Chemoenzymatic synthesis of a Haloferax volcanii N-glycosylation

Subscriber access provided by UNIVERSITY OF ADELAIDE LIBRARIES

Article

Assembling glycan-charged dolichol phosphates: Chemoenzymatic synthesis of a Haloferax volcanii N-glycosylation pathway intermediate Yifat Elharar, Ananda R. Podilapu, Ziqiang Guan, Suvarn S. Kulkarni, and Jerry Eichler Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.7b00436 • Publication Date (Web): 15 Aug 2017 Downloaded from http://pubs.acs.org on August 18, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Assembling glycan-charged dolichol phosphates: Chemoenzymatic synthesis of a Haloferax volcanii N-glycosylation pathway intermediate

Yifat Elharar†,#, Ananda Rao Podilapu‡,#, Ziqiang Guan§, Suvarn S. Kulkarni‡,* and Jerry Eichler†,*

†

Department of Life Sciences, Ben Gurion University of the Negev, Beersheva

8410501, Israel ‡

Department of Chemistry, Indian Institute of Technology Bombay, Powai, Mumbai

400076, India §

Department of Biochemistry, Duke University Medical Center, Durham NC 27710,

USA

# Equal contributions

Byline: Chemoenzymatic synthesis of an archaeal N-glycosylation intermediate

* Corresponding authors: Suvarn S. Kulkarni, Department of Chemistry, Indian Institute of Technology Bombay, Powai, Mumbai - 400 076, India; Tel: 022-2576-7166; Fax: 022-2576-7152; Email: [email protected] Jerry Eichler, Department of Life Sciences, Ben Gurion University of the Negev, Beersheva 8410501, Israel; Tel: +972 8 6461343; Fax: +972 8 6479175; Email: [email protected]

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT N-glycosylation, the covalent attachment of glycans to select protein target Asn residues, is a post-translational modification performed by all three domains of life. In the halophilic archaea Haloferax volcanii, where understanding of this universal protein-processing event is relatively well-advanced, genes encoding the components of the Agl (archaeal glycosylation) pathway responsible for the assembly and attachment of an N-linked pentasaccharide have been identified. As elsewhere, the Nlinked glycan is assembled on phosphodolichol carriers before transfer to target Asn residues. However, as little is presently known of the Hfx. volcanii Agl pathway at the protein level, the seemingly unique ability of Archaea to use dolichol phosphate (DolP) as the glycan lipid carrier, rather than dolichol pyrophosphate used by eukaryotes, remains poorly understood. With this in mind, a chemoenzymatic approach was taken to biochemically study AglG, one of the five glycosyltransferases of the pathway. Accordingly, a novel regio- and stereo-selective reduction of naturally isolated polyprenol gave facile access to S-dolichol via asymmetric transfer hydrogenation under very mild conditions. This compound was used to generate glucose-charged DolP, a precursor of the N-linked pentasaccharide, as well as DolPglucose-glucuronic acid and DolP-glucuronic acid. AglG, purified from Hfx. volcanii membranes in hypersaline conditions, like those encountered in situ, was subsequently combined with UDP-glucuronic acid and DolP-glucose to yield DolPglucose-glucuronic acid. The in vitro system for the study of AglG activity developed here represents the first such tool for studying halophilic glycosyltransferases and will allow for detailed understanding of archaeal N-glycosylation.


Page 2 of 41

Page 3 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION In any organism, the diversity of the proteome exceeds the number of gene products encoded in the genome. Post-translational modifications represent one source of such protein multiplicity. Of the various protein-processing events that can affect a given protein, glycosylation, namely the covalent attachment of glycans, is one of the most common and arguably the most complex.1,2 Long-held to be unique to eukaryotes, it is now clear that both Bacteria and Archaea are also capable of N-glycosylation, where glycans are added to select Asn residues of a target protein.3,4 A comparison of pathways of N-glycosylation that have been delineated in members of each of the three domains of life reveals traits shared across evolution. For example, in each system, the N-linking glycan is assembled on one or more cytoplasmically-oriented lipid carriers. The glycan-charged lipids are then “flipped”, such that the glycan now faces the ER lumen in the eukaryal system or the cell exterior in the bacterial and archaeal processes. At this point, the glycan is delivered to target Asn residues by an oligosaccharyltransferase that relies on a catalytic subunit sharing topology, domain organization and motifs important for activity across evolution.5,6,7

Still, N-glycosylation pathways in Eukarya, Bacteria and Archaea present domainspecific traits. The polyisoprenoid lipid carriers upon which N-linked glycans are assembled represent one such example. In eukaryal N-glycosylation, a 14-member tribranched oligosaccharide is transferred to target proteins from a dolichol pyrophosphate (DolPP) carrier.8 In Campylobacter jejuni, a bacterium where the Nglycosylation pathway has been delineated,9 a heptasaccharide is assembled on a undecaprenol pyrophosphate carrier. The eukaryal and bacterial lipid glycan carriers can thus be distinguished by whether the α-position isoprene is saturated, as in



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

dolichol, or not, as in undecaprenol.10,11 In Archaea, where N-glycosylation is apparently an almost universal trait,12 phosphodolichol also serves as the lipid glycan carrier, as in eukaryotes. However, unlike its eukaryal counterpart, the archaeal lipid is also saturated at the ω-position isoprene, and in some species, at more internal isoprenes.13,14,15,16,17,18 Moreover, both DolPP and dolichol phosphate (DolP) can serve as the glycan lipid carrier in Archaea (for review, see ref. 19). To better understand the seemingly archaeal-specific use of DolP as glycan lipid carrier, there is a need to characterize the enzymes that assemble the glycan bound to this lipid platform.

Over the past decade, the considerable progress made in understanding archaeal Nglycosylation has largely relied on genetic approaches to identify components of the pathways responsible for mediating this post-translational modification (for review, see ref. 4). At the same time, only little is currently known of the enzymes comprising such pathways, and in particular those enzymes that directly interact with the DolPlinked glycan. To date, efforts in this direction have largely focused on the oligosaccharyltransferase AglB, responsible for transferring the lipid-linked glycan to target Asn residues, from the thermophiles Pyrococcus furiosus, Pyrococcus horikoshii and Archaeoglobus fulgidus, where the crystallized enzyme or domains thereof have been the focus of structural study.20,21,22 Likewise, AglC and AglK, glycosyltransferases involved in adding sugars to the DolP carrier in the methanogen Methanococcus voltae have been addressed biochemically.23 As such, there is clearly a need to expand our understanding of glycan-charged DolP-processing enzymes, especially from Archaea found in other extreme environments.


