Article pubs.acs.org/JAFC
Chitosan Controls Postharvest Decay on Cherry Tomato Fruit Possibly via the Mitogen-Activated Protein Kinase Signaling Pathway Danfeng Zhang, Hongtao Wang, Yi Hu, and Yongsheng Liu* School of Biotechnology and Food Engineering, Hefei University of Technology, 193 Tunxi Road, Hefei, Anhui 230009, People’s Republic of China ABSTRACT: The inhibitive effects of chitosan on gray mold caused by Botrytis cinerea on cherry tomato fruit were evaluated. Decay incidence was tested on tomato stored at 22 °C. Hydrogen peroxide accumulation, malondialdehyde (MDA) production, peroxidase (POD) activity, and several related gene expressions (including MPK3, MPK6, PR1a1, and PR5) were determined. Results showed that 0.2% of chitosan solution significantly inhibited the tomato gray mold 3 days after inoculation. Hydrogen peroxide accumulated in the fruit epidermal peel along with chitosan treatment, while MDA production was not increased. POD activity was remarkably enhanced by the application of chitosan. The relative expressions of MPK3, MPK6, and PR1a1 were significantly induced in 10 min after chitosan treatment, while PR5 was induced in 20 min. These findings suggested that the effects of chitosan on inhibiting gray mold in cherry tomato fruit were probably associated with the mitogen-activated protein kinase (MAPK) signaling pathway. KEYWORDS: chitosan, cherry tomato, postharvest, MAPK
■
INTRODUCTION Postharvest decay caused considerable economic losses on fruit and vegetable.1 Many methods have been used to control the postharvest diseases and increase the shelf life. Using synthetic fungicide is the primary strategy for controlling pathogens on harvested fruit and vegetable. However, there is an increased concern about the potential harmful effects on human health and environment by fungicide residues.2,3 The addition of a natural preservative has become a popular strategy to increase the shelf life of fruit and vegetable. Chitin and its deacetylated form, chitosan, have been reported to reduce postharvest diseases on many fruits, including tomato,4 strawberry,5,6 longan,7 dragon fruit,8 jujube,9 and apple.10 Studies have been conducted to illustrate the mechanisms of the effect of chitin or chitosan on fruit preservation. It has indicated that chitin and chitosan had a positive effect on the antagonistic activity of beneficial microorganisms.5,10 Many other studies showed that chitin/chitosan could effectively inhibit postharvest diseases of fruits by directly inhibiting the spore germination, germ tube elongation, and mycelial growth of pathogens11,12 and indirectly inducing defense-related enzymes, including chitinase, β-1,3-glucanase, phenylalanine ammonia-lyase, peroxidase (POD), and polyphenol oxidase.11,13,14 However, the action mode for chitin or chitosan controlling postharvest diseases of fruit is still largely unknown.1 Chitosan, the derivative of fungi cell wall component chitin, could elicit the pathogen-associated molecular patterns (PAMPs) triggered immunity in both plant and animal to recognize the potential pathogens.15 The addition of chitosan could trigger the production of hydrogen peroxide (H2O2), activate phenylalanine ammonia-lyase and chitinase, and increase the transcription of defense-related genes β-1,3glucanase, chitinase, and pathogen-related protein 1 (PR1) in rice cell.16 The expressions of mitogen-activated protein kinase © 2015 American Chemical Society
(MAPK) genes were induced in poplar suspension-cultured cells 5 min after treated with chitosan.17 A similar result had been observed in coconut tissue.18 However, there is little research about chitosan modifying MAPKs expression on harvested fruits against fungal pathogens during storage. The objectives of this study were (i) to investigate if chitosan could activate the MAPK signaling pathway in harvested cherry tomato fruit and (ii) to detect if the chitosan-stimulated reactive oxygen species (ROS) accumulation could result in the oxidative damage of fruit tissue.
