Chimeric Enzyme Composed of Polyhydroxyalkanoate (PHA

Feb 18, 2009 - Chimeric enzymes composed of polyhydroxyalkanoate (PHA) synthases from Ralstonia eutropha (CupriaVidus necator) (PhaCRe) and ...
1 downloads 0 Views 1MB Size
Download PDF
682

Biomacromolecules 2009, 10, 682–685

Chimeric Enzyme Composed of Polyhydroxyalkanoate (PHA) Synthases from Ralstonia eutropha and Aeromonas caviae Enhances Production of PHAs in Recombinant Escherichia coli Ken’ichiro Matsumoto,† Kazuma Takase,§ Yoko Yamamoto,† Yoshiharu Doi,§ and Seiichi Taguchi*,† Division of Biotechnology and Macromolecular Chemistry, Graduate School of Engineering, Hokkaido University, N13-W8, Kita-ku, Sapporo 060-8628, Japan and RIKEN Institute, 2-1 Hirosawa, Wako-shi 351-0198, Japan Received November 29, 2008; Revised Manuscript Received January 17, 2009

Chimeric enzymes composed of polyhydroxyalkanoate (PHA) synthases from Ralstonia eutropha (CupriaVidus necator) (PhaCRe) and Aeromonas caViae (PhaCAc) were constructed. PhaCRe is known for its potent enzymatic activity among the characterized PHA synthases. PhaCAc has broad substrate specificity and synthesizes shortchain-length (SCL)/medium-chain-length (MCL) PHA. We attempted to create chimeric enzymes inheriting both of the advantageous properties. Among eight chimeras, AcRe12, with 26% of the N-terminal of PhaCAc and 74% of the C-terminal of PhaCRe, exhibited comparable P(3-hydroxybutyrate) accumulation as parental enzymes in Escherichia coli JM109. Thus, AcRe12 was applied to SCL/MCL PHA production using E. coli LS5218 as the host. AcRe12 accumulated higher amount of PHA (50 wt %) than the parental enzymes. Furthermore, the PHA consisted of 2 mol % 3-hydroxyhexanoate as well as 3-hydroxybutyrate. Therefore, the chimeric PHA synthase, AcRe12, inherited the character of both of the parental enzymes and thus exhibits improved enzymatic properties.

Introduction Plastics derived from biobased carbon sources are attracting interest because of the need to look for alternatives to finite petroleum resources. Polyhydroxyalkanoates (PHAs) are bacterial polyesters that can be used as biodegradable plastic materials.1,2 PHAs are wholly produced by bioprocesses, is an advantageous feature of PHAs compared to other representative biobased plastics, such as poly(lactate)s (PLAs)3 and poly(butylene succinate), which are produced via biological and chemical processes. PHAs consist of various monomer units, such as short-chain-length (SCL, C4 and C5) and medium-chainlength (MCL, C6 to C14) 3-hydroxyalkanoates, 4-hydroxybutyrate,4 3-mercaptobutyrate,5 and 3-hydroxyl acids with various functional groups.6 The variety of PHA monomeric units enables the production of materials with a variety of properties. For example, SCL-based SCL/MCL PHAs are flexible material whose mechanical properties are similar to those of polypropylene.7 PHA synthase (or polymerase), plays a central role in PHA biosynthesis. The activity and substrate specificity of PHA synthase are major factors in determining the productivity and properties of the materials. The engineering of PHA synthases to create beneficial mutants is an effective strategy for enhancing polymer production and regulation of monomer composition.8 Our group has created many beneficial mutants of PHA synthase from Aeromonas caViae,9 Ralstonia eutropha (CupriaVidus necator),10 and Pseudomonas sp. 61-3.11 Most of the mutated enzymes resulted in an increase in PHA content in recombinant Escherichia coli, R. eutropha,12 Corynebacterium glutamicum,13 and even Arabiodpsis,14 as well as the regulation of monomer * To whom correspondence should be addressed. Tel./Fax: +81-11-7066610. E-mail: [email protected]. † Hokkaido University. § RIKEN Institute.