Page 4 of 41

Page 5 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In Haloferax volcanii, a halophilic archaeon first isolated from the Dead Sea,24 glycoproteins are modified by an N-linked pentasaccharide (mannose-1,2-[methyl-O4-]glucuronic acid−β-1,4-galacturonic acid-α-1,4-glucuronic acid-β-1,4-glucose-β-1Asn)25 assembled by the Agl (archaeal glycosylation) pathway (Figure 1). To date, the Hfx. volcanii Agl pathway has been characterized at the gene level and at the DolPand Asn-linked glycan levels.25,26,27 However, to biochemically characterize the steps of Hfx. volcanii N-glycosylation, both purified enzymes and substrates are required.

Figure 1 - Schematic depiction of the Hfx. volcanii Agll pathway. In the Agl pathway, the first four sugars of the N-linked pentasaccharide decorating Hfx. volcanii glycoproteins are sequentially added to a common DolP lipid carrier by the Glycosyltranferases AglJ, AglG, AglI and AglE.26,28,43,44 Once assembled, the DolPlinked tetrasaccharide (like its DolP-linked precursors; not shown) is flipped to face the cell exterior, where the oligosaccharyltransferase AglB transfers the tetrasaccharide to select target protein Asn residues.26,43,44 The terminal pentasaccharide sugar, mannose, is added to its own DolP carrier by AglD.26,43 DolPmannose is translocated across the membrane in a reaction involving AglR,45 at which point the mannose is delivered to the protein-linked tetrasaccharide by AglS.46 In 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

addition, AglF, a glucose-1-phosphate uridyltransferase,28 and AglM, a UDP-glucose dehydrogenase,47 AglP, a methyltransferase48 and AglQ, an isomerase,49 also contribute to the pathway. At present, it is not clear whether AglQ converts UDPglucuronic acid to UDP-galacturonic acid or glucuronic acid already bound to the DolP-disaccharide to galacturnic acid. The yellow hexagons represent glucose, the green hexagons represent glucuronic acid, the orange hexagons represent galacturonic acid and the blue hexagons represent mannose. DolP is in purple. The horizontal bar highlights the reaction catalyzed by AglG.

In the present report, Hfx. volcanii AglG, the second glycosyltransferase of the Agl pathway,28 was purified in hypersaline conditions and combined with chemically synthesized DolP-glucose (DolP-Glc). This chemoenzymatic approach confirmed the predicted function of AglG as adding glucuronic acid to DolP-Glc, while offering new insight into N-glycosylation in Archaea.


Page 6 of 41

Page 7 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RESULTS AND DISCUSSION With the aim of biochemically characterizing AglG, a Hfx. volcanii Agl pathway glycosyltransferase, the present study took a chemoenzymatic approach by combining purified AglG with chemically synthesized DolP-Glc, the sugar-charged lipid carrier to which the enzyme adds glucuronic acid (GlcA), to generate a more elaborate precursor of the N-linked pentasaccharide that decorates Hfx. volcanii glycoproteins.

Chemical synthesis of DolP-linked sugars As a first step in the project, the various sugar-charged DolPs required were generated. In chemically synthesizing phosphoglycolipids 1-3 (Figure 2), construction of the mono- and disaccharide moieties demands careful selection of protecting groups for assembling each sugar with the desired regio- and stereo-selectivity. Moreover, the presence of the DolP group restricts the choice of protecting groups. For instance, once the DolP is installed on the sugar, it is no longer be possible to employ hydrogenolysis or strong acidic or basic conditions for protecting group manipulations and functionalization of sugar-OH groups, as the unsaturated double bonds and phosphate group of DolP are sensitive to such conditions. Furthermore, glycosylation of the 4-OH group of a sugar is also a challenge due to inherent low reactivity that needs to be alleviated by tuning the electronic properties of the nearby protecting groups. All of these points were considered in synthesizing sugar-charged DolP, as discussed below.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2 – DolP-linked mono- and disaccharides synthesized in this study. Glc-αDolP (1), GlcA-β-(1-4)-Glc-α-DolP (2) and GlcA-α-DolP (3) were synthesized as described in Methods and Supporting Information.

Synthesis of S-dolichol: To begin synthesis of sugar-charged DolP, (S)-dolichols were procured by isolating C50-60 polyprenols following the protocol of Larkin et al.23 and subsequent stereo-selective reduction of their terminal double bond (Scheme 1).

Scheme 1 – Conversion of polyprenol to S-Dolichol.


Page 8 of 41

Page 9 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Accordingly, solvent extraction of powdered leaves of the plant source Rhus typhina, followed by repeated column chromatographic purification, afforded a C55-enriched mixture of polyprenols (with minor C50- and C60-containing species) in 5 wt% yield. Stereo- and regio-selective reduction of the α-double bond of polyprenol was first reported by Imperiali and co-workers using hydrogen at extremely high pressure (1500 psi) for 24 h.29 As an alternative, milder and more convenient conditions for the transformation of polyprenols into S-dolichols (Dol) were explored. Stereo-selective reduction of polyprenols in the presence of a Ru catalyst, KOH and isopropanol under asymmetric transfer hydrogenation conditions30,31 for 2 h afforded S-dolichols at 89% yield. Analysis of the S-dolichols matched well with reported data.29 Furthermore, the optical rotation of the corresponding S-dolichols matched well with earlier reported data,32 further confirming its identity. Notably, the novel method developed here does not require any special apparatus and gives consistently high yields of optically pure S-dolichols.

Synthesis of Glc-α-DolP (1): Synthesis of Glc-α-DolP 1 is shown in Scheme 2. Easily accessible hemiacetal 4, obtained from D-glucose in two steps via per-Oacetylation and selective anomeric deprotection, was phosphorylated using the phosphorimidate method (CEPCl, DIPEA and DCM)33 to obtain an unstable phosphoramidate 5 (86% yield), which upon reacting with S-dolichol in the presence of 0.45 M tetrazole in acetonitrile followed by further oxidation with tBuOOH furnished the glucosyl dolichol phosphate derivative 6 at 82% yield. Removal of the cyanoethoxy group using DBU and subsequent deacetylation (KOH, THF and H2O) afforded target molecule 1 at 74% yield over two steps.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 2 – Synthesis of Glc-α-DolP (1).