■
MATERIALS AND METHODS
Fruit. Cherry tomato (Lycopersicon esculentum) fruits were purchased from market at the mature red stage (surface color of the fruits was red). The fruits with similar sizes and absence of physical injuries were selected. Before treatments, fruits were surface disinfected with 2% sodium hypochlorite for 3 min, washed with tap water, and air-dried.11 Chitosan. Shrimp-shell chitosan with 75% deacetylation was purchased from Sigma-Aldrich. The solution was prepared by dissolving 2 g of chitosan in 1 L of 1% (v/v) acetate by stirring for 24 h at room temperature, and pH was adjusted to 5.0 using 1 mol L−1 NaOH. Pathogen Inoculum. Botrytis cinerea was isolated from infected kiwifruit and identified by morphology and sequence of the internal transcribed spacer (ITS) rDNA region.19 Spores were collected from a 2-week-old culture on potato dextrose agar (PDA) at 25 °C, suspended in sterile distilled water, and filtered through four layers of sterile cheesecloth to remove mycelia. The spore concentration was adjusted to 104 spores mL−1. Effect of Chitosan on Gray Mold of Cherry Tomato Fruit. Cherry tomato fruits were wounded (3 mm deep and 2 mm wide) Received: Revised: Accepted: Published: 7399
March 28, 2015 July 24, 2015 July 29, 2015 July 29, 2015 DOI: 10.1021/acs.jafc.5b01566 J. Agric. Food Chem. 2015, 63, 7399−7404
Article
Journal of Agricultural and Food Chemistry Table 1. Primers Used in qRT-PCR Reactions gene name
accession number
MPK3
NC015443
MPK6
NC015442
PR1a1
NC015438
PR5
NM001247232
UBI3
X58253
primer sequences (5′ → 3′)
Tm (°C)
product length (bp)
F: GGAGTTTTCTGATGTTTACATTGCT R: ATATTCTCGTTCTCTACGTTTGGC F: GGAGACACGTGAGGAAGTAGCT R: GCTGTTGGTTGGAATGAATAATC F: TGCTGGTGCTGTGAAGATGTG R: CAGACTTTACCTGGAGCACACG F:TGAAAAAATTACCAAAATAATAAGCA R: GTTGAAGGGAGACATACATAACACAC F: AGGTTGATGACACTGGAAAGGTT R: AATCGCCTCCAGCCTTGTTGTA
59.2 59.3 57.8 58.4 60.1 60.0 58.0 59.2 60.6 60.0
343 233 81 104 150
Figure 1. (a) Disease incidence and (b) lesion diameter of cherry tomato fruits inoculated with B. cinerea. Cherry tomato fruits treated with 1% acetate solution serviced as the control. Statistical significance of the difference was confirmed according to Duncan’s multiple range test at p < 0.05 (∗, p < 0.05; ∗∗, p < 0.01). Detection of Hydrogen Peroxide in Tomato Epidermal Peel. Cherry tomato was immersed in 0.2% chitosan solution for 10 min, 20 min, 30 min, 1 h, 2 h, and 3 h. Then, the tomato epidermal peel was collected immediately for H2O2 detection and total mRNA extraction. For H2O2 determination, peel samples were stained with 10 μM 2′,7′dichlorodihydrofluorescein diacetate (H2DCFDA, Invitrogen) for 30 min in darkness at 30 °C as the description of Liu et al.23 H2O2 accumulation was examined on a laser confocal microscopy (FV1000, Olympus) at 488 nm excitation and 520 nm emission. For total mRNA extraction, peel samples were stored at −80 °C. Relative gene expressions would be detected in the total mRNA sample. Fruit treated with 1% acetate solution (pH 5.0) serviced as the control. Each treatment contained three replicates with three fruits per replicate, and the experiment was repeated 3 times. RNA Extraction and Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR). The tomato peel samples stored at −80 °C were milled using liquid nitrogen, and total mRNA was extracted using Trizol reagent (Invitrogen) according to the instruction of the manufacturer. About 100 ng of mRNA was used for cDNA synthesis. Real-time qRT-PCR was performed using the cDNA, and the gene-specific primers used were presented in Table 1. Real-time qRT-PCR was performed using Transgen Supermix (TransGen Biotech, Beijing, China) in a StepOne Plus real-time PCR system (Applied Biosystems). The PCR conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 15 s. Melting curve analyses of amplification products were performed at the end of the PCR reaction. The melting cycle was 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. The expression level was normalized by the internal control gene UBI3, using the 2−ΔΔCT method.24 Statistical Analysis. All statistical analyses were performed using SAS 9.2 (Cary, NC). Data were analyzed by one-way analysis of variation (ANOVA). Mean separations were performed by Duncan’s multiple range tests. Least square means (LSMEANS) and standard errors of least-squares means (SEM) were calculated using the LSMEANS. Differences at p < 0.05 were considered to be significant.
