped to remove antibody and subsequently probed with radiolabeled complementary DNA strands. Due to the pairing properties of DNA glycoconjugates, it was expected that all spots containing nucleic acid would be visualized by phosphorimager analysis of bound probe. As demonstrated in Figure 4B, spots 2-5, which contained DNA-1, and spots 7-9, which contained DNA-2, gave strong signals in the presence of complementary DNA probe. In contrast, spots containing only protein and carbohydrate (LeX-BSA, spots 1 and 6, Figure 4B) produced no signals, because the protein cannot hybridize with radiolabeled DNA strands. The combined Southwestern detection of DNA glycoconjugates further validated the identity of the DNA glycoconjugate synthesized by the chemoenzymatic approach: sequence-specific DNA binding and LeX-specific antibody recognition were observed in the presence of the target, in both cases. Furthermore, the orthogonal blotting approach of DNA glycoconjugates by radiolabeled complementary strands or anti-LeX antibodies suggests that the DNA and the carbohydrate components of DNA glycoconjugates function independently. These studies demonstrate the potential for detection of specific DNA glycoconjugates by standard glycobiology and molecular biology methods. Our future plans for DNA glycoconjugates synthesized by chemoenzymatic methods include nucleic acid delivery, targeting and DNA imaging. One direction includes


the application of chemoenzymatic synthesis of DNA glycoconjugates to antisense oligonucleotide delivery strategies. Specifically, antisense DNA oligonucleotides conjugated to cell-type specific antigens will be used for the selective targeting of DNA to cancer cells. Second, in combination with targeting, it may be possible to adapt our chemoenzymatic method to facilitate cellular uptake of DNA. Finally, the utility of the antibody-based DNA detection approach will be explored as an alternative to standard DNA detection strategies and applied toward the visualization of DNA compartmentalization in cells. In conclusion, a new chemoenzymatic approach to the synthesis of DNA glycoconjugates was developed. GlcNAc-DNA was synthesized by solid-phase DNA synthesis using GlcNAc phosphoramidite derivative 1. Oligosaccharide structures, such as LacNAc or LeX, were elaborated on the GlcNAc-DNA core by stepwise or onepot glycosyl transferase enzyme reactions. The combination of chemical synthesis with the efficiency and specificity of enzymatic synthesis may allow for the rapid preparation of complex DNA glycoconjugates of biochemical or therapeutic interest. For example, it may be possible to extend the methodology to the synthesis of sLeX-DNA, in which the biologically important sLeX antigen (4, 35) would be synthesized from a simple DNA glycoconjugate. Alternatively, the approach may be applied to the synthesis of cell-specific carbohydrate antigens that may be used to target cellular delivery or uptake of DNA or antisense nucleic acid molecules (57). Finally, the combination of these chemoenzymatic methods with the demonstrated orthogonal DNA glycoconjugate detection approach may offer potential for in situ detection of these hybrid biomaterials for biochemical experiments or under cellular conditions. ACKNOWLEDGMENT

This research was supported by a National Cancer Institute SPORE in Prostate Cancer Career Development Award to T.L.S., administered through The Robert H. Lurie Comprehensive Cancer Center of Northwestern University. The MALDI-TOF MS instrument was purchased with funds provided by a NIH Scientific Instrumentation grant (1-S10-RR13810). We acknowledge the use of instruments in the Keck Biophysics Facility at Northwestern University. Supporting Information Available: Characterization data for 1, mass spectrometric data for modified oligonucleotides, glycosylation assays, “on target” enzymatic digestion assays, and melting curve data. This material is available free of charge via the Internet at http:// pubs.acs.org/BC. LITERATURE CITED (1) Dwek, R. A. (1996) Glycobiology: Toward understanding the function of sugars. Chem. Rev. 96, 683-720. (2) Gorelik, E., Galili, U., and Raz, A. (2002) On the role of cell surface carbohydrates and their binding proteins (lectins) in tumor metastasis. Cancer Metastasis Rev. 20, 245-277. (3) Ritchie, G. E., Moffatt, B. E., Sim, R. B., Morgan, B. P., Dwek, R. A., and Rudd, P. M. (2002) Glycosylation and the complement system. Chem. Rev. 102, 305-319. (4) McEver, R. P. (1997) Selectin-carbohydrate interactions during inflammation and metastasis. Glycoconjugate J. 14, 585-591. (5) Feizi, T. (1997) Carbohydrate differentiation antigens Ii, SSEA-1 (Lex) and related structures. New Compr. Biochem. 29b, 571-586. (6) Cummings, R. D., and Nyame, A. K. (1996) Glycobiology of schistosomiasis. FASEB J. 10, 838-848.