Synthesis of GlcA−β β−(1-4)-Glc-α-DolP (2): To synthesize DolP-linked disaccharide (Scheme 3), an OMP-glycoside that can be linked to Dol-P at a later stage was constructed. Accordingly, glycosylation of D-glucose-derived glycosyl donor 7 and acceptor 8 using NIS/TMSOTf as promotor afforded β-linked disaccharide 9 at 81% yield. Hydrolysis of the benzylidene acetal in 9 using 80% AcOH at 85ºC furnished 4,6-diol 10 (89% yield). Oxidation of the primary C6-hydroxyl of compound 10 using TEMPO and BAIB generated the corresponding acid intermediate, which upon esterification with MeI and K2CO3 afforded 11 at 72% yield over two steps. At this stage, the benzyl groups were replaced with acetates. Compound 11 was subjected to de-O-benzylation under hydrogenolysis conditions using H2 (1 atm) and Pd/C to give a tetrol, which upon acetylation using Ac2O and Et3N afforded 12 at 78% yield over 10 ACS Paragon Plus Environment

Page 10 of 41

Page 11 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


two steps. The paramethoxyphenyl group was then cleaved using CAN in the presence of CH3CN and water to give hemiacetal 13 (76% yield). Compound 13 was subsequently reacted with CEPCl and DIPEA to generate an unstable phosphoramidate, which upon oxidation using tBuOOH in decane afforded fully protected DolP-Glc-GlcA 14 at 89% yield over two steps. Global deprotection of compound 14 was carried out in two steps. Compound 14 was first treated with DBU in the presence of DCM as solvent to give the corresponding protected DolPdisaccharide at 89% yield. Hydrolysis of esters was done using 1.3 M KOH in the presence of THF and H2O as solvents to afford target molecule 2 at 68% yield.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 3 –Synthesis GlcA−β−(1-4)-Glc-α-DolP (2).

Synthesis of GlcA-α-DolP (3): To study AglG specificity, synthesis of a negative control was required. Chemical synthesis of GlcA-α-DolP is outlined in Scheme 4. Oxidation of the primary C6-hydroxyl group of compound 15 using TEMPO and BAIB furnished an acid intermediate, which upon further esterification with MeI and K2CO3 afforded D-glucuronate derivative 16 at 74% yield over two steps. Capping of the free hydroxyl group in compound 16 by acetate furnished a fully protected compound 17 (94% yield). Selective anomeric deprotection of 17 using NBS, THF 12 ACS Paragon Plus Environment

Page 12 of 41

Page 13 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and H2O afforded hemiacetal 18 (84% yield), which was phosphorylated using the phosphorimidate method (CEPCl, DIPEA and DCM) to obtain unstable phosphoramidate 19, which upon reacting with S-dolichol in the presence of 0.45 M tetrazole in acetonitrile followed by further oxidation with tBuOOH furnished glucuronyl dolichol phosphate derivative 20 (81%). Removal of the cyanoethoxy group using DBU and subsequent deacetylation (KOH, THF and H2O) furnished target molecule 3 (71%).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 4 – Synthesis of GlcA-α-DolP (3).

Purification and characterization of AglG With various sugar-charged DolP moieties in hand, attention next focused on AglG, the glycosyltranferase responsible for adding GlcA to DolP-Glc.28 The protein was expressed bearing N-terminal His6 and Strep tags by transformed Hfx. volcanii cells. Expressing the tagged version of the protein in the native host ensures proper folding of this halophilic protein. To correctly fold and function in hypersaline environments, as required by Hfx. volcanii,24 halophilic proteins are enriched in negative residues, including AglG, with a pI value of 4.46. As such, expression of halophilic proteins in


Page 14 of 41

Page 15 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


non-halophilic heterologous systems, such as Escherichia coli, often leads to misfolding and aggregation.34

The His6 tag was first exploited for purification on NiNTA agarose beads from a DDM extract of the membrane fraction of the cells. SDS-PAGE revealed that the eluted fraction contained two major protein species, with the faster migrating band corresponding to His6-Strep-AglG (calculated molecular mass, 37.8 kDa) and the slower migrating band likely corresponding to PitA (calculated molecular mass, 56.1 kDa), an endogenous Hfx. volcanii protein that presents an internal string of His residues and that shows high affinity for divalent cations.35 When this fraction was applied to Tactin beads designed to exploit the Strep tag on His6-Strep-AglG, only this protein, hereafter referred to as AglG, was eluted (Figure 3, arrow). The predicted single C-terminal transmembrane domain (spanning residues 281-202) of AglG may be important for stabilizing the enzyme, since a version of the protein lacking this domain was far less well expressed than was the full-length protein (not shown).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3 - Purification of AglG. AglG bearing His6 and Strep tags was sequentially purified on NiNTA and Tactin beads from a DDM extract of the membrane fraction of Hfx. volcanii cells transformed to express this protein. The protein eluted from Tactin resin was concentrated. The positions of 98, 64, 50, 36 and 22 kDa molecular mass markers are shown on the left, while the arrow on the right shows the position of His6-Strep-AglG (AglG).

The glycosyltranferase activity of AglG was tested upon incubation of the enzyme with UDP-GlcA and DolP-Glc over an 80 min period. The reaction components and products were then visualized by thin-layer chromatography (TLC). Only in those reactions where the enzyme, the sugar donor and the acceptor lipid sugar carrier were present did a novel species, presumably DolP-Glc-GlcA, appear (Figure 4a). To verify the specificity of the reaction, a series of control experiments was performed. When DolP-GlcA rather than DolP-Glc was included in the reaction mixture, no such novel glycan-charged DolP species was detected (Figure 4b). Likewise, no novel reaction


Page 16 of 41

Page 17 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


product was detected when AglG and DolP-Glc were combined with UDP-Glc instead of UDP-GlcA (not shown).

To confirm that the novel species indeed corresponds to DolP-Glc-GlcA, the expected product of the AglG-catalyzed reaction,28 normal phase liquid chromatographyelectrospray ionization mass spectrometry (NPLC-ESI MS) was performed. The monoisotopic [M-H]- peak at m/z 1185.76 thought to correspond to C55 DolP-GlcGlcA (calculated mass 1185.759 Da) found in a lipid extract of the complete reaction was further analyzed by MS/MS. The fragmentation pattern obtained, consistent with that of DolP-Glc-GlcA, confirmed the identity of the novel species as DolP-Glc-GlcA (Figure 4c). Moreover, comparison of the AglG-generated product with chemically synthesized compound 2 reaffirmed its identity as DolP-Glc-GlcA.