with a sterile nail at the equator on two opposite sides, dipped in 0.2% of chitosan solution for 5 min, and then air-dried on a clean bench. A total of 5 μL of spore suspension of B. cinerea was injected into each wound. Because acetate could also attribute to the inhibition of fruit decay,20 we used the fruit treated with 1% acetate solution (pH was adjusted to 5.0) as the control. Treated fruits were put in 200 × 130 × 50 mm plastic boxes with tap water to maintain a high relative humidity (about 80%) and stored at 22 °C. Decay incidence of tomato fruit was determined 3, 5, and 7 days after inoculation. After storage, the disease symptoms and severity (lesion diameter) were recorded. Disease incidence (%) was calculated as follows: disease incidence (%) =
number of infected wounds × 100 total wounds per replicate
Each treatment contained three replicates with 10 fruits per replicate, and the experiment was repeated 3 times. Determination of the Malondialdehyde (MDA) Content and POD Activity in Tomato Fruit Tissue. To determine the MDA content, we conducted two treatments for cherry tomato fruit samples: (i) dipped in 0.2% chitosan solution for 5 min and air-dried, and 1 g of fruit tissue was collected 0, 3, 5, and 7 days after treatment; (ii) immersed in 0.2% chitosan solution for 10 min, 20 min, 30 min, 1 h, 2 h, and 3 h, and 1 g of fruit tissue was collected immediately. Tissue samples were homogenized in 5 mL of 100 mM ice-cold sodium phosphate buffer (pH 6.4) containing 0.1 g of polyvinyl polypyrrolidone (Sigma-Aldrich, St. Louis, MO). The MDA content was determined as the description of Song et al.21 POD activity was determined according to Liu et al. and expressed as units mg−1 of protein, where 1 unit was expressed as the increase rate of absorbency per mass of protein per minute.11 The protein content was determined using bovine serum albumin (Sigma-Aldrich, St. Louis, MO) as the standard.22 Fruit treated with 1% acetate solution (pH 5.0) serviced as the control. Each treatment contained three replicates with three fruits per replicate, and the experiment was repeated 3 times. 7400
DOI: 10.1021/acs.jafc.5b01566 J. Agric. Food Chem. 2015, 63, 7399−7404
Article
Journal of Agricultural and Food Chemistry
■
RESULTS AND DISCUSSION Effects of Chitosan on Postharvest Diseases of Cherry Tomato Fruit. Results in Figure 1a showed that chitosan at the
Figure 3. (a and b) MDA production and (c) POD activity in cherry tomato treated with chitosan. Cherry tomato treated with 1% acetate solution serviced as the control. Statistical significance of the difference was confirmed according to Duncan’s multiple range test at p < 0.05 (∗, p < 0.05).
Figure 2. H2O2 accumulation in cherry tomato epidermal peel with chitosan. Peels were stained with H2DCFDA and observed with a laser confocal microscopy at 488 nm excitation and 520 nm emission. Cherry tomato treated with 1% acetate solution serviced as the control. Bar = 150 μm.