Bioconjugate Chem., Vol. 14, No. 6, 2003 1321 (7) Edwards, N. J., Monteiro, M. A., Faller, G., Walsh, E. J., Moran, A. P., Roberts, I. S., and High, N. J. (2000) Lewis X structures in the O antigen side-chain promote adhesion of Helicobacter pylori to the gastric epithelium. Mol. Microbiol. 35, 1530-1539. (8) Garratty, G. (1995) Blood group antigens as tumor markers, parasitic/bacterial/viral receptors, and their association with immunologically important proteins. Immunol. Invest. 24, 213-232. (9) Lis, H., and Sharon, N. (1998) Lectins: Carbohydratespecific proteins that mediate cellular recognition. Chem. Rev. 98, 637-674. (10) Singhal, A., and Hakomori, S. (1990) Molecular changes in carbohydrate antigens associated with cancer. BioEssays 12, 223-230. (11) Van Dam, G. J., Bergwerff, A. A., Thomas-Oates, J. E., Rotmans, J. P., Kamerling, J. P., Vliegenthart, J. F. G., and Deelder, A. M. (1994) The immunologically reactive O-linked polysaccharide chains derived from circulating cathodic antigen isolated from the human blood fluke Schistosoma mansoni have Lewis x as repeating unit. Eur. J. Biochem. 225, 467-482. (12) Pan, J., Yeger, H., and Cutz, E. (2002) Neuronal developmental marker FORSE-1 identifies a putative progenitor of the pulmonary neuroendocrine cell lineage during lung development. J. Histochem. Cytochem. 50, 1567-1578. (13) Sears, P., and Wong, C.-H. (1999) Carbohydrate mimetics: a new strategy for tackling the problem of carbohydratemediated biological recognition. Angew. Chem., Int. Ed. 38, 2301-2324. (14) Sihorkar, V., and Vyas, S. P. (2001) Potential of polysaccharide anchored liposomes in drug delivery, targeting and immunization. J. Pharm. Pharmaceut. Sci. 4, 138-158. (15) Cloninger, M. J. (2002) Biological applications of dendrimers. Curr. Opin. Chem. Biol. 6, 742-748. (16) Stiriba, S.-E., Frey, H., and Haag, R. (2002) Dendritic polymers in biomedical applications: From potential to clinical use in diagnostics and therapy. Angew. Chem., Int. Ed. 41, 1329-1334. (17) Lichtenstein, J., and Cohen, S. S. (1960) Nucleotides derived from enzymatic digests of nucleic acids of T2, T4, and T6 bacteriophages. J. Biol. Chem. 235, 1134-1141. (18) Lehman, I. R., and Pratt, E. A. (1960) On the structure of the glucosylated hydroxymethylcytosine nucleotides of coliphages T2, T4, and T6. J. Biol. Chem. 235, 3254-3259. (19) Ehrlich, M., and Ehrlich, K. C. (1981) A novel, highly modified, bacteriophage DNA in which thymine is partly replaced by a phosphoglucuronate moiety covalently bound to 5-(4′, 5′-dihydroxypentyl)uracil. J. Biol. Chem. 256, 99669972. (20) Gommers-Ampt, J. H., Vanleeuwen, F., Debeer, A. L. J., Vliegenthart, J. F. G., Dizdaroglu, M., Kowalak, J. A., Crain, P. F., and Borst, P. (1993) β-D-Glucosyl-hydroxymethyluracil - a novel modified base present in the DNA of the parasitic protozoan trypanosoma-brucei. Cell 75, 1129-1136. (21) van Leeuwen, F., Taylor, M. C., Mondragon, A., Moreau, H., Gibson, W., Kieft, R., and Borst, P. (1998) β-D-glucosylhydroxymethyluracil is a conserved DNA modification in kinetoplastid protozoans and is abundant in their telomeres. Proc. Natl. Acad. Sci. U.S.A. 95, 2366-2371. (22) Borst, P., and van Leeuwen, F. (1997) β-D-Glucosylhydroxymethyluracil, a novel base in African trypanosomes and other Kinetoplastida. Mol. Biochem. Parasitol. 90, 1-8. (23) van Leeuwen, F., Kieft, R., Cross, M., and Borst, P. (2000) Tandemly repeated DNA is a target for the partial replacement of thymine by β-D-glucosyl-hydroxymethyluracil in Trypanosoma brucei. Mol. Biochem. Parasitol. 109, 133-145. (24) Akhtar, S., Routledge, A., Patel, R., and Gardiner, J. M. (1995) Synthesis of monomannoside and dimannoside phosphoramidite derivatives for solid-phase conjugation to oligonucleotides. Tetrahedron Lett. 36, 7333-7336. (25) de Kort, M., Ebrahimi, E., Wijsman, E. R., van der Marel, G. A., and van Boom, J. H. (1999) Synthesis of oligodeoxynucleotides containing 5-(β-D-glycopyranosyloxymethyl)-2′deoxyuridine, a modified nucleoside in the DNA of Trypanosoma brucei. Eur. J. Org. Chem., 2337-2344.