AglG, the first haloarchaeal glycosyltransferase involved in N-glycosylation to be purified, is thought to be an inverting glycosyltransferase containing the canonical Afold36 and has been assigned to glycosyltranferase family 2 (www.cazy.org). Accordingly, even though the anomerism of the in vitro linkage of GlcA to DolP-Glc catalyzed by AglG described here was not addressed, the GlcA at position two of the pentasaccharide N-linked to the Hfx. volcanii S-layer glycoprotein is known to be βlinked.25 Moreover, although Mg2+ was included when assaying AglG activity, given how A-fold-containing inverting glycosyltransferases often require a divalent cation,36 active enzyme was obtained regardless of whether or not Mg2+ was included during AglG purification, suggesting that this ion does not serve a structural role.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Finally, to better characterize AglG, kinetics experiments were conducted. The initial rates of DolP-Glc-GlcA generated in the presence of 0.5, 1, 2 or 4 mg/ml DolP-Glc over an 80 min incubation period with AglG and UDP-GlcA were determined and plotted against the substrate concentration (Figure 4d). Upon fitting the data to the Michaelis-Menten equation, the Km of the reaction was determined to be 1.69 mg/ml DolP-Glc. Because of problems in finding conditions that allowed for the solubilization of increasing amounts of DolP-Glc-GlcA so as to generate a calibration curve to quantitate the amount of product formation compatible with both TLC and hypersalinity, the rate of the reaction was instead calculated as the percent increase in DolP-Glc-GlcA levels over time, with the amount of DolP-Glc-GlcA obtained after 80 min considered as 100%. Accordingly, the Vmax was determined to be 3.18 percent DolP-Glc-GlcA/min.


Page 18 of 41

Page 19 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4 - AglG catalyzes the addition of UDP-GlcA to DolP-Glc. A. AglG activity was assayed in a reaction that included UDP-GlcA and DolP-Glc. Aliquots were removed at the indicated times and analyzed by TLC. In control reactions, either UDP-GlcA or DolP-Glc were omitted from the reaction. The arrows indicate the positions of DolP-Glc and DolP-Glc-GlcA, while the arrowhead indicates the origin of migration. B. The experiment described in A was repeated, however in some reactions, DolP-GlcA was included instead of DolP-Glc. Aliquots were removed after 80 min and analyzed by TLC. The arrows indicate the positions of DolP-Glc, DolPGlcA and DolP-Glc-GlcA, while the arrowhead indicates the origin of migration. C. MS/MS spectrum of the [M-H]- ion of C55 DolP-Glc-GlcA at m/z 1185.76. The fragmentation scheme is shown in the inset. D. The Km and Vmax of the reaction catalyzed by AglG were determined as described in the text. 19 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

To date, all known examples of DolP (and DolPP) involved in archaeal Nglycosylation can be distinguished from their eukaryal counterparts by the presence of a saturated ω-position isoprene in the archaeal lipid, a trait first reported for Hfx. volcanii DolP.13 However, the importance of ω-position isoprene saturation is unclear, since AglG was able to add GlcA to DolP-Glc in which the ω-position isoprene was not saturated. The same held true for the in vitro activities of AglC and AglK, two glycosyltransferases participating in N-glycosylation in the methanoarchaea Methanococcus voltae.23 Likewise, the absence of a saturated ω-position isoprene did not prevent the in vitro activity of the archaeal oligosaccharyltransferase AglB from M. voltae.23 Furthermore, DolP not saturated at the ω-position isoprene could be processed by DolP mannose synthases from Thermoplasma acidophilum37 and Pyrococcus horikoshii,38 although it is not known if DolP-mannose is part of an Nglycosylation pathway in either Archaea. Thus, although not essential for the activities of Agl pathway enzymes, the possibility that the saturated ω-position DolP isoprene unit contributes to enzyme activity nonetheless remains. Alternatively, other roles for the saturated ω-position isoprene can be envisaged, such as contributing to DolP localization via interactions with the transmembrane domains of Agl pathway enzymes. Indeed, the presence of saturated isoprenes at more internal positions in DolP and DolPP involved in N-glycosylation in thermophilic archaea14,16,17,18 has been proposed to reduce the movement of such lipids at the elevated temperatures at which these organisms live, a property that could be important for the enzymatic processing of their lipid glycan carriers.19

Conclusions


Page 20 of 41

Page 21 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Characterization of the glycosyltransferases that comprise archaeal N-glycosylation pathways is necessary for understanding the seemingly unique ability of Archaea to rely on DolP as a glycan lipid carrier. In the present study, a novel and streamlined protocol for chemical synthesis of sugar-charged DolP was reported. At the same time, AglG was purified in buffer containing 2 M NaCl and the detergent DDM while retaining its activity. AglG thus joins the limited number of membrane proteins purified from haloarchaea in the functional state. Finally, the chemoenzymatic strategy taken here offers a platform for detailed in vitro studies of AglG and the other glycosyltransferases that participate in the processing of sugar-charged DolP during Hfx. volcanii N-glycosylation.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 41

EXPERIMENTAL PROCEDURES Chemical synthesis of DolP-linked glycans (S)-Dolichols, DolP-Glc (1), DolP-Glc-GlcA (2) and DolP-GlcA (3) were synthesized using

standard

organic

chemistry

procedures,

purified

using

silica

gel

chromatography, and characterized by standard techniques, including 1H, 13C and 31P NMR spectroscopy and mass spectrometry (See Supporting Information).

Plasmid construction For over-expression of AglG, plasmid pRV1-ptna:his6-strep-aglG was constructed. Plasmid pRV1-ptna39 was cleaved with NdeI and EcoRI. AglG was cloned from Hfx. volcanii genomic DNA using a 5’ primer designed to introduce an NdeI cleavage site followed by sequences encoding Strep and His6 tags before the N-terminus of AglG (GTACTACATATGCATCATCATCATCATCATTGGAGCCACCCGCAATTCGA AAAGATGAAAGTCTCCGTCGTG; NdeI site is underlined) and a 3’ primer designed to introduce an EcoRI cleavage site (TACATGGAATTCCTAATTATTCGTCTTCTCCA; EcoRI site is underlined). The cloned fragment were then ligated into the cleaved plasmid to generate plasmid pRV1-ptna:his6-strep-aglG. The presence of the tna promotor allows for induction of the coding sequence, i.e. his6-strep-aglG in this case, in the presence of tryptophan.