composition of SCL/MCL PHA copolymers.15 Furthermore, we recently found an engineered PHA synthase with acquired lactate-polymerizing activity.16 Using a lactate polymerizing enzyme, we achieved biological production of P(lactate-co-3hydroxybutyrate) in recombinant E. coli. Because lactate-based polyesters, such as PLAs, are currently produced via a chemoprocess using a metal catalyst, a biological system for the production of lactate-based polyester has the potential to be a more environmentally friendly alternative to conventional chemo-processes. These results have demonstrated that the engineering of PHA synthases can improve the productivity and quality of PHAs and also expands the research field on biological polyesters in terms of the production of various biobased materials with useful properties. Several methods are in use for the protein engineering to improve properties of enzymes. Point mutation based on the 3D structure of the enzyme is a common way to create beneficial mutations.17 However, the 3D structure of PHA synthase has not been obtained yet, so our group has investigated positive screening from a random mutant library of PHA synthase to obtain highly active mutants.18,19 Sheu reported that the engineering of PHA synthase by point mutations targeted to highly conserved region of the enzymes.20 Once beneficial point mutations were obtained, the variation in the engineered enzymes can be further expanded by creating multiple mutants using gene shuffling21 and recombination techniques.8,11,15 The construction of chimeric enzymes is also a way to create new enginered enzymes. A chimeric enzyme is a fusion of two or more enzymes that could exhibit the character of both of the parental enzymes. Solaiman et al. created functional chimeras of PHA synthases derived from Pseudomonas resinoVorans (phaC1 and phaC2).22 Niamsiri et al. also reported chimeric PHA synthases within the same class II homologous enzymes.23 On the other hand, Rehm et al. constructed chimeras of class I and II PHA synthases from R. eutropha and Pseudomonas

10.1021/bm801386j CCC: $40.75  2009 American Chemical Society Published on Web 02/18/2009

Chimeric Class I PHA Synthase

Biomacromolecules, Vol. 10, No. 4, 2009

683

Figure 1. Alignment of PHA synthases from R. eutropha (PhaCRe) and A. caviae (PhaCAc) and their predicted secondary structures. The asterisk indicates identical amino acid residues. The gray box indicates the possible random coil region.

aeruginosa, respectively, but none of them produced detectable PHA.21 These results suggest that successful chimeragenesis requires an adequate degree of homology between the target enzymes. In this study, we attempted to generate chimeras of PHA synthase from parental enzymes with different properties, but categorized into the same class I PHA synthase. Namely, we chose PHA synthases from R. eutropha (PhaCRe) and A. caViae (PhaCAc) as the parental enzymes for chimeragenesis. PhaCRe is known to have very strong enzymatic activity among the characterized PHA synthases and produces SCL PHAs.24,25 On the other hand, PhaCAc has broad substrate specificity and produces SCL/MCL PHAs consisting of monomers which are 4-6 carbons long.26 We attempted to create chimeric PHA synthases having both high enzymatic activity and broad substrate specificity. Here, one chimeric enzyme, which improved SCL/MCL PHA production in recombinant E. coli, is reported. This result adds a new member to the set of engineered PHA synthases with beneficial properties.