receptors localized on the cell surface as the attack of fungal pathogens, and then ROS was stimulated.27,28 This is one of the earliest cellular responses following successful pathogen recognition.29 ROS include H2O2 and other chemical forms, such as superoxide anion, hydroxyl radical, and peroxyl radical; among them, H2O2 is most stable, although it lasts for no more than 1 s in fresh tissue.30 ROS accumulation has already been observed in Arabidopsis treated with chitosan.31−33 A similar result was observed in sycamore cultured cells.34 In this study, while cherry tomato was treated with 0.2% chitosan for 10 min, H2O2 accumulation in the epidermal peel could be observed; in 20 and 30 min, the fluorescence signal of H2O2 remained strong (Figure 2). However, the H2O2 level was reduced significantly in the treatments in 1 h; and in 3 h, it could hardly be detected (Figure 2). This result indicated that, in the mature tomato fruit peel, H2O2 was stimulated as an early response to chitosan. Zeng et al. reported that, in the navel orange fruit treated with chitosan, the H2O2 content significantly increased and, subsequently, inhibited the postharvest decay.35 The increase
concentration of 0.2% could control gray mold caused by B. cinerea notably 3 days after innoculation (p < 0.05). The disease incidence was reduced by 44.7%. However, at 5 days after innoculation, the difference was not significant (p > 0.05). A previous study showed that chitosan at the concentration of 0.05% could significantly inhibit the decay of citrus fruit caused by B. cinerea.25 Liu et al. reported that 0.5% of chitosan could significantly decrease decay incidence of tomato fruit after 3 days of storage at 25 °C.11 It suggested that chitosan inhibits the tomato gray mold depending upon the dosage. The lesion diameter on the fruit was also observed, and it was lower on the chitosan treatment than the control after 5 days of storage (Figure 1b), in accordance with previous studies that chitosan could reduce decay on fruits.10,26 Effect of Chitosan on ROS Accumulation in Cherry Tomato Fruit Epidermal Peel. Chitosan was recognized by 7401
DOI: 10.1021/acs.jafc.5b01566 J. Agric. Food Chem. 2015, 63, 7399−7404
Article
Journal of Agricultural and Food Chemistry
Figure 4. Relative expression of (a) MPK3, (b) MPK6, (c) PR1a1, and (d) PR5 in cherry tomato epidermal peel treated with chitosan. UBI3 was used as the internal control gene. Cherry tomato treated with 1% acetate solution serviced as the control. Statistical significance of the difference was confirmed according to Duncan’s multiple range test at p < 0.05 (∗, p < 0.05; ∗∗, p < 0.01).
was significantly higher than that in the control (p < 0.05); this might explain the decrease of the MDA content 5 days after treatment. However, it was reduced after 7 days and had no difference compared to the control (p > 0.05). In the control, the POD activity also increased markedly during storage, in agreement with a previous report that the POD activity was increased dramatically in grape fruit treated with deionized water at pH 5.6.26 Effect of Chitosan on MPK3/MPK6 and PR Transcripts in Cherry Tomato Fruit Epidermal Peel. MAPK cascades are major components downstream of receptors that can rapidly transduce stress signals into intracellular responses in all eukaryotes.15 MAPK cascade activation is one of the earliest signaling events while the plant interacts with PAMPs. Many of the known PAMPs were shown to activate MAPKs, e.g., flagellin,43 peptidoglycan,44 and chitin.45,46 PAMPs are recognized by pattern recognition receptors on the plasma membrane, and intracellular immune responses are immediately initiated.47 Several chitin/chitosan receptors have been identified in Arabidopsis.48−50 The cascades mainly composed of a MAPK kinase kinase, a MAPK kinase, and a MAPK link upstream receptors to downstream targets involved in the regulation of development, growth, and programmed cell death and in responses to a diversity of environmental stimuli.15 MPK3 and MPK6 are key players and make positive effects in the defense response to bacterial and fungal pathogens. They show a high level of functional redundancy.15 In this experiment, the relative expression level of MPK3 was induced 10 min after treatment, reached the highest level at 20 min,