Protein purification Hfx. volcanii WR536 (H53) strain cells (1 l) transformed with plasmid pRV1ptna:his6-strep-aglG were grown in complete medium containing 3.4 M NaCl, 0.15 M MgSO4•7H20, 1 mM MnCl2, 4 mM KCl, 3 mM CaCl2, 0.3 % (w/v) yeast extract, 0.5 % (w/v) tryptone, 50 mM Tris-HCl, pH 7.240 at 42°C to OD600=1.5 and harvested by


Page 23 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


centrifugation (9,000 x g, 20 min, 4°C). The resulting pellet was resuspended with 50 ml buffer R (2 M NaCl, 50 mM Tris-HCl, pH 7.2), 15 µl DNAse were added and the mixture was incubated for 5 min at RT. Following sonication (2 s on and 1 s off for 90 s, 70% output, Misonix XL2020 ultrasonicator) on ice and centrifugation (8,000 x g, 20 min, 4°C), the supernatant was subjected to ultracentrifugation (142,000 x g, 1 h, 4°C). The resulting pellet was resuspended in 3 ml buffer H (1% n-dodecyl β-Dmaltoside (DDM), 20 mM imidazole, 2 M NaCl, 50 mM Tris-HCl, pH 7.2), gently rotated for 1 h at 4°C and again subjected to ultracentrifugation (142,000 x g, 1 h, 4°C). The resulting supernatant was incubated with 0.5 ml NiNTA agarose beads (Qiagen) pre-washed three times with 5 ml buffer A (0.05% n-dodecyl β-D-maltoside (DDM), 20 mM imidazole, 2 M NaCl, 50 mM Tris-HCl, pH 7.2) and collected each time by centrifugation at 4,000 x g, 2 min, 4°C) for 20 min at 4°C with gentle rotation. The beads were washed three times with buffer A (and collected each time by centrifugation at 4,000 x g, 2 min, 4°C) and transferred into a Poly-Prep chromatography column (BioRad). The column was washed with 2.5 ml buffer A and eluted with 1 ml buffer E (0.05% DDM, 250 mM imidazole, 2 M NaCl, 50 mM TrisHCl, pH 7.2). The eluate was combined with 0.5 ml Strep-Tactin Superflow Plus beads (Qiagen) for 1 h at 4°C with gentle rotation and transferred into a Poly-Prep chromatography column. The column was washed twice with 1 ml buffer R containing 0.05% DDM and eluted with 1.5 ml buffer F (0.05% DDM, 2.5 mM desthiobiotin, 2 M NaCl, 50 mM Tris-HCl, pH 7.2). The buffer of the eluted samples was exchanged to buffer R containing 0.05% DDM using a PD-10 desalting column containing Sephadex G-25M resin (GE Healthcare Life Sciences). After concentrating using an Amicon concentrating unit (MW cut-off 10 kDa; Merck) and the samples were stored at -80°C until used.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Glycosyltransferase activity assays To assess the ability of AglG to convert DolP-Glc into DolP-Glc-GlcA, a mixture containing 0.5 µM AglG with 14.8 mg/ml UDP-GlcA, 0.5-4 mg/ml DolP-Glc, 10 mM MgCl2 and 2 mM DTT (final concentrations are given) was prepared. Assay buffer (0.05% DDM, 2 M NaCl, 50 mM Tris-HCl, pH 7.2) was added to bring the reaction volume to 135 µl. The reaction was performed at 37ºC. At selected time points up to 80 min, 20 µl aliquots were removed and combined with 10 mM EDTA on ice to stop the reaction. Fifteen µl aliquots from the arrested reactions were then separated by TLC using silica gel 60 0.25 mm 20x20 plates (Merck) developed in chloroform:methanol:water (16.5:7.6:1). To reveal the conversion of DolP-Glc to DolP-Glc-GlcA by AglG, the TLC plates were stained with oricine glycolipid stain solution (0.1% (w/v) oricine monohydrate in 5% (v/v) H2SO4 in ethanol). After completion of TLC, the plate was air-dried, sprayed with the oricine solution until completely wet, air-dried and placed in an oven pre-heated to 120°C for 5-10 min.

For kinetics analysis of AglG, the amounts of DolP-Glc-GlcA generated in the presence of the different levels of added DolP-Glc were densitometrically quantified using EZQuant-Gel (EZQuant, Tel Aviv, Israel). The amount of DolP-Glc-GlcA generated at each time point considered was expressed as a percent of the amount of product obtained after 80 min for that concentration of substrate, taken as 100%. The initial rates of DolP-Glc-GlcA generation at each concentration of DolP-Glc were determined using Kaleidagraph version 4.5 (Synergy Software, Reading PA) and plotted against the substrate concentration. Upon fitting the data to the Michaelis-


Page 24 of 41

Page 25 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Menten equation (Kaleidagraph version 4.5, Reading, PA), the Km and Vmax of the reaction were defined.

NPLC-ESI MS To confirm the identity of the product of the AglG-catalyzed reactions, NPLC-ESI MS was performed in the negative mode. Accordingly, 170 µl of 80 min reactions with each enzyme were combined with 2 M NaCl, 50 mM Tris-HCl, pH 7.2 to a final volume of 800 µl. Chloroform (1 ml) and methanol (2 ml) were added. After mixing using a Pasteur pipette, the samples were maintained at room temperature for 10 min, at which point chloroform (1 ml) and water (1 ml) were added. The mixtures were centrifuged (2,500 x g, 30 min) and the lower phase of each sample was transferred into a clean glass vial and evaporated under a stream of nitrogen. The samples were sealed with a Teflon lid and stored at -20°C until analyzed. NPLC-ESI MS of the products of the AglG-catalyzed reaction, as well as of DolP prepared similarly, was performed using an Agilent 1200 Quaternary LC system coupled to a high resolution TripleTOF5600 mass spectrometer (Sciex, Framingham, MA). A Unison UK-Amino column (3 µm, 25 cm × 2 mm) (Imtakt USA, Portland, OR) was used. Mobile phase A consisted of chloroform/methanol/aqueous ammonium hydroxide (800:195:5, v/v/v). Mobile phase B consisted of chloroform/methanol/water/ aqueous ammonium hydroxide (600:340:50:5, v/v/v/v). Mobile phase C consisted of chloroform/methanol/water/aqueous ammonium hydroxide (450:450:95:5, v/v/v/v). The elution program consisted of the following: 100% mobile phase A was held isocratically for 2 min and then linearly increased to 100% mobile phase B over 14 min and held at 100% B for 11 min. The LC gradient was then changed to 100% mobile phase C over 3 min and held at 100% C for 3 min, and finally returned to