Materials and Methods Plasmid Construction. The N-terminal and C-terminal truncated fragments of the PhaCRe and PhaCAc genes were amplified using the phosphorylated primers listed in Table 1. Eight pairs of the truncated fragments were ligated to generate chimeric gene fragments, as shown in figure 2. Chimeric genes were amplified using the ligated fragments as a template and a pair of primers, pETMCS-f and pETMCS-r. The XbaI/BamHI digested chimeric gene was inserted into pGEM′′ABex bearing β-ketothiolase and acetoacetyl-CoA reductase genes from R. eutropha and pGEMABJ4ex bearing the enoyl-CoA hydratase gene from Pseudomonas aeruginosa along with phaAB to yield pGEM′′CchABs and pGEM′′CchABJ4s, respectively (Figure 2). CultivationandPHAAnalyses.E.coliJM109harboringpGEM′′CchABs were cultured in LB medium containing glucose (2 wt %/vol) and ampicillin (100 µg/mL) for 48 h at 30 °C to produce the P(3hydroxybutyrate) [P(3HB)] homopolymer. For accumulating SCL/MCL PHA, E. coli LS5218 [fadR601, atoC(Con)] harboring pGEM′′CchABJ4s was cultured in M9 medium containing sodium dodecanoate (0.3 wt %/vol) and ampicillin (100 µg/ml) with brij-35 for 72 h at 37 °C. The cellular P(3HB) content was determined using HPLC, as described previously.15 The content and monomer composition of SCL/MCL PHA were analyzed using gas chromatography (GC), as described previously.15,27 The molar mass of PHA was determined using gel permeation chromatography (GPC) with polystylene standards for the calibration, as described previously.28 Immunoblot Analysis. Recombinant E. coli JM109 strains harboring pGEM′′CchABs were grown at 37 °C for 14 h as a preculture,

Table 1. Primers Used in this Study primer name

sequence

R1 R2 R3 R4 R5 R6 R7 R8 A1 A2 A3 A4 A5 A6 A7 A8 pETMCS-f pETMCS-r

GGCGGGCGACATCGCATCGACCCATTGCG AACTTCCTTGCCACCAATCCCGAGGCG GCACGGCGGCACCATCAGCAGCGGGCGCGC ATCAACAAGTACTACATCCTGGACCTGCAG GCCGCCCACGCAGAAGCCGAGCACG ACCATTGTCTCGACCGCGCTGGCGG CGCACCCAGCACGAAGCGCAGCTTGTTCGC TCGGGCCATATCGCCGGTGTGATCAACCCG GCTGGGGGCCATGGCGTTGACGTACTGGCG AACTTCCTGGCCACCAACCCCGAGCTGCTC GAAGGGCGGCACTATCAGCACAGG ATCAACAAGTACTACATCATGGACATGCGG GCCGCCGATGCAGTAGCCGATGCCG ACCGCCCTGTCGCTCGCCATGGGCTGGC CTCCGCCAGGAGGAAGCGCTGCTCCCCGCC TCCGGCCACATCGCCGGCATCATCAACCCG CCCAACGCTGCCCGAGATCTCGATCCCGCG AGCTTCCTTTCGGGCTTTGTTAGCAGCCGG

transferred into new medium, and further cultivated at 37 °C for 9 h. The cells were disrupted by sonication in 10 mM sodium phosphate buffer (pH 7.0). The supernatant of the crude extract was applied to immunoblotting using antiserums prepared previously.10,29

Results and Discussion Construction of Chimeras and P(3HB) Production. To create a functional chimeric enzyme, selection of the junction site is critical. We performed computational secondary structure prediction using DNASIS software (Hitachisoft, JAPAN) to find the proper junction sites for the two enzymes (Figure 1). Based on the predicted secondary structure, four positions (numbering for PhaCRe: 159, 246, 323, and 506) located at linker regions of secondary structures and relatively conserved regions in primary structures were chosen as junction sites to achieve ordinary protein folding. Using the four junction sites, eight chimeric PHA synthase genes were designated and constructed, as shown in Figure 2, and introduced into E. coli. Production of the chimeric enzymes was detected with immunoblot analysis. All of the eight chimeric enzymes and two parental enzymes were successfully expressed in recombinant E. coli (Figure 3). Because the antibody against PhaCRe was raised using an oligopeptide with the sequence from the C-terminal region of PhaCRe,10 chimeric enzymes with the C-terminal region of PhaCRe were detected by the antibody against PhaCRe. The chimeras with the C-terminal of PhaCAc

684

Biomacromolecules, Vol. 10, No. 4, 2009

Matsumoto et al. Table 2. Content and Composition of the PHAs Produced in Recombinant E. coli Harboring Parental and Chimeric PHA Synthase Genesa monomer composition (mol %)b PHA SCL/MCL PHA 3HB synthase content (wt %) (C4) PhaCRe AcRe12 PhaCAc