of the H2O2 content was believed to promote resistance of apple fruit to Penicillium expansum.36 Therefore, the improvement of the H2O2 level might serve as an important signaling molecule to activate plant defense-related genes in cherry tomato fruit. Effect of Chitosan on the MDA Content and POD Activity in Cherry Tomato Fruit Tissue. In the past, ROS was always considered to contribute to the senescence of harvested fruit.37,38 ROS in peach petals induced by Monilinia fructicola resulted in oxidative damage in host tissues,23 which might enhance the infection by necrotrophic pathogen. Therefore, the content of ROS must be maintained at a nontoxic level, and ROS producing/scavenging enzymes were involved in the maintaining of this balance.39 MDA, a decomposition product of polyunsaturated fatty acid hydroperoxides, is often used as a marker for monitoring lipid peroxidation caused by oxidative damage.40 In our study, the MDA content in fruit treated by chitosan was not different with the control (panels a and b of Figure 3; p > 0.05), indicating that the instantaneous H2O2 accumulated in the epidermal peel had no effect on the oxidation of fruit tissue. After 5 days of storage, the MDA content was even lower than that in the control (p < 0.05). This might be ascribed to the increasing activities of catalase and POD, which were crucial for suppressing the toxic ROS level.30 Figure 3c showed that the POD activity was enhanced notably with the addition of chitosan (p < 0.05), in agreement with the previous studies on tomato, sweet cherry, and peach.11,41,42 After 3 days, POD activity in chitosan treatment 7402
DOI: 10.1021/acs.jafc.5b01566 J. Agric. Food Chem. 2015, 63, 7399−7404
Article
Journal of Agricultural and Food Chemistry
(3) Sharma, R. R.; Singh, D.; Singh, R. Biological control of postharvest diseases of fruits and vegetables by microbial antagonists: A review. Biol. Control 2009, 50, 205−221. (4) Badawy, M. E. I.; Rabea, E. I. Potential of the biopolymer chitosan with different molecular weights to control postharvest gray mold of tomato fruit. Postharvest Biol. Technol. 2009, 51, 110−117. (5) Ge, L.; Zhang, H.; Chen, K.; Ma, L.; Xu, Z. Effect of chitin on the antagonistic activity of Rhodotorula glutinis against Botrytis cinerea in strawberries and the possible mechanisms involved. Food Chem. 2010, 120, 490−495. (6) Romanazzi, G.; Feliziani, E.; Santini, M.; Landi, L. Effectiveness of postharvest treatment with chitosan and other resistance inducers in the control of storage decay of strawberry. Postharvest Biol. Technol. 2013, 75, 24−27. (7) Jiang, Y.; Li, Y. Effects of chitosan coating on postharvest life and quality of longan fruit. Food Chem. 2001, 73, 139−143. (8) Ali, A.; Zahid, N.; Manickam, S.; Siddiqui, Y.; Alderson, P. G.; Maqbool, M. Effectiveness of submicron chitosan dispersions in controlling anthracnose and maintaining quality of dragon fruit. Postharvest Biol. Technol. 2013, 86, 147−153. (9) Wang, L.; Wu, H.; Qin, G.; Meng, X. Chitosan disrupts Penicillium expansum and controls postharvest blue mold of jujube fruit. Food Control 2014, 41, 56−62. (10) Lu, H.; Lu, L.; Zeng, L.; Fu, D.; Xiang, H.; Yu, T.; Zheng, X. Effect of chitin on the antagonistic activity of Rhodosporidium paludigenum against Penicillium expansum in apple fruit. Postharvest Biol. Technol. 2014, 92, 9−15. (11) Liu, J.; Tian, S.; Meng, X.; Xu, Y. Effects of chitosan on control of postharvest diseases and physiological responses of tomato fruit. Postharvest Biol. Technol. 2007, 44, 300−306. (12) de Oliveira, C. E.; Magnani, M.; de Sales, C. V.; de Souza Pontes, A. L.; Campos-Takaki, G. M.; Stamford, T. C.; de Souza, E. L. Effects of post-harvest treatment using chitosan from Mucor circinelloides on fungal pathogenicity and quality of table grapes during storage. Food Microbiol. 2014, 44, 211−219. (13) Zhang, D.; Quantick, P. C. Antifungal effects of chitosan coating on fresh strawberries and raspberries during storage. J. Hortic. Sci. Biotechnol. 