Cholesterol-Lowering Activity of Sesamin Is Associated with Down

Mar 9, 2015 - It was concluded that the cholesterol-lowering activity of sesamin was ... of sterols and modulating the genes involved in cholesterol a...
0 downloads 0 Views 799KB Size
Download PDF
Article pubs.acs.org/JAFC

Cholesterol-Lowering Activity of Sesamin Is Associated with Down-Regulation on Genes of Sterol Transporters Involved in Cholesterol Absorption Yin Tong Liang,† Jingnan Chen,‡ Rui Jiao,# Cheng Peng,† Yuanyuan Zuo,† Lin Lei,† Yuwei Liu,† Xiaobo Wang,† Ka Ying Ma,† Yu Huang,§ and Zhen-Yu Chen*,† †

Food and Nutritional Sciences Programme, School of Life Sciences, The Chinese University of Hong Kong, Shatin, NT, Hong Kong, China ‡ Lipids Technology and Engineering, College of Food Science and Technology, Henan University of Technology, Zhengzhou, Henan, China # Department of Food Science and Engineering, Jinan University, Guangzhou, China § School of Biomedical Sciences, Chinese University of Hong Kong, Shatin, NT, Hong Kong, China ABSTRACT: Sesame seed is rich in sesamin. The present study was to (i) investigate the plasma cholesterol-lowering activity of dietary sesamin and (ii) examine the interaction of dietary sesamin with the gene expression of sterol transporters, enzymes, receptors, and proteins involved in cholesterol metabolism. Thirty hamsters were divided into three groups fed the control diet (CON) or one of two experimental diets containing 0.2% (SL) and 0.5% (SH) sesamin, respectively, for 6 weeks. Plasma total cholesterol (TC) levels in hamsters given the CON, SL, and SH diets were 6.62 ± 0.40, 5.32 ± 0.40, and 5.00 ± 0.44 mmol/L, respectively, indicating dietary sesamin could reduce plasma TC in a dose-dependent manner. Similarly, the excretion of total fecal neutral sterols was dose-dependently increased with the amounts of sesamin in diets (CON, 2.65 ± 0.57; SL, 4.30 ± 0.65; and SH, 5.84 ± 1.27 μmol/day). Addition of sesamin into diets was associated with down-regulation of mRNA of intestinal Niemann−Pick C1 like 1 protein (NPC1L1), acyl-CoA:cholesterol acyltransferase 2 (ACAT2), microsomal triacylglycerol transport protein (MTP), and ATP-binding cassette transporters subfamily G members 5 and 8 (ABCG5 and ABCG8). Results also showed that dietary sesamin could up-regulate hepatic cholesterol-7α-hydroxylase (CYP7A1), whereas it down-regulated hepatic 3-hydroxy-3-methyl-glutaryl-CoA (HMG-CoA) reductase and liver X receptor alpha (LXRα). It was concluded that the cholesterol-lowering activity of sesamin was mediated by promoting the fecal excretion of sterols and modulating the genes involved in cholesterol absorption and metabolism. KEYWORDS: ABCG, ACAT2, cholesterol, NPC1L1, sesamin

■

synergistically reduce plasma TC with α-tocopherol.7 With regard to the possible mechanisms, it was reported that dietary sesamin down-regulated the activity and gene expression of 3-hydroxy-3-methyl-glutaryl-CoA (HMG-CoA) reductase in rats.8 When rats were given a diet containing 0.5% sesamin, they had an increase in fecal excretion of neutral sterols, suggesting sesamin decreased cholesterol absorption.9 In addition, sesamin had been shown to be capable of increasing fatty acid oxidation in vivo, leading to a reduction in body fat.10,11 It remains largely unknown how dietary sesamin affects the cholesterol absorption pathway. Absorption of cholesterol is a complex process (Figure 1). In brief, about total 1200− 1700 mg of cholesterol enters the lumen of the small intestine with 300−500 mg coming from the diet and the remainder portion deriving from bile each day.12−15 First, cholesterol absorption starts with intestinal Niemann−Pick C1 like 1 protein (NPC1L1), which transports free cholesterol from the lumen