13 50 40

100 98 92

3HHx (C6) 0 2 8

molar mass

3HO Mn Mw (C8) (105) (105) Mw/Mn 0 trace 0

2.9 1.1 2.0

8.3 2.3 3.8

3.0 2.1 1.9

a E. coli LS5218 harboring pGEM′′CchABJ4s were grown on dodecanoate for SCL/MCL production. b 3HB, 3-hydroxybutyrate; 3HHx, 3-hydroxyhexanoate; 3HO, 3-hydroxyoctanoate.

Figure 2. Construction of chimeric genes composed of PHA synthase genes from R. eutropha and A. caviae. R1-R8, A1-A8, f and r, indicate the primers used for amplification of the truncated fragments of the PHA synthase genes; f and r, pETMCS-f and pETMCS-r primers, respectively. PRe and TRe, the promoter and terminator regions from R. eutropha phb operon, respectively; phaCch, chimeric PHA synthase gene; phaA, β-ketothiolase gene; phaB, acetoacetylCoA reductase gene; phaJ4, enoyl-CoA hydratase gene.

Figure 3. Immunoblot analysis of crude extracts from recombinant E. coli JM109 harboring the parental and chimeric PHA synthase genes. Lane 1, PhaCRe; lane 2, AcRe12; lane 3, AcRe34; lane 4, AcRe56; lane 5, AcRe78; lane 6, PhaCAc; lane 7, ReAc12; lane 8, ReAc34; lane 9, ReAc56; lane 10, ReAc78; lane 11, negative control (wild-type E. coli). (A) Detected with anti-PhaCRe and (B) detected with anti-PhaCAc; the same samples were loaded on the two gels.

were detected by anti-PhaCAc in a similar manner. The sizes of the PHA synthases, as shown by immunoblotting, agreed with the deduced molecular weight of the chimeric enzymes. The production of chimeras composed of the N-terminal portion of PhaCAc was lower than that of parental PhaCRe, whereas chimeras with the N-terminal of PhaCRe exhibited a higher expression than PhaCAc. These results suggested that N-terminal region of PhaCRe has a positive effect on the production of PHA synthases. P(3HB) production using the chimeric enzymes was investigated. Among the chimeras, AcRe12 produced a significant amount of P(3HB) (40 wt %). The PHA content was comparable to that of the two parental enzymes (38 wt % for PhaCRe and 36 wt % for PhaCAc, respectively). In addition, ReAc12, which has the same junction site, exhibited a trace amount of polymer production, suggesting that the junction site 159 was preferable

for maintaining the activity of the chimeric enzyme. The other chimeras did not produce any detectable polymers. SCL/MCL PHA Production and Molar Mass Analysis. Because AcRe12 exhibited significant activity in producing P(3HB), we next investigated SCL/MCL PHA production using the chimera. The plasmid bearing the AcRe12 chimeric PHA synthase gene along with phaABJ4 genes was introduced into E. coli LS5218. Under this condition, MCL monomers were supplied via the β-oxidation pathway. PhaCRe produced 13 wt % of P(3HB) under the conditions used because PhaCRe is specific to 3HB-CoA (Table 2). In contrast, PhaCAc produced 40 wt % SCL/MCL PHA, consisting of 3HB and 3HHx units, reflecting its broad substrate specificity. AcRe12 chimeric PHA synthase exhibited enhanced PHA accumulation (50 wt %) compared to both parental enzymes. Surprisingly, the chimeric enzyme, which is composed of only 26% of PhaCAc, produced a polymer consisting of 2 mol % of 3HHx and a trace amount of the 3HO unit. Thus, AcRe12 was a superior child, in terms of both high polymer productivity and expanded substrate specificity. Furthermore, the result suggests that the N-terminal region (positions 1-154) of PhaCAc may contribute to the substrate binding of the enzyme. In fact, the Glu130Asp mutation in PHA synthase from Pseudomonas sp. 61-3, although it belongs to class II, affected the activity and substrate specificity of the enzyme.30 In addition, deletion and mutagenesis of the N-terminal region of PhaCRe was reported to affect the productivity of PHA.31 Taken these results together, the N-terminal region of PHA synthase presumably plays an important role in the activity and subsbtrate specificity of the enzyme. Table 2 summarizes the molar masses of the P(3HB) and SCL/MCL PHA produced by the chimeric and parental PHA synthases. The chimeric enzyme AcRe12 produced SCL/MCL PHA with a lower molar mass than the parental enzymes, although the chimera exhibited enhanced PHA accumulation. This result suggests a linkage between the N-terminal structure of PHA synthase and the molar mass of PHAs. Zheng et al. reported that deletion and mutagenesis of the N-terminal region from PhaCRe increased the molar mass of PHA.31 A similar phenomenon was observed in the case of PHA synthase from Aeromonas hydrophila,32 which is homologous to PhaCAc. Thus, the N-terminal region of PHA synthase is presumed to be involved in PHA chain elongation.