1998, 73, 763−767. (14) Romanazzi, G.; Nigro, F.; Ippolito, A.; Di Venere, D.; Salerno, M. Effects of pre- and postharvest chitosan treatments to control storage grey mould of table grapes. J. Food Sci. 2002, 67, 1862−1867. (15) Pitzschke, A.; Schikora, A.; Hirt, H. MAPK cascade signalling networks in plant defence. Curr. Opin. Plant Biol. 2009, 12, 421−426. (16) Lin, W.; Hu, X.; Zhang, W.; John Rogers, W.; Cai, W. Hydrogen peroxide mediates defence responses induced by chitosans of different molecular weights in rice. J. Plant Physiol. 2005, 162, 937−944. (17) Hamel, L. P.; Miles, G. P.; Samuel, M. A.; Ellis, B. E.; Séguin, A.; Beaudoin, N. Activation of stress-responsive mitogen-activated protein kinase pathways in hybrid poplar (Populus trichocarpa × Populus deltoides). Tree Physiol. 2005, 25, 277−288. (18) Lizama-Uc, G.; Estrada-Mota, I. A.; Caamal-Chan, M. G.; SouzaPerera, R.; Oropeza-Salín, C.; Islas-Flores, I.; Zúñiga-Aguilar, J. J. Chitosan activates a MAP-kinase pathway and modifies abundance of defense-related transcripts in calli of Cocos nucifera L. Physiol. Mol. Plant Pathol. 2007, 70, 130−141. (19) Grant-Downton, R. T.; Terhem, R. B.; Kapralov, M. V.; Mehdi, S.; Rodriguez-Enriquez, M. J.; Gurr, S. J.; van Kan, J. A. L.; Dewey, F. M. A novel Botrytis species is associated with a newly emergent foliar disease in cultivated. PLoS One 2014, 9, e89272. (20) Sholberg, P. L.; Shephard, T.; Randall, P.; Moyls, L. Use of measured concentrations of acetic acid vapour to control postharvest decay in d’Anjou pears. Postharvest Biol. Technol. 2004, 32, 89−98. (21) Song, H.; Fan, P.; Li, Y. Overexpression of organellar and cytosolic AtHSP90 in Arabidopsis thaliana impairs plant tolerance to oxidative stress. Plant Mol. Biol. Rep. 2009, 27, 342−349. (22) Bradford, M. N. A rapid and sensitive method for the quantitation of microgram quantities of protein using the principle of protein−dye binding. Anal. Biochem. 1976, 72, 248−254.
which was 11 times higher than that in the control (p < 0.05), and reduced to the basal level 3 h after treatment (Figure 4a). The expression of MPK6 was also induced in 10 min (p < 0.05) and reached the highest level at 1 h. At 3 h after treatment, the expression level of MPK6 was significantly decreased (Figure 4b). The activated MPK3/MPK6 is followed by a series of modifications of the cell, including the synthesis of pathogeninduced synthesis of PR proteins (e.g., β-1,3-glucanases and chitinases),15,51 lignin deposition,52 and phytoalexin (e.g., camalexin) synthesis.53 PR genes play an important role in plant defense responses and have been widely used as a marker of downstream immune signaling.54 They are classified into 17 families.55 In our study, PR1a1 and PR5 were selected to detect the defense response in tomato fruit peel. The expression of PR1a1 was also induced in 10 min (p < 0.05) and reached the highest level at 20 min, about 24 times higher than the control (p < 0.01; Figure 4c), while the expression of PR5 was induced in 20 min (p < 0.05) and reached the highest level at 30 min (p < 0.01; Figure 4d). This might be one of the reasons that the disease severity was notably lower on fruits treated by chitosan. Additionally, we had also determined two other PR genes, PRP2 and PR-P4; however, they were not induced (data not shown), indicating that not all PR genes were induced in response to the chitosan-triggered defense. The regulation of the PR1 gene is considered to depend upon the salicylic acid signaling pathway and correlated with the onset of systemic acquired resistance.54 It was reported that salicylic acid improved the activities of the main defense-related enzymes, including phenylalanine ammonia-lyase, POD, chitinase, and β-1,3-glucanase in jujube fruit and, consequently, enhanced the fruit resistance.56 In conclusion, this study showed that 0.2% of chitosan could induce the accumulation of ROS and the expressions of MPK3, MPK6, PR1, and PR5 genes in cherry tomato peel. The result suggested that the MAPK signaling pathway was possibly activated in the cherry tomato fruit treated with chitosan. This might be one of the molecular mechanisms that the resistance to fungal pathogens of fruit was enhanced by chitosan. However, the complete cascade stimulated by chitosan on tomato contains the specific MAPK kinase kinase, and MAPK kinase upstream of MPK3/MPK6 should be further identified.