1322 Bioconjugate Chem., Vol. 14, No. 6, 2003 (26) Sheppard, T. L., Wong, C. H., and Joyce, G. F. (2000) Nucleoglycoconjugates: Design and synthesis of a new class of DNA-carbohydrate conjugates. Angew. Chem., Int. Ed. 39, 3660-3663. (27) Matsuura, K., Hibino, M., Yamada, Y., and Kobayashi, K. (2001) Construction of glyco-clusters by self-organization of site-specifically glycosylated oligonucleotides and their cooperative amplification of lectin-recognition. J. Am. Chem. Soc. 123, 357-358. (28) Dubber, M., and Frechet, J. M. J. (2003) Solid-phase synthesis of multivalent glycoconjugates on a DNA synthesizer. Bioconjugate Chem. 14, 239-246. (29) Matsuura, K., Akasaka, T., Hibino, M., and Kobayashi, K. (2000) Facile synthesis of stable and lectin-recognizable DNAcarbohydrate conjugates via diazo coupling. Bioconjugate Chem. 11, 202-211. (30) Dey, S., and Sheppard, T. L. (2001) Ketone-DNA: A versatile postsynthetic DNA decoration platform. Org. Lett. 3, 3983-3986. (31) Charles, I., Xue, L. A., and Arya, D. P. (2002) Synthesis of aminoglycoside-DNA conjugates. Bioorg. Med. Chem. Lett. 12, 1259-1262. (32) Koeller, K. M., and Wong, C. H. (2000) Synthesis of complex carbohydrates and glycoconjugates: Enzyme-based and programmable one-pot strategies. Chem. Rev. 100, 4465-4493. (33) Davis, B. G. (2002) Synthesis of glycoproteins. Chem. Rev. 102, 579-601. (34) Flitsch, S. L. (2000) Chemical and enzymatic synthesis of glycopolymers. Curr. Opin. Chem. Biol. 4, 619-625. (35) Ichikawa, Y., Lin, Y. C., Dumas, D. P., Shen, G. J., Garciajunceda, E., Williams, M. A., Bayer, R., Ketcham, C., Walker, L. E., Paulson, J. C., and Wong, C. H. (1992) Chemical-enzymatic synthesis and conformational-analysis of sialyl lewis-X and derivatives. J. Am. Chem. Soc. 114, 9283-9298. (36) Seitz, O., and Wong, C. H. (1997) Chemoenzymatic solution- and solid-phase synthesis of O-glycopeptides of the mucin domain of MAdCAM-1. A general route to O-LacNAc, O-sialyl-LacNAc, and O-sialyl-Lewis-X peptides. J. Am. Chem. Soc. 119, 8766-8776. (37) Halcomb, R. L., Huang, H. M., and Wong, C. H. (1994) Solution-phase and solid-phase synthesis of inhibitors of Helicobacter-pylori attachment and E-selectin-mediated leukocyte adhesion. J. Am. Chem. Soc. 116, 11315-11322. (38) Matsuda, M. (2001) Heterobifunctional ligands: Practical chemoenzymatic synthesis of a cell adhesive glycopeptide that interacts with both selectins and integrins. J. Med. Chem. 44, 715-724. (39) Danishefsky, S. J., Koseki, K., Griffith, D. A., Gervay, J., Peterson, J. M., McDonald, F. E., and Oriyama, T. (1992) Azaglycosylation of complex stannyl alkoxides with glycalderived iodo sulfonamides: a straightforward synthesis of sialyl-Lewis X antigen and other oligosaccharide domains. J. Am. Chem. Soc. 114, 8331-8333. (40) Danishefsky, S. J., Gervay, J., Peterson, J. M., McDonald, F. E., Koseki, K., Oriyama, T., Griffith, D. A., Wong, C. H., and Dumas, D. P. (1992) Remarkable regioselectivity in the chemical glycosylation of glycal acceptors: a concise solution to the synthesis of sialyl-Lewis X glycal. J. Am. Chem. Soc. 114, 8329-8331. (41) Corey, E. J., and Roberts, B. E. (1997) Total synthesis of dysidiolide. J. Am. Chem. Soc. 119, 12425-12431. (42) Pochet, S., Kansal, V., Destouesse, F., and Sarfati, S. R. (1990) Alkylglycoside carbonates of 3′-azido-3′-deoxythymidine. Tetrahedron Lett. 31, 6021-6024.