INTRODUCTION Hypercholesterolemia is a known risk factor for coronary heart disease. Interest in using the natural compounds to manage hypercholesterolemia is increasing. In this regard, a group of compounds called lignans is on the list. Lignans refer to a group of bioactive and noncaloric phenolic compounds found in plants mainly including sesame, flax, barley, buckwheat, millet, oats, rye, nuts, and legumes.1 Among these foods, sesame seed is one of the most abundant plants rich in lignans, with sesamin being the major isomer.2,3 Sesamin as a natural cholesterol-lowering supplement is very promising. A meta-analysis on published data has clearly suggested that lignans in general can reduce both plasma total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) in humans.4 A study on the anti-hypercholesterolemia activity of sesame in humans suggests that sesamin can reduce plasma TC concentration, especially LDL-C, without having any effect on triacylglycerols (TG) and high-density lipoprotein cholesterol (HDL-C).5 In a randomized, placebo-controlled and crossover study, postmenopausal women daily given 50 g of sesame seed decreased not only their plasma TC and LDL-C but also their oxidized LDL concentrations.6 When rats were given an atherogenic diet, it was found that sesamin could © 2015 American Chemical Society

Received: Revised: Accepted: Published: 2963

December 30, 2014 March 1, 2015 March 9, 2015 March 9, 2015 DOI: 10.1021/jf5063606 J. Agric. Food Chem. 2015, 63, 2963−2969

Article

Journal of Agricultural and Food Chemistry

and liver X receptor alpha (LXRα).20,21 SREBP-2 controls the gene expressions of LDL receptor and HMG-CoA reductase. LDL receptor is responsible for the removal of LDL-C from circulation, whereas HMG-CoA reductase is a rate-limiting enzyme in the cholesterol synthesis pathway. LXRα is a sensor of cholesterol concentration in the liver and governs the gene expression of hepatic cholesterol-7α-hydroxylase (CYP7A1), a key enzyme in bile acid synthesis. The excess cholesterol in the liver is partially removed by being converted to bile acids. To date, there is no study that has examined the effect of dietary sesamin on gene expression of these transcript factors, enzymes, or receptor involved in maintaining cholesterol homeostasis. The present study was therefore designed to (i) investigate if dietary sesamin could reduce plasma TC in a dose-dependent manner and (ii) examine the interaction of dietary sesamin with the gene expressions of hepatic SREBP-2, LXRα, HMGCoA reductase, LDL receptor, and CYP7A1 as well as intestinal NPC1L1, ACAT2, MTP, and ABCG5 and ABCG8.

■

Figure 1. Structure of sesamin and cholesterol absorption pathway. Dietary and biliary cholesterol (C) is transported into enterocytes by Niemann−Pick C1 like 1 transporter (NPC1L1). Acyl-CoA:cholesterol acyltransferase 2 (ACAT2) esterifies cholesterol to form cholesteryl ester (CE), which is then packed into chylomicrons (CMs) by microsomal triacylglycerols transport protein (MTP). CMs containing CE are then transferred into blood through the lymphatic system. ATP binding cassette transporters (ABCG5 and ABCG8) return the unabsorbed cholesterol to the lumen of intestine. Cholesterol in the large intestine is converted to coprostanol and other derivatives by bacteria.

MATERIALS AND METHODS

Chemicals and Diet Ingredients. Sesamin with a purity of 93% was purchased from KEB Biotechnology (Beijing, China). Casein, mineral mix, and vitamin mix were purchased from Harlan Teklad (Madison, WI, USA). Cholesterol and DL-methionine were purchased from Sigma-Aldrich (St. Louis, MO, USA). Lard was obtained from Hop Hing Oils & Fats Ltd. (Hong Kong, China). Preparation of Diets. The three diets were prepared with some modification of AIN-93 Purified Diet for Laboratory Rodents. The control diet (CON) was prepared by mixing the following ingredients (g): cornstarch, 508; casein, 242; lard, 50; sucrose, 119; mineral mix, 40, vitamin mix, 20; DL-methionine, 1; cholesterol, 1. The two experimental diets were formulated by adding 0.2% (SL) or 0.5% (SH) sesamin into the control diet, respectively. The total cholesterol content in the three diets was actually 1.05 mg/kg as lard contained 90 mg cholesterol/100 g. The rationale for adding cholesterol at 0.1% was because such a level could induce a rise in plasma TC to reach >6.2 mM, which is similar to human hypercholesterolemia.22 Hamsters. Male Golden Syrian hamsters (n = 30) were divided into three groups (n = 10 each) and fed one of the three diets formulated above. Hamsters were housed in an animal room at 23 °C with 12/12 h light/dark cycles. The fresh diets were given daily, and body weight was recorded twice a week. The hamsters were fed ad libitum. At weeks 0, 3 and 6, about 100 μL of blood from each hamster was taken from the retro-orbital sinus under inhalational anesthesia of isoflurane after overnight fasting. At the end of week 6, all of the hamsters were killed with the liver being removed for the mRNA analyses of SREPB-2, LXRα, LDL receptor, HMG-CoA reductase, and CYP7A1. The first 40 cm of the small intestine was kept for the