■
AUTHOR INFORMATION
Corresponding Author
*Telephone: 86-187-0983-2886. Fax: +86-551-6290-1516. Email:
[email protected]. Funding
The authors thank the China Postdoctoral Science Foundation (113-471015) and the National Natural Science Foundation of China (31461143008). Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Zhang, H.; Li, R.; Liu, W. Effects of chitin and its derivative chitosan on postharvest decay of fruits: A review. Int. J. Mol. Sci. 2011, 12, 917−934. (2) Droby, S.; Wisniewski, M.; Macarisin, D.; Wilson, C. Twenty years of postharvest biocontrol research: is it time for a new paradigm? Postharvest Biol. Technol. 2009, 52, 137−145. 7403
DOI: 10.1021/acs.jafc.5b01566 J. Agric. Food Chem. 2015, 63, 7399−7404
Article
Journal of Agricultural and Food Chemistry
signalling cascade in Arabidopsis innate immunity. Nature 2002, 415, 977−983. (44) Gust, A. A.; Biswas, R.; Lenz, H. D.; Rauhut, T.; Ranf, S.; Kemmerling, B.; Gö tz, F.; Glawischnig, E.; Lee, J.; Felix, G.; Nürnberger, T. Bacteria-derived peptidoglycans constitute pathogenassociated molecular patterns triggering innate immunity in Arabidopsis. J. Biol. Chem. 2007, 282, 32338−32348. (45) Wan, J.; Zhang, S.; Stacey, G. Activation of a mitogen-activated protein kinase pathway in Arabidopsis by chitin. Mol. Plant Pathol. 2004, 5, 125−135. (46) Kaku, H.; Nishizawa, Y.; Ishii-Minami, N.; Akimoto-Tomiyama, C.; Dohmae, N.; Takio, K.; Minami, E.; Shibuya, N. Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 11086− 11091. (47) Zipfel, C. Pattern-recognition receptors in plant innate immunity. Curr. Opin. Immunol. 2008, 20, 10−16. (48) Miya, A.; Albert, P.; Shinya, T.; Desaki, Y.; Ichimura, K.; Shirasu, K.; Narusaka, Y.; Kawakami, N.; Kaku, H.; Shibuya, N. CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 2007, 104, 19613−19618. (49) Liu, T.; Liu, Z.; Song, C.; Hu, Y.; Han, Z.; She, J.; Fan, F.; Wang, J.; Jin, C.; Chang, J.; Zhou, J. M.; Chai, J. Chitin-induced dimerization activates a plant immune receptor. Science 2012, 336, 1160−1164. (50) Cao, Y.; Liang, Y.; Tanaka, K.; Nguyen, C. T.; Jedrzejczak, R. P.; Joachimiak, A.; Stacey, G. The kinase LYK5 is a major chitin receptor in Arabidopsis and forms a chitin-induced complex with related kinase CERK1. eLife 2014, 3, e03766. (51) Djamei, A.; Pitzschke, A.; Nakagami, H.; Rajh, I.; Hirt, H. Trojan horse strategy in Agrobacterium transformation: Abusing MAPK defense signaling. Science 2007, 318, 453−456. (52) Morse, A. M.; Whetten, R. W.; Dubos, C.; Campbell, M. M. Post-translational modification of an R2R3-MYB transcription factor by a MAP Kinase during xylem development. New Phytol. 2009, 183, 1001−1013. (53) Ren, D.; Liu, Y.; Yang, K. Y.; Han, L.; Mao, G.; Glazebrook, J.; Zhang, S. A fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 2008, 105, 5638−5643. (54) Durrant, W. E.; Dong, X. Systemic acquired resistance. Annu. Rev. Phytopathol. 2004, 42, 185−209. (55) van Loon, L. C.; Rep, M.; Pieterse, C. M. J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135−162. (56) Cao, J.; Yan, J.; Zhao, Y.; Jiang, W. Effects of postharvest salicylic acid dipping on Alternaria rot and disease resistance of jujube fruit during storage. J. Sci. Food Agric. 2013, 93, 3252−3258.