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

100% A over 0.5 min and held at 100% A for 5 min. The total LC flow rate was 300 µl/min. The post-column splitter diverted ~10% of the LC flow to the ESI source of the TF5600 mass spectrometer, with MS settings as follows: Ion spray voltage (IS) = 4500 V, Curtain gas (CUR) = 20 psi, Ion source gas 1 (GS1) = 20 psi, De-clustering potential (DP) = -55 V, and Focusing Potential (FP) = -150 V. For tandem mass spectrometry (MS/MS) analysis, nitrogen was used as the collision gas. Data acquisition and analysis were performed using Analyst TF1.5 software (Sciex, Framingham, MA).


Page 26 of 41

Page 27 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ACKNOWLEDGMENTS The authors thank Barbara Imperiali, Massachusetts Institute of Technology, for kindly providing Rhus typhina leaves and Thorsten Allers, University of Nottingham, for plasmid pRV1-ptna.

FUNDING SOURCES This research was supported by the ISF-UGC joint research program framework (grant 2253/15 awarded to S.K. and J.E). Z.G. was supported by the LIPID MAPS Large Scale Collaborative Grant GM-069338 and grant EY023666 from NIH. A.R.P. thanks CSIR-New Delhi for fellowships.

SUPPORTING INFORMATION DESCRIPTION The Supporting Information provides detailed descriptions of the methods used to generate the different compounds generated in this study, as well as their characterization.

ABBREVIATIONS Agl - archaeal glycosylation; Dol - S-dolichol; DolP – dolichol phosphate; DolP-Glc dolichol phosphate-glucose; DolPP - dolichol pyrophosphate; Glc – glucose; GlcA – glucuronic acid; NPLC-ESI MS - normal phase liquid chromatography-electrospray ionization mass spectrometry; TLC - thin-layer chromatography.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

REFERENCES 1. Apweiler, R., Hermjakob, H., and Sharon, N. (1999) On the frequency of protein glycosylation, as deduced from analysis of the SWISS-PROT database. Biochim. Biophys. Acta 1473, 4-8. 2. Spiro, R.G. (1973) Glycoproteins. Adv. Protein. Chem. 27, 349-467. 3. Nothaft, H., and Szymanski, C.M. (2013) Bacterial protein N-glycosylation: new perspectives and applications. J. Biol. Chem. 288, 6912-6920. 4. Jarrell, K.F., Ding, Y., Meyer, B.H., Albers, S.V., Kaminski, L., and Eichler, J. (2014) N-linked glycosylation in Archaea: A structural, functional and genetic analysis. Microbiol. Mol. Biol. Rev. 78, 304-341. 5. Wacker, M., Feldman, M.F., Callewaert, N., Kowarik, M., Clarke, B.R., Pohl, N.L., Hernandez, M., Vines, E.D., Valvano, M.A., Whitfield, C., et al. (2006) Substrate specificity of bacterial oligosaccharyltransferase suggests a common transfer mechanism for the bacterial and eukaryotic systems. Proc. Natl. Acad. Sci. USA 103, 7088-7093. 6. Lizak, C., Gerber, S., Numao, S., Aebi, M., and Locher, K.P. (2011) X-ray structure of a bacterial oligosaccharyltransferase. Nature 474, 350-355. 7. Matsumoto, S., Shimada, A., Nyirenda, J., Igura, M., Kawano, Y., and Kohda, D. (2013) Crystal structures of an archaeal oligosaccharyltransferase provide insights into the catalytic cycle of N-linked protein glycosylation. Proc. Natl. Acad. Sci. USA 110, 17868-17873. 8. Aebi, M. (2013) N-linked protein glycosylation in the ER. Biochim. Biophys. Acta 1833, 2430-2437. 9. Linton, D., Dorell, N., Hitchen, P.G., Amber, S., Karlyshev, A.V., Morris, H.R., Dell, A., Valvano, M.A., Aebi, M., and Wren, B.W. (2005) Functional analysis of the Campylobacter jejuni N-linked protein glycosylation pathway. Mol. Microbiol. 55, 1695-1703. 10. Swiezewska, E., and Danikiewicz, W. (2005) Polyisoprenoids: structure, biosynthesis and function. Prog. Lipid Res. 44, 235-258. 11. Jones, M.B., Rosenberg, J.N., Betenbaugh, M.J., and Krag, S.S. (2009) Structure and synthesis of polyisoprenoids used in N-glycosylation across the three domains of life. Biochim. Biophys. Acta 1790, 485-494. 12. Kaminski, L., Lurie-Weinberger, M.N., Allers, T., Gophna, U., Eichler, J. (2013) Phylogenetic- and genome-derived insight into the evolution of Nglycosylation in Archaea. Mol. Phylogenet. Evol. 68, 327-339.