into enterocytes.16 Second, intestinal acyl-CoA:cholesterol acyltransferase 2 (ACAT2) subsequently converts the free cholesterol to cholesteryl ester (CE) followed by the action of microsomal triacylglycerol transport protein (MTP), which packs CE into chylomicrons (CM). 17 Third, CM are transferred into blood through the lymphatic system. Finally, ATP-binding cassette transporter subfamily G members 5 and 8 (ABCG5 and ABCG8) return the unabsorbed free cholesterol left in the enterocytes to the lumen for excretion.18,19 Although some research has addressed the effect of sesamin on plasma cholesterol, no study to date has investigated the effect of dietary sesamin on gene expression of intestinal NPC1L1, ACAT2, MTP, ABCG5, and ABCG8 (Figure 1). A systematic investigation concerning the effect of sesamin on cholesterol metabolism is also lacking. Cholesterol homeostasis is partially regulated by two different transcription factors, namely, sterol regulatory element-binding protein 2 (SREBP-2)

Table 1. Quantitative Real-Time PCR Primers Used To Measure the mRNA Levels of Genes Involved in Cholesterol Absorption and Homeostasis in Hamster Liver and Intestine gene GAPDH CYP7A1 HMGR LDL-R SREBP-2 NPC1L1 ABCG5 ABCG8 ACAT2 MTP

accession no. DQ403055 L04690 X00494 M94387 U12330

forward primer 5′ 3′ GAACATCATCCCTGCATCCA GGTAGTGTGCTGTTGTATATGGGTTA CGAAGGGTTTGCAGTGATAAAGGA GCCGGGACTGGTCAGATG GGACTTGGTCATGGGAACAGATG CCTGACCTTTATAGAACTCACCACAGA TGATTGGCAGCTATAATTTTGGG TGCTGGCCATCATAGGGAG CCGAGATGCTTCGATTTGGA GTCAGGAAGCTGTGTCAGAATG

reverse primer 5′ 3′ TaqMan CCAGTGAGCTTCCCGTTCA ACAGCCCAGGTATGGAATCAAC GCCATAGTCACATGAAGCTTCTGTA ACAGCCACCATTGTTGTCCA TGTAATCAATGGCCTTCCTCAGAAC SYBRGreen GGGCCAAAATGCTCGTCAT GTTGGGCTGCGATGGAAA TCCTGATTTCATCTTGCCACC GTGCGGTAGTAGTTGGAGAAGGA CTCCTTTTTCTCTGGCTTTTCA 2964

TaqMan probe 5′ CTTGCCCACAGCCTTGGCAGC CACCTGCTTTCCTTCTCC ACGTGCGAATCTGCT GCACTCATTGGTCCTGCAGTCCTT CCAAGATGCACAAATC

DOI: 10.1021/jf5063606 J. Agric. Food Chem. 2015, 63, 2963−2969

Article

Journal of Agricultural and Food Chemistry

Determination of Fecal Cholesterol, Coprostanol, and Other Neutral and Acidic Sterols. Fecal cholesterol, coprostanol, other neutral and acidic sterols were determined as previously described.22−24 5α-Cholestane and hyodeoxycholic acid were added into the fecal samples as internal standards to quantify the amount of total neutral and acidic sterols, respectively. In brief, the dried fecal samples were hydrolyzed and extracted with cyclohexane. Neutral sterols in cyclohexane extract were dried and converted into their corresponding TMS derivatives. Acidic sterols in the bottom aqueous layer left after cyclohexane extraction were saponified, extracted, and similarly converted to their corresponding TMS derivatives. Both neutral and acidic sterol TMS derivatives were then subjected to the GC analysis. Real-Time PCR Analysis of Intestinal NPC1L1, ACAT2, ABCG5, ABCG8, and MTP and Hepatic SREBP-2, LXRα, CYP7A1, HMG-CoA Reductase, and LDL Receptor. mRNA for each target gene was quantified as previously described.22−25 In brief, the total RNA in the intestine or the liver was extracted followed by transcription to complementary DNA (cDNA) using a high-capacity cDNA reverse transcription kit (Invitrogen, Carlsbad, CA, USA). Reverse transcription was then carried out followed by the real-time PCR analysis on a Fast Real-time PCR System 7500 (Applied Biosystems, Foster City, CA, USA). The expression of NPC1L1, ACAT-2, ABCG5, ABCG8, and MTP was normalized with cyclophilin, whereas that of hepatic SREBP-2, LXRα, CYP7A1, HMG-CoA reductase, and LDL receptor was normalized with GAPDH. Each primer and TaqMan probe (Table 1) was obtained from Applied Biosystems. Real-time PCR was performed using a TaqMan Fast Universal PCR Master Mix. Data were analyzed using Sequence Detection Software version 1.3.1.21. Statistical Analysis. One-way analysis of variance (ANOVA) followed by post hoc LSD test was used to statistically evaluate differences in lipoproteins, gene expression of transcription factors, sterol transporters, and enzymes involved in the cholesterol metabolism among the three groups. A simple linear regression analysis was carried out to assess the dose-dependent activity of sesamin using SPSS (PASW Statistics for Windows, version 18.0, Chicago, IL, USA).