(23) Liu, J.; Macarisin, D.; Wisniewski, M.; Sui, Y.; Droby, S.; Norelli, J.; Hershkovitz, V. Production of hydrogen peroxide and expression of ROS-generating genes in peach flower petals in response to host and non-host fungal pathogens. Plant Pathol. 2013, 62, 820−828. (24) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt Method. Methods 2001, 25, 402−408. (25) Chien, P. J.; Sheu, F.; Lin, H. R. Coating citrus (Murcott tangor) fruit with low molecular weight chitosan increases postharvest quality and shelf life. Food Chem. 2007, 100, 1160−1164. (26) Meng, X.; Li, B.; Liu, J.; Tian, S. Physiological responses and quality attributes of table grape fruit to chitosan preharvest spray and postharvest coating during storage. Food Chem. 2008, 106, 501−508. (27) Bradley, D. J.; Kjellbom, P.; Lamb, C. J. Elicitor- and woundinduced oxidative cross-linking of a proline-rich plant cell wall protein: A novel, rapid defense response. Cell 1992, 70, 21−30. (28) Bueter, C. L.; Specht, C. A.; Levitz, S. M. Innate sensing of chitin and chitosan. PLoS Pathog. 2013, 9, e1003080. (29) Torres, M. A.; Jones, J. D. G.; Dangl, J. L. Reactive oxygen species signaling in response to pathogens. Plant Physiol. 2006, 141, 373−378. (30) Sharma, P.; Jha, A. B.; Dubey, R. S.; Pessarakli, M. Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J. Bot. 2012, 2012, 1−26. (31) Khokon, M. A. R.; Uraji, M.; Munemasa, S.; Okuma, E.; Nakamura, Y.; Mori, I. C.; Murata, Y. Chitosan-induced stomatal closure accompanied by peroxidase-mediated reactive oxygen species production in Arabidopsis. Biosci., Biotechnol., Biochem. 2010, 74, 2313−2315. (32) Povero, G.; Loreti, E.; Pucciariello, C.; Santaniello, A.; Di Tommaso, D.; Di Tommaso, G.; Kapetis, D.; Zolezzi, F.; Piaggesi, A.; Perata, P. Transcript profiling of chitosan-treated Arabidopsis seedlings. J. Plant Res. 2011, 124, 619−629. (33) Feng, H.; Xia, W.; Shan, C.; Zhou, T.; Cai, W.; Zhang, W. Quaternized chitosan oligomers as novel elicitors inducing protection against B. cinerea in Arabidopsis. Int. J. Biol. Macromol. 2015, 72, 364− 369. (34) Malerba, M.; Crosti, P.; Cerana, R. Defense/stress responses activated by chitosan in sycamore cultured cells. Protoplasma 2012, 249, 89−98. (35) Zeng, K.; Deng, Y.; Ming, J.; Deng, L. Induction of disease resistance and ROS metabolism in navel oranges by chitosan. Sci. Hortic. 2010, 126, 223−228. (36) Torres, R.; Valentines, M. C.; Usall, J.; Viñas, I.; Larrigaudiere, C. Possible involvement of hydrogen peroxide in the development of resistance mechanisms in ‘Golden Delicious’ apple fruit. Postharvest Biol. Technol. 2003, 27, 235−242. (37) Qin, G.; Meng, X.; Wang, Q.; Tian, S. Oxidative damage of mitochondrial proteins contributes to fruit senescence: a redox proteomics analysis. J. Proteome Res. 2009, 8, 2449−2462. (38) Tian, S.; Qin, G.; Li, B. Reactive oxygen species involved in regulating fruit senescence and fungal pathogenicity. Plant Mol. Biol. 2013, 82, 593−602. (39) Baxter, A.; Mittler, R.; Suzuki, N. ROS as key players in plant stress signaling. J. Exp. Bot. 2014, 65, 1229−1240. (40) Bailly, C.; Benamar, A.; Corbineau, F.; Côme, D. Changes in malondialdehyde content and in superoxide dismutase, catalase and glutathione reductase activities in sunflower seeds as related to deterioration during accelerated aging. Physiol. Plant. 1996, 97, 104− 110. (41) Dang, Q. F.; Yan, J. Q.; Li, Y.; Cheng, X. J.; Liu, C. S.; Chen, X. G. Chitosan acetate as an active coating material and its effects on the storing of Prunus avium L. J. Food Sci. 2010, 75, S125−131. (42) Ma, Z.; Yang, L.; Yan, H.; Kennedy, J. F.; Meng, X. Chitosan and oligochitosan enhance the resistance of peach fruit to brown rot. Carbohydr. Polym. 2013, 94, 272−277. (43) Asai, T.; Tena, G.; Plotnikova, J.; Willmann, M. R.; Chiu, W. L.; Gomez-Gomez, L.; Boller, T.; Ausubel, F. M.; Sheen, J. MAP kinase 7404
DOI: 10.1021/acs.jafc.5b01566 J. Agric. Food Chem. 2015, 63, 7399−7404