Conclusion Among eight chimeras of PhaCRe and PhaCAc, AcRe12 enhanced the production of SCL/MCL PHA compared to the two parental enzymes. From this finding, chimeragenesis is demonstrated to be a useful method to engineer PHA synthases with improved enzymatic properties, for example, activity

Chimeric Class I PHA Synthase

increase and substrate specificity expansion. Predicted secondary structure-based identification of the proper junction site enables assembly of the enzymes to generate functional chimeras, which will broaden the variation of engineered PHA synthases that should eventually lead to an efficient PHA production with desirable properties. In addition, analysis of the chimeric PHA synthase suggested that the N-terminal region contributed to the activity increase and substrate specificity alteration in the enzyme, as well as an alteration in the molar mass of PHA. Accordingly, chimeragenesis adopted here for PHA synthase would provide a versatile strategy to expand the enzymatic function diversity that is available for materials propertydepending practical applications, and obtained chimeric mutant genes can be readily transferred to various living organisms such as practical microbes and plants. Acknowledgment. This study was partly supported by a Grant-in-Aid for Scientific Research of Japan from the Ministry of Education, Culture, Sports, Science, and Technology-Japan Grant 70216828 (to S.T.), the Nagase Science Technology Foundation (to S.T.), and the Global Center of Excellence Program (Project No. B01: Catalysis as the Basis for Innovation in Materials Science) from the Ministry of Education, Culture, Sports, Science, and Technology-Japan. Pacific Edit reviewed the manuscript prior to submission.

References and Notes (1) Doi, Y. Microbial Polyesters; VHC Publishers: New York, 1990. (2) Stubbe, J.; Tian, J.; He, A.; Sinskey, A. J.; Lawrence, A. G.; Liu, P. Annu. ReV. Biochem. 2005, 74, 433–480. (3) Garlotta, D. J. Polym. EnViron. 2001, 9, 63–83. (4) Doi, Y.; Segawa, A.; Kunioka, M. Int. J. Biol. Macromol. 1990, 12, 106–111. (5) Lu¨tke-Eversloh, T.; Fischer, A.; Remminghorst, U.; Kawada, J.; Marchessault, R. H.; Bo¨gershausen, A.; Kalwei, M.; Eckert, H.; Reichelt, R.; Liu, S. J.; Steinbu¨chel, A. Nat. Mater. 2002, 1, 236– 240. (6) Renard, E.; Poux, A.; Timbart, L.; Langlois, V.; Guerin, P. Biomacromolecules 2005, 6, 891–896. (7) Matsusaki, H.; Abe, H.; Doi, Y. Biomacromolecules 2000, 1, 17–22. (8) Taguchi, S.; Tsuge, T. In Protein Engineering Handbook; Lutg, S., Boruscheuer U. T., Eds.; Wiley-VCH: Weinheim, 2008; p 877.