mRNA analyses of NPC1L1, ACAT-2, MTP, ABCG5, and ABCG8. All samples were stored in a −80 °C freezer prior to analysis. All of the feces from each hamster at weeks 1, 3, and 6 were pooled, freeze-dried, ground, and saved for neutral and acidic sterol analyses. The whole experimental procedure was approved by the Animal Experimental Ethical Committee, The Chinese University of Hong Kong. Analysis of Plasma Lipoproteins. Plasma TC, high-density lipoprotein cholesterol (HDL-C), non-HDL-C, and TG were measured using the commercial enzymatic kits from Infinity (Waltham, MA, USA) and Stanbio Laboratories (Boerne, TX, USA), respectively.23 Analysis of Cholesterol in the Liver. Cholesterol in the liver was analyzed as previously described.22,24 In brief, the total lipids were extracted from 300 mg of sample using a solvent of chloroform/ methanol (2:1, v/v) with 5α-cholestane being added as an internal standard. The extract was then subjected to cold saponification at room temperature. Nonsaponifiable materials were extracted into hexane followed by TMS derivatization. The cholesterol TMS-ether derivative was analyzed in a SAC-5 column in a Shimadzu GC-14B equipped with a FID detector (Shimadzu, Tokyo, Japan).

Table 2. Food Consumption, Body Weight, and Organ Weights in Male Golden Syrian Hamsters Fed the Control (CON) or One of the Two Experimental Diets Containing 0.2% Sesamin (SL) or 0.5% Sesamin (SH), Respectivelya food intake (g) body wt (g) initial final absolute organ wt (g) liver kidney heart testis epididymal fat pad perirenal fat pad a

CON

SL

SH

9.9 ± 0.7

9.9 ± 1.2

10.0 ± 1.1

110 ± 7 122 ± 8

109 ± 9 125 ± 9

110 ± 9 122 ± 9

6.0 1.1 0.4 3.0 1.9 1.1

± ± ± ± ± ±

0.6 0.1 0.1 1.0 0.6 0.2

6.3 1.1 0.4 3.3 2.0 1.3

± ± ± ± ± ±

0.8 0.2 0.1 0.7 0.5 0.5

6.4 1.1 0.4 2.3 1.9 1.1

± ± ± ± ± ±

0.7 0.2 0.1 1.4 0.4 0.3

■

RESULTS Food Intake and Body and Organ Weights. No differences in food intake and body weight were seen among the three groups (Table 2). The weights of kidney, heart, and

Data are expressed as the mean ± SD; n = 10 each group.

Table 3. Changes in Plasma Total Cholesterol (TC), Triacylglycerols (TG), High-Density Lipoprotein Cholesterol (HDL-C), and Non-HDL-Cholesterol (Non-HDL-C) in Hamsters Fed the Control (CON) and the Two Experimental Diets Containing 0.2% Sesamin (SL) or 0.5% Sesamin (SH), Respectively, for 3 and 6 Weeksa CON

SL

SH

P value

week 0 TC (mmol/L) TG (mmol/L) HDL-C (mmol/L) non-HDL-C(mmol/L) non-HDL-C:HDL-C

2.88 2.75 1.49 1.39 0.94

± ± ± ± ±

0.43 0.52 0.18 0.35 0.23

2.96 2.81 1.53 1.43 0.94

± ± ± ± ±

0.34 0.59 0.19 0.29 0.22

2.94 2.63 1.50 1.44 0.96

± ± ± ± ±

0.43 0.34 0.09 0.38 0.24

0.76 0.57 0.93 0.75 0.83

TC (mmol/L) TG (mmol/L) HDL-C (mmol/L) non-HDL-C(mmol/L) non-HDL-C:HDL-C

6.63 4.25 2.57 4.06 1.59

± ± ± ± ±

0.49a 0.99 0.22a 0.44a 0.22

5.98 3.72 2.46 3.52 1.42

± ± ± ± ±

0.55b 0.51 0.20a 0.40b 0.13

5.37 3.80 2.19 3.17 1.40

± ± ± ± ±

0.59b 0.67 0.24b 0.57b 0.25

0.01 0.24 0.01 0.01 0.07

5.00 ± 0.44b 4.31 ± 1.31 2.19 ± 0.08b 2.70 ± 0.41b 1.21 ± 0.18b 99 ± 24b

0.01 0.22 0.01 0.01 0.01 0.01

week 3

week 6 TC (mmol/L) TG (mmol/L) HDL-C (mmol/L) non-HDL-C(mmol/L) non-HDL-C:HDL-C liver cholesterol (μmol/g) a