Page 28 of 41

Page 29 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


13. Kuntz, C., Sonnenbichler, J., Sonnenbichler, I,. Sumper, M., and Zeitler, R. (1997) Isolation and characterization of dolichol-linked oligosaccharides from Haloferax volcanii. Glycobiology 7, 897-904. 14. Guan, Z., Meyer, B.H., Albers, S.V., and Eichler, J. (2011) The thermoacidophilic archaeon Sulfolobus acidocaldarius contains an unusually short, highly reduced dolichyl phosphate. Biochim. Biophys. Acta 1811, 607616. 15. Cohen-Rosenzweig, C., Guan, Z., Shaanan, B., and Eichler, J. (2014) Substrate promiscuity: AglB, the archaeal oligosaccharyltransferase, can process a variety of lipid-linked glycans. Appl. Environ. Microbiol. 80, 486496. 16. Chang, M.M., Imperiali, B., Eichler, J., and Guan, Z. (2015) N-linked glycans are assembled on highly reduced dolichol phosphate carriers in the hyperthermophilic archaea Pyrococcus furiosus. PLoS One 10, e0130482. 17. Guan, Z., Delago, A., Nussbaum, P., Meyer, B., Albers, S.V. and Eichler, J. (2016) N-glycosylation in the thermoacidophilic archaeon Sulfolobus acidocaldarius involves a short dolichol pyrophosphate carrier. FEBS Lett., 590, 3168-3178. 18. Taguchi, Y., Fujinami, D., and Kohda, D. (2016) Comparative analysis of archaeal lipid-linked oligosaccharides that serve as oligosaccharide donors for Asn glycosylation. J. Biol. Chem. 291, 11042-11054. 19. Eichler, J., and Guan, Z. (2017) Lipid sugars carriers at the extremes: The phosphodolichols Archaea use in N-glycosylation. Biochim. Biophys. Acta, 1862, 589-599. 20. Igura, M., Maita, N., Kamishikiryo, J., Yamada, M., Obita, T., Maenaka, K., and Kohda, D. (2008) Structure-guided identification of a new catalytic motif of oligosaccharyltransferase. EMBO J 27, 234-243. 21. Matsumoto, S., Igura, M., Nyirenda, J., Matsumoto, M., Yuzawa, S., Noda, N.N., Inagaki, F., and Kohda, D. (2012) Crystal structure of the C-terminal globular domain of oligosaccharyltransferase from Archaeoglobus fulgidus at 1.75 A resolution. Biochemistry 51, 4157-4166. 22. Nyirenda, J., Matsumoto, S., Saitoh, T., Maita, N., Noda, N.N., Inagaki, F., and Kohda, D. (2013) Crystallographic and NMR evidence for flexibility in oligosaccharyltransferases and its catalytic significance. Structure 21, 32-41. 23. Larkin, A., Chang, M.M., Whitworth, G.E., and Imperiali, B. (2013) Biochemical evidence for an alternate pathway in N-linked glycoprotein biosynthesis. Nat. Chem. Biol. 9, 367-373.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

24. Mullakhanbhai, M.F., and Larsen, H. (1975) Halobacterium volcanii spec. nov., a Dead Sea halobacterium with a moderate salt requirement. Arch. Microbiol. 104, 207-214. 25. Kandiba, L., Lin, C.-w., Aebi, M., Eichler, J., and Guerardel, Y. (2016) Structural characterization of the N-linked pentasaccharide decorating glycoproteins of the halophilic archaeon Haloferax volcanii. Glycobiology 26, 745-756. 26. Guan, Z., Naparstek, S., Kaminski, L., Konrad, Z., and Eichler, J. (2010) Distinct glycan-charged phosphodolichol carriers are required for the assembly of the pentasaccharide N-linked to the Haloferax volcanii S-layer glycoprotein. Mol. Microbiol. 78, 1294-1303. 27. Eichler, J., Arbiv, A., Cohen-Rosenzweig, C., Kaminski, L., Kandiba, L., and Konrad, Z. (2013) N-glycosylation in Haloferax volcanii: Adjusting the sweetness. Front Microbiol. 4, 403. 28. Yurist-Doutsch, S., Abu-Qarn, M., Battaglia, F., Morris, H.R., Hitchen, P.G., Dell, A., and Eichler, J. (2008) aglF, aglG and aglI, novel members of a gene cluster involved in the N-glycosylation of the Haloferax volcanii S-layer glycoprotein. Mol Microbiol. 69: 1234-1245. 29. Zinaserman, J.W. and Imperiali, B. (1988) Synthesis of dolichols via asymmetric hydrogenation of plant polyprenols. Tetrahedron Lett. 29, 5343-5344. 30. Wu, R., Beauchamps, M.G., Laquidara, J.M., and John R.S. (2012) Rutheniumcatalyzed asymmetric transfer hydrogenation of allylic alcohols by an enantioselective isomerization/transfer hydrogenation mechanism. Angew. Chem., Int. Ed. 51, 2106-2110. 31. Shoola, C.O., DelMastro, T., Wu, R., and John R.S. (2015) Asymmetric transfer hydrogenation of secondary allylic alcohols. Eur. J. Org. Chem. 1670–1673. 32. Suzuku, S., Mori, F., Takigawa, T., Ibata, K., Ninagawa, Y., Nishida, T., Mizuno, M., and Tanaka, Y. (1983) Synthesis of mammalian dolichols from plant polyprenols. Tetrahedron Lett. 24, 5103-5106. 33. Westerduin, P., Veeneman, G.H., Marugg, J.E., van der Marel, G.A., and van Boom, J.H. (1986) An approach to the synthesis of α-l-fucopyranosyl phosphoric mono- and diesters via phosphite intermediates. Tetrahedron Lett. 27, 1211-1214. 34. Allers, T. (2010) Overexpression and purification of halophilic proteins in Haloferax volcanii. Bioeng. Bugs 1, 288-290. 35. Dinitz-Bab, E., Shmuely, H., Maupin-Furlow, J., Eichler, J., and Shaanan, B. (2006) Haloferax volcanii PitA: An example of functional interaction between the Pfam chlorite dismutase and antibiotic biosynthesis monooxygenase families? Bioinformatics 22, 671-675. 30 ACS Paragon Plus Environment

Page 30 of 41

Page 31 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


36. Lairson, L.L., Henrissat, B., Davies, G.J., and Withers, S.G. (2008) Glycosyltransferases: structures, functions, and mechanisms. Annu. Rev. Biochem. 77, 521-555. 37. Zhu, B.C. and Laine, R.A. (1996) Dolichyl-phosphomannose synthase from the archae Thermoplasma acidophilum. Glycobiology 6, 811-816. 38. Urushibata, Y., Ebisu, S., and Matsui, I. (2008) A thermostable dolichol phosphoryl mannose synthase responsible for glycoconjugate synthesis of the hyperthermophilic archaeon Pyrococcus horikoshii. Extremophiles 12, 665676. 39. Large, A., Stamme, C., Lange, C., Duan, Z., Allers, T., Soppa, J., and Lund, P.A. (2007) Characterization of a tightly controlled promoter of the halophilic archaeon Haloferax volcanii and its use in the analysis of the essential cct1 gene. Mol. Microbiol. 66, 1092-1106. 40. Mevarech, M. and Werczberger, R. (1985) Genetic transfer in Halobacterium volcanii. J. Bacteriol. 162, 461-462. 41. Abu-Qarn, M., Giordano, A., Battaglia, F., Trauner, A., Morris, H.R., Hitchen, P., Dell, A., and Eichler, J. (2008) Identification of AglE, a second glycosyltransferase involved in N-glycosylation of the Haloferax volcanii Slayer glycoprotein. J. Bacteriol. 190, 3140-3146. 42. Kaminski, L., Abu-Qarn, M., Guan, Z., Naparstek, S., Ventura, V.V., Raetz, C.R.H., Hitchen, P.G., Dell, A., and Eichler, J. (2010). AglJ participates in adding the linking saccharide in the Haloferax volcanii N-glycosylation pathway. J. Bacteriol. 192, 5572-5579. 43. Abu-Qarn, M. and Eichler, J. (2006) Protein N-glycosylation in Archaea: defining Haloferax volcanii genes involved in S-layer glycoprotein glycosylation. Mol. Microbiol. 61, 511-525. 44. Abu-Qarn, M., Yurist-Doutsch, S., Giordano, A., Trauner, A., Morris, H.R., Hitchen, P., Medalia, O., Dell, A., and Eichler, J. (2007) Haloferax volcanii AglB and AglD are involved in N-glycosylation of the S-layer glycoprotein and proper assembly of the surface layer. J. Mol. Biol. 374, 1224-1236. 45. Kaminski, L., Guan, Z., Abu-Qarn, M., Konrad, Z., and Eichler, J. (2012) AglR is required for addition of the final mannose residue of the N-linked glycan decorating the Haloferax volcanii S-layer glycoprotein. Biochim. Biophys. Acta 1820, 1664-1670. 46. Cohen-Rosenzweig, C., Yurist-Doutsch, S., and Eichler, J. (2012) AglS, a novel component of the Haloferax volcanii N-glycosylation pathway, is a dolichol phosphate-mannose mannosyltransferase. J. Bacteriol. 194, 69096916.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

47. Yurist-Doutsch, S., Magidovich, H., Ventura, V.V., Hitchen, P.G., Dell, A., and Eichler, J. (2010) N-glycosylation in Archaea: On the coordinated actions of Haloferax volcanii AglF and AglM. Mol. Microbiol. 75, 1047-1058. 48. Magidovich, H., Yurist-Doutsch, S., Konrad, Z., Ventura, V.V., Hitchen, P.G., Dell, A., Eichler, J. (2010) AglP is a S-adenosyl-L-methionine-dependent methyltransferase that participates in the N glycosylation pathway of Haloferax volcanii. Mol. Microbiol. 76, 190-199. 49. Arbiv, A., Yurist-Doutsch, S., Guan, Z., and Eichler, J. (2013) AglQ is a novel component of the Haloferax volcanii N-glycosylation pathway. PLoS One 8, e81782.

TOC GRAPHIC


Page 32 of 41

Page 33 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1 - Schematic depiction of the Hfx. volcanii Agll pathway. In the Agl pathway, the first four sugars of the N-linked pentasaccharide decorating Hfx. volcanii glycoproteins are sequentially added to a common DolP lipid carrier by the Glycosyltranferases AglJ, AglG, AglI and AglE.26,28,43,44 Once assembled, the DolP-linked tetrasaccharide (like its DolP-linked precursors; not shown) is flipped to face the cell exterior, where the oligosaccharyltransferase AglB transfers the tetrasaccharide to select target protein Asn residues.26,43,44 The terminal pentasaccharide sugar, mannose, is added to its own DolP carrier by AglD.26,43 DolP-mannose is translocated across the membrane in a reaction involving AglR,45 at which point the mannose is delivered to the protein-linked tetrasaccharide by AglS.46 In addition, AglF, a glucose1-phosphate uridyltransferase,28 and AglM, a UDP-glucose dehydrogenase,47 AglP, a methyltransferase48 and AglQ, an isomerase,49 also contribute to the pathway. At present, it is not clear whether AglQ converts UDP-glucuronic acid to UDP-galacturonic acid or glucuronic acid already bound to the DolP-disaccharide to galacturnic acid. The yellow hexagons represent glucose, the green hexagons represent glucuronic acid, the orange hexagons represent galacturonic acid and the blue hexagons represent mannose. DolP is in purple. The horizontal bar highlights the reaction catalyzed by AglG. 84x38mm (300 x 300 DPI)

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2 – DolP-linked glycans synthesized in this study. Glc-α-DolP (1), GlcA-β-(1-4)-Glc-α←-DolP (2) and GlcA-α-DolP (3) were synthesized as described in Methods and Supporting Information. 84x36mm (300 x 300 DPI)


Page 34 of 41

Page 35 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3 - Purification of AglG. AglG bearing His6 and Strep tags was sequentially purified on NiNTA and Tactin beads from a DDM extract of the membrane fraction of Hfx. volcanii cells transformed to express this protein. The protein eluted from Tactin resin was concentrated. The positions of 98, 64, 50, 36 and 22 kDa molecular mass markers are shown on the left, while the arrow on the right shows the position of His6Strep-AglG (AglG). 84x96mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4 - AglG catalyzes the addition of UDP-GlcA to DolP-Glc. A. AglG activity was assayed in a reaction that included UDP-GlcA and DolP-Glc. Aliquots were removed at the indicated times and analyzed by TLC. In control reactions, either UDP-GlcA or DolP-Glc were omitted from the reaction. The arrows indicate the positions of DolP-Glc and DolP-Glc-GlcA, while the arrowhead indicates the origin of migration. B. The experiment described in A was repeated, however in some reactions, DolP-GlcA was included instead of DolP-Glc. Aliquots were removed after 80 min and analyzed by TLC. The arrows indicate the positions of DolP-Glc, DolP-GlcA and DolP-Glc-GlcA, while the arrowhead indicates the origin of migration. C. MS/MS spectrum of the [M-H]- ion of C55 DolP-Glc-GlcA at m/z 1185.76. The fragmentation scheme is shown in the inset. D. The Km and Vmax of the reaction catalyzed by AglG were determined as described in the text. 177x147mm (300 x 300 DPI)


Page 36 of 41

Page 37 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1 – Conversion of polyprenol to S-Dolichol. 84x99mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 2 – Synthesis of Glc-α-DolP (1). 84x61mm (300 x 300 DPI)


Page 38 of 41

Page 39 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 3 –Synthesis GlcA−β−(1-4)-Glc-α←-DolP (2). 150x170mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 4 – Synthesis of GlcA-α-DolP (3). 150x150mm (300 x 300 DPI)


Page 40 of 41

Page 41 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC graphic 90x44mm (300 x 300 DPI)


Chemoenzymatic synthesis of a Haloferax volcanii N-glycosylation

Recommend Documents