Biomacromolecules, Vol. 10, No. 4, 2009

685

(9) Kichise, T.; Taguchi, S.; Doi, Y. Appl. EnViron. Microbiol. 2002, 68, 2411–2419. (10) Normi, Y. M.; Hiraishi, T.; Taguchi, S.; Abe, H.; Sudesh, K.; Najimudin, N.; Doi, Y. Macromol. Biosci. 2005, 5, 197–206. (11) Takase, K.; Taguchi, S.; Doi, Y. J. Biochem. 2003, 133, 139–145. (12) Tsuge, T.; Watanabe, S.; Sato, S.; Hiraishi, T.; Abe, H.; Doi, Y.; Taguchi, S. Macromol. Biosci. 2007, 7, 846–854. (13) Jo, S. J.; Matsumoto, K.; Leong, C. R.; Ooi, T.; Taguchi, S. J. Biosci. Bioeng. 2007, 104, 457–463. (14) Matsumoto, K.; Nagao, R.; Murata, T.; Arai, Y.; Kichise, T.; Nakashita, H.; Taguchi, S.; Shimada, H.; Doi, Y. Biomacromolecules 2005, 6, 2126–2130. (15) Takase, K.; Matsumoto, K.; Taguchi, S.; Doi, Y. Biomacromolecules 2004, 5, 480–485. (16) Taguchi, S.; Yamada, M.; Matsumoto, K.; Tajima, K.; Satoh, Y.; Munekata, M.; Ohno, K.; Kohda, K.; Shimamura, T.; Kambe, H.; Obata, S. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 17323–17327. (17) Tsuge, T.; Hisano, T.; Taguchi, S.; Doi, Y. Appl. EnViron. Microbiol. 2003, 69, 4830–4836. (18) Nomura, C. T.; Taguchi, S. Appl. Microbiol. Biotechnol. 2007, 73, 969–979. (19) Taguchi, S.; Doi, Y. Macromol. Biosci. 2004, 4, 146–156. (20) Sheu, D. S.; Lee, C. Y. J. Bacteriol. 2004, 186, 4177–4184. (21) Rehm, B. H. A.; Antonio, R. V.; Spiekermann, P.; Amara, A. A.; Steinbu¨chel, A. Biochim. Biophys. Acta, Protein Struct. Mol. Enzymol. 2002, 1594, 178–190. (22) Solaiman, D. K. Y.; Ashby, R. D.; Foglia, T. A. Biotechnol. Lett. 2002, 24, 1011–1016. (23) Niamsiri, N.; Delamarre, S. C.; Kim, Y. R.; Batt, C. A. Appl. EnViron. Microbiol. 2004, 70, 6789–6799. (24) Schubert, P.; Steinbu¨chel, A.; Schlegel, H. G. J. Bacteriol. 1988, 170, 5837–5847. (25) Slater, S.; Voige, W. H.; Dennis, D. E. J. Bacteriol. 1998, 170, 4431– 4436. (26) Fukui, T.; Doi, Y. J. Bacteriol. 1997, 179, 4821–4830. (27) Kato, M.; Bao, H. J.; Kang, C. K.; Fukui, T.; Doi, Y. Appl. Microbiol. Biotechnol. 1996, 45, 363–370. (28) Kusaka, S.; Abe, H.; Lee, S. Y.; Doi, Y. Appl. Microbiol. Biotechnol. 1997, 47, 140–143. (29) Fukui, T.; Yokomizo, S.; Kobayashi, G.; Doi, Y. FEMS Microbiol. Lett. 1999, 170, 69–75. (30) Matsumoto, K.; Takase, K.; Aoki, E.; Doi, Y.; Taguchi, S. Biomacromolecules 2005, 6, 99–104. (31) Zheng, Z.; Li, M.; Xue, X. J.; Tian, H. L.; Li, Z.; Chen, G. Q. Appl. Microbiol. Biotechnol. 2006, 72, 896–905. (32) Ye, Z. Q.; Song, G.; Chen, G. Q.; Chen, J. Y. Biochem. Eng. J. 2008, 41, 67–73.

BM801386J