6.62 ± 0.40a 5.13 ± 1.32 2.69 ± 0.51a 3.97 ± 0.60a 1.57 ± 0.47a 128 ± 15a

5.32 ± 0.63b 4.51 ± 0.78 2.36 ± 0.24b 2.96 ± 0.55b 1.26 ± 0.23b 105 ± 20b

Mean values within a row with unlike letters are significantly different (P < 0.05). 2965

DOI: 10.1021/jf5063606 J. Agric. Food Chem. 2015, 63, 2963−2969

Article

Journal of Agricultural and Food Chemistry

Table 4. Changes in Fecal Neutral and Acidic Sterols in Hamsters Fed the Control (CON) and the Two Experimental Diets Containing 0.2% Sesamin (SL) or 0.5% Sesamin (SH), Respectively, at Weeks 1, 3, and 6a CON

SL

SH

P value

Week 1 neutral sterols (μmol/day) coprostanol coprostanone cholesterol dihydrocholesterol campesterol stigmasterol sitosterol total acidic sterols (μmol/day) lithocholic acid deoxycholic acid chenodeoxycholic acid + cholic acid ursocholic acid total

1.10 0.05 0.32 0.29 0.03 0.02 0.02 1.82

± ± ± ± ± ± ± ±

0.33 0.03 0.17 0.13 0.01 0.01 0.01 0.61

1.13 0.11 0.39 0.44 0.04 0.01 0.01 2.13

± ± ± ± ± ± ± ±

0.21 0.09 0.06 0.06 0.00 0.00 0.02 0.19

1.46 0.17 0.39 0.51 0.05 0.02 0.03 2.62

± ± ± ± ± ± ± ±

0.47 0.10 0.06 0.20 0.01 0.01 0.01 0.70

0.21 0.07 0.41 0.08 0.15 0.87 0.26 0.08

4.27 1.48 0.17 0.64 6.55

± ± ± ± ±

1.98 0.46 0.05b 0.22 2.19

4.62 1.56 0.14 0.69 7.01

± ± ± ± ±

1.21 0.21 0.06b 0.15 1.42

5.26 1.93 0.26 0.52 7.97

± ± ± ± ±

1.69 0.86 0.02a 0.10 2.14

0.53 0.39 0.02 0.13 0.29

Week 3 neutral sterols (μmol/day) coprostanol coprostanone cholesterol dihydrocholesterol campesterol stigmasterol sitosterol total acidic sterols (μmol/day) lithocholic acid deoxycholic acid chenodeoxycholic acid + cholic acid ursocholic acid total

1.52 0.06 0.58 0.34 0.02 0.04 0.05 2.61

± ± ± ± ± ± ± ±

0.43 0.01 0.29b 0.08c 0.01 0.00 0.01 0.28c

1.82 0.08 0.81 0.69 0.01 0.03 0.06 3.51

± ± ± ± ± ± ± ±

0.65 0.01 0.17b 0.23b 0.01 0.01 0.01 0.63ab

2.16 0.08 1.37 0.82 0.01 0.04 0.06 4.53

± ± ± ± ± ± ± ±

1.29 0.03 0.42a 0.21a 0.00 0.01 0.02 1.40a

0.35 0.28 0.01 0.01 0.48 0.67 0.39 0.02

2.49 1.27 0.26 0.91 4.94

± ± ± ± ±

0.37b 0.01 0.12 0.49 0.75b

2.88 2.16 0.42 0.93 6.40

± ± ± ± ±

0.41ab 0.58 0.15 0.22 1.22ab

4.24 2.02 0.33 0.80 7.39

± ± ± ± ±

0.61a 0.37 0.10 0.33 0.77a

0.01 0.09 0.63 0.65 0.02

Week 6 neutral sterols (μmol/day) coprostanol coprostanone cholesterol dihydrocholesterol campesterol stigmasterol sitosterol total acidic sterols (μmol/day) lithocholic acid deoxycholic acid chenodeoxycholic acid + cholic acid ursocholic acid total a

0.93 0.08 1.04 0.54 0.01 0.04 0.03 2.65

± ± ± ± ± ± ± ±

0.16b 0.01b 0.35b 0.16b 0.00 0.01b 0.01b 0.57b

1.52 0.11 1.75 0.76 0.01 0.08 0.07 4.30

± ± ± ± ± ± ± ±

0.97ab 0.03ab 0.36ab 0.46ab 0.01 0.03ab 0.02a 1.65ab

2.20 0.12 2.25 1.09 0.01 0.09 0.07 5.84

± ± ± ± ± ± ± ±

0.28a 0.02a 0.94a 0.39a 0.00 0.04a 0.02a 1.27a

0.01 0.03 0.01 0.04 0.25 0.02 0.01 0.01

2.62 1.74 0.20 0.50 5.08

± ± ± ± ±

1.09b 0.73 0.04b 0.17 1.23b

3.71 2.55 0.32 0.50 7.09

± ± ± ± ±

1.01ab 0.99 0.14ab 0.31 1.36a

4.31 2.33 0.43 0.50 7.56

± ± ± ± ±

1.54a 0.51 0.18a 0.16 1.27a

0.05 0.32 0.03 0.98 0.01

Mean values within a row with unlike letters are significantly different, P < 0.05.

control hamsters at the end of week 6. The amount of cholesterol in the liver decreased significantly in both SL and SH groups (Table 3). Results demonstrated that the control hamsters had liver cholesterol of 128.0 μmol/g, whereas SL and SH hamsters had liver cholesterol of 105.0 and 99.4 μmol/g, equivalent to 16 and 22% reductions, respectively. Fecal Neutral Sterols. Microbial hydrogenation and bioconversion of cholesterol in the large intestine produce several derivatives, namely, coprostanol, coprostanone, and

perirenal and epididymal adipose tissues were similar among the three groups. Plasma TC, LDL, TG, and Liver Cholesterol. The three groups of hamsters had similar levels of plasma TC, HDL-C, non-HDL-C, and TG at week 0. When the experiment reached the end of weeks 3 and 6, SL and SH hamsters had decreased plasma TC, non-HDL-C, and TG in a dose-dependent manner (Table 3). At week 6, SL and SH groups had plasma TC reduced by 20 and 25%, respectively, compared with the 2966

DOI: 10.1021/jf5063606 J. Agric. Food Chem. 2015, 63, 2963−2969

Article

Journal of Agricultural and Food Chemistry dihydrocholesterol, whereas stigmasterol and β-sitosterol are of dietary origin. At week 1, no differences in individual and total fecal neutral sterols were seen among the three groups (Table 4). At week 3, SL and SH groups had increased fecal excretion of cholesterol, dihydrocholesterol, and total neutral sterols in a dose-dependent manner. At week 6, addition of sesamin into the diet dose-dependently increased the fecal excretion of cholesterol, coprostanol, coprostanone, and dihydrocholesterol. Compared with the control hamsters, SL and SH groups had increased excretion of fecal total neutral sterols by 62 and 120%, respectively (Table 4). Fecal Acidic Sterols. Fecal bile acids are divided into primary and secondary bile acids. The primary bile acids are cholic acid and chenodeoxycholic acids, whereas the secondary bile acids are deoxycholic, lithocholic, and ursocholic acids. In week 1, no differences in the excretion of total bile acids were seen among the three groups. At week 3, the excretion of total bile acids and secondary bile acids lithocholic and deoxycholic acids was significantly increased in SL and SH groups in a dosedependent manner (Table 4). At week 6, addition of sesamin into the diet dose-dependently increased the excretion of total fecal bile acids by 40 and 49% in the SL and SH groups, respectively. Real-Time PCR mRNA of Intestinal NPC1L1, ACAT2, MTP, ABCG5, and ABCG8. RT-PCR analysis demonstrated that addition of sesamin into diets had significant effects on gene expression of transporters, enzymes, and protein involved in cholesterol absorption. As shown in Figure 2, dietary sesamin dose-dependently down-regulated the mRNA of intestinal NPC1L1, ACAT2, MTP, ABCG5, and ABCG8. For mRNA NPC1L1, it was down-regulated in SL and SH groups by 22.3 and 51.5%, respectively, compared with the control. Similarly, mRNA ACAT2 was decreased by 24.5 and 53.3%, whereas mRNA MTP was down-regulated by 24.4 and 50.1% in SL and SH groups, respectively, compared with the control. mRNA ABCG5 and ABCG8 were also decreased by 13.1− 13.5 and 26.1−49.5%, respectively, compared with the control values. Real-Time PCR mRNA Analysis of Hepatic SREBP2, LDL Receptor, HMG-CoA Reductase, LXRα, and CYP7A1. RT-PCR analysis found the addition of sesamin in the diet had no effect on mRNA of LDL receptor and SREBP2 (Figure 3). Dietary sesamin at 0.2 and 0.5% significantly up-regulated the mRNA of CYP7A1 by 55.3 and 71.3%, respectively, compared with the control value. In contrast, sesamin at 0.2 and 0.5% in diets significantly down-regulated mRNA HMG-CoA reductase by 46.8−49.4% and mRNA LXRα by 60.1−62.6%, respectively, compared with the control values.

Figure 2. mRNA levels of intestinal Niemann−Pick C1 like 1 protein (NPC1L1), acyl coenzyme A:cholesterol acyltransferase 2 (ACAT2), microsomal triacylglycerol transport protein (MTP), and ATP binding cassette transporters subfamily G members 5 and 8 (ABCG5 and ABCG8) in hamsters fed the control diet (CON) or one of the two experimental diets with the addition of 0.2% sesamin (SL) or 0.5% sesamin (SH). Data were normalized with cyclophilin. Values are expressed as means ± SD (n = 10) with those for the control group being arbitrarily taken as 1. Means with different letters (a, b) differ significantly, P < 0.05. R is the coefficient of correlation for the regression analysis on the dose-dependent effect of sesamin on target genes.

2 g of plant sterols per day to decrease plasma LDL-C by about 10% for humans.26 This translates to a dose of 1 g plant sterols/ 1000 kcal in the diet provided that humans daily consume about 2000 kcal energy. In the present study, 0.2−0.5% sesamin added in diets was equivalent to 0.5−1.2 g/1000 kcal, which was close to the recommended intake for plant sterols. We proposed two underlying mechanisms by which dietary sesamin decreased plasma TC. The first mechanism was that dietary sesamin reduced plasma TC concentration by downregulating the gene expression of transporters and enzymes involved in cholesterol absorption pathway in the intestine. The proposed mechanism was supported by the results from RT-PCR analysis with the following evidence. First, dietary sesamin dose-dependently down-regulated mRNA of intestinal NPC1L1, ACAT-2, MTP, ABCG5, and ABCG8 (Figure 2), all of which are essential for cholesterol absorption. Second, such down-regulation on these genes was accompanied by 62−120% greater excretion of neutral sterols (Table 4), proving that dietary sesamin inhibited cholesterol absorption. To the best of

■

DISCUSSION We chose sesamin as a representative lignan and investigated its effect on plasma TC using hamsters as a hypercholesterolemia model. It was found that dietary sesamin was capable of modulating favorably the plasma lipoprotein profile with the following observations. First, dietary sesamin at 0.2 and 0.5% could decrease plasma TC by 20−25% in a dose-dependent manner (Table 3). Second, dietary sesamin decreased both non-HDL-C and HDL-C; however, it decreased non-HDL-C more than HDL-C, thus favorably reducing the ratio of nonHDL-C to HDL-C. The rationale for adding sesamin into diets at 0.2 and 0.5% was that such doses were comparable to the recommended intake for other cholesterol-lowering nutraceuticals such as plant sterols. It is generally recommended to take 2967

DOI: 10.1021/jf5063606 J. Agric. Food Chem. 2015, 63, 2963−2969

Article

Journal of Agricultural and Food Chemistry

dietary sesamin promoted the biosynthesis of bile acids and deceased the liver cholesterol concentration. This was supported by a 40−49% increase in the excretion of fecal bile acids in hamsters given diets with the addition of 0.2 or 0.5% sesamin. It is worth noting that dietary sesamin could downregulate the mRNA of LXRα by 60.1−62.6% in the liver. It is known that LXRα acts as a cholesterol concentration sensor in the liver. When cellular oxysterols accumulate as a result of increasing concentrations of cholesterol in the liver, LXRα is up-regulated to induce the transcription of genes that protect cells from cholesterol overload and then activate the bile acid synthesis.27 In the present study, such down-regulation of mRNA LXRα was expected because dietary sesamin decreased the cholesterol concentration in the liver by 16−22%. The discrepancy between down-regulation of mRNA LXRα and upregulation of mRNA CYP7A1 was probably due to changes in other nuclear receptors such as farnesoid X receptor (FXR), which can also regulate the gene expression of CYP7A1.27,28 We plan to investigate the issue in our future research. In summary, dietary sesamin could favorably modulate plasma lipoprotein profile by decreasing plasma TC, non-HDL-C, and the non-HDL-C/HDL-C ratio. Dietary sesamin-induced reduction in plasma TC was accompanied by greater excretion of both total fecal neutral and acidic sterols. It was concluded that the cholesterol-lowering activity of dietary sesamin was mediated by up-regulation of hepatic mRNA CYP7A1 and down-regulation of intestinal mRNA NPC1L1, ACAT2, MTP, ABCG5, and ABCG8 as well as down-regulation of hepatic mRNA HMGCoA reductase.

■

AUTHOR INFORMATION

Corresponding Author

Figure 3. mRNA levels of hepatic sterol regulatory element-binding protein-2 (SREBP-2), liver X receptor-alpha (LXRα), 3-hydroxy-3methylglutaryl-CoA (HMG-CoA) reductase, LDL receptor (LDLR), and cholesterol-7α-hydroxylase (CYP7A1) in hamsters fed the control diet (CON) or one of two experimental diets with the addition of 0.2% sesamin (SL) or 0.5% sesamin (SH). Data were normalized with GAPDH. Values are expressed as means ± SD (n = 10) with those for the control group being arbitrarily taken as 1. Means with different letters (a, b) differ significantly, P < 0.05. R is the coefficient of correlation for the regression analysis on the dose-dependent effect of sesamin on target genes.

*(Z.-Y.C.) Fax: (852) 2603-7246. Phone: (852) 3943-6382. Email: [email protected]. Funding

This project was supported by a grant from the Hong Kong Research Grant Council (CUHK462813). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Peterson, J.; Dwyer, J.; Adlercreutz, H.; Scalbert, A.; Jacques, P.; McCullough, M. L. Dietary lignans: physiology and potential for cardiovascular disease risk reduction. Nutr. Rev. 2010, 68 (10), 571− 603. (2) Penalvo, J. L.; Haajanen, K. M.; Botting, N.; Adlercreutz, H. Quantification of lignans in food using isotope dilution gas chromatography/mass spectrometry. J. Agric. Food Chem. 2005, 53, 9342−9347. (3) Penalvo, J. L.; Heinonen, S. M.; Aura, A. M.; Adlercreutz, H. Dietary sesamin is converted to enterolactone in humans. J. Nutr. 2005, 135, 1056−1062. (4) Pan, A.; Yu, D.; Demark-Wahnefried, W.; Franco, O. H.; Lin, X. Meta-analysis of the effects of flaxseed interventions on blood lipids. Am. J. Clin. Nutr. 2009, 90, 288−297. (5) Hirata, F.; Fujita, K.; Ishikura, Y.; Hosoda, K.; Ishikawa, T.; Nakamura, H. Hypocholesterolemic effect of sesame lignan in humans. Atherosclerosis 1996, 122, 135−136. (6) Wu, W. H.; Kang, Y. P.; Wang, N. H.; Jou, H. J.; Wang, T. A. Sesame ingestion affects sex hormones, antioxidant status, and blood lipids in postmenopausal women. J. Nutr. 2006, 136, 1270−1275. (7) Rogi, T.; Tomimori, N.; Ono, Y.; Kiso, Y. The mechanism underlying the synergetic hypocholesterolemic effect of sesamin and

our knowledge, this is the first study to demonstrate that the cholesterol-lowering activity of dietary sesamin was mediated by down-regulation on the gene expression of intestinal NPC1L1, ACAT2, MTP, ABCG5, and ABCG8. The second mechanism was that sesamin could modulate the cholesterol homeostasis in a way favoring the reduction of plasma TC. The present study clearly demonstrated that dietary sesamin down-regulated mRNA HMG-CoA reductase in a dose-dependent manner, suggesting dietary sesamin inhibited cholesterol biosynthesis in the liver (Figure 3). The present results also demonstrated that sesamin had a trend of downregulating mRNA SREBP-2 in the liver, although such an effect was statistically insignificant. It is known that the expression of HMG-CoA reductase is under the control of SREBP-2, which is activated at a lower cholesterol level. Therefore, downregulation of HMG-CoA reductase was expected in response to reduction of liver cholesterol and mRNA SREBP-2. The most important observation was that dietary sesamin dosedependently up-regulated the mRNA CYP7A1, indicating 2968

DOI: 10.1021/jf5063606 J. Agric. Food Chem. 2015, 63, 2963−2969

Article

Journal of Agricultural and Food Chemistry α-tocopherol in rats fed a high-cholesterol diet. J. Pharmacol. Sci. 2011, 115, 408−416. (8) Ide, T.; Ashakumary, L.; Takahashi, Y.; Kushiro, M.; Fukuda, N.; Sugano, M. Sesamin, a sesame lignan, decreases fatty acid synthesis in rat liver accompanying the down-regulation of sterol regulatory element binding protein-1. Biochim