Wang and Sheppard (43) Horton, D. (1973) 2-Acetamido-3,4,6-tri-O-acetyl-2-deoxyR-D-glucopyranosyl chloride. Organic Synthesis, pp 1-5, Wiley, New York. (44) Bouzide, A., and Sauve, G. (1997) Highly selective silver(I) oxide mediated monoprotection of symmetrical diols. Tetrahedron Lett. 38, 5945-5948. (45) Zemlyakov, A. E., Kakayan, E. S., and Chirva, V. Y. (1989) Synthesis of β-(ω-aminoalkyl)glycosides of N-acetylmuramoylL-alanyl-D-isoglutamine. Bioorg. Khim. 15, 1527-1533. (46) Richards, E. G. (1975) Use of tables in calculation of absorption, optical rotatory dispersion, and circular dichroism of polyribonucleotides. Handbook of Biochemistry and Molecular Biology: Nucleic Acids, 3rd ed., pp 596-603, CRC Press, Cleveland. (47) Bhattacharyya, B. R., Ramaswamy, K., and Crane, R. K. (1976) Synthesis of some β-D-glucopyranosides having a hydrophobic aglycon group terminated with a hydrophilic group. Carbohydr. Res. 47, 167-171. (48) Charreyre, M. T., Boullanger, P., Pichot, C., Delair, T., Mandrand, B., and Llauro, M. F. (1993) Synthesis of a hexyl methacrylate-terminated disaccharide monomer and study of its radically initiated homo- and copolymerization with styrene. Makromol. Chem. 194, 117-135. (49) Ren, T., Zhang, G., and Liu, D. (2001) Synthesis of bifunctional cationic compounds for gene delivery. Tetrahedron Lett. 42, 1007-1010. (50) Heathcock, C. H., and Ratcliff, R. (1971) Stereoselective total synthesis of the guaiazulenic sesquiterpenoids R-bulnesene and bulnesol. J. Am. Chem. Soc. 93, 1746-1757. (51) Caruthers, M. H., Barone, A. D., Beaucage, S. L., Dodds, D. R., Fisher, E. F., Mcbride, L. J., Matteucci, M., Stabinsky, Z., and Tang, J. Y. (1987) Chemical synthesis of deoxyoligonucleotides by the phosphoramidite method. Methods Enzymol. 154, 287-313. (52) Weston, B. W., Smith, P. L., Kelly, R. J., and Lowe, J. B. (1992) Molecular cloning of a fourth member of a human R(1, 3)fucosyltransferase gene family. Multiple homologous sequences that determine expression of the Lewis x, sialyl Lewis x, and difucosyl sialyl Lewis x epitopes. J. Biol. Chem. 267, 24575-24584. (53) Geyer, H., Schmitt, S., Wuhrer, M., and Geyer, R. (1999) Structural analysis of glycoconjugates by on-target enzymatic digestion and MALDI-TOF-MS. Anal. Chem. 71, 476-482. (54) Southern, E. M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517. (55) Remoortere, A., Hokke, C. H., van Dam, G. J., van Die, I., Deelder, A. M., and van den Eijnden, D. H. (2000) Various stages of schistosoma express Lewis(x), LacdiNAc, GalNAcβ1-4 (FucR1-3)GlcNAc and GalNAcβ1-4(FucR12FucR1-3)GlcNAc carbohydrate epitopes: detection with monoclonal antibodies that are characterized by enzymatically synthesized neoglycoproteins. Glycobiology 10, 601-609. (56) Allendoerfer, K. L., Durairaj, A., Matthews, G. A., and Patterson, P. H. (1999) Morphological domains of Lewis-X/ FORSE-1 immunolabeling in the embryonic neural tube are due to developmental regulation of cell surface carbohydrate expression. Dev. Biol. 211, 208-219. (57) Akhtar, S., Hughes, M. D., Khan, A., Bibby, M., Hussain, M., Nawaz, Q., Double, J., and Sayyed, P. (2000) The delivery of antisense therapeutics. Adv. Drug Delivery Rev. 44, 3-21.

BC034144P

Chemoenzymatic Synthesis and Antibody Detection of DNA

Recommend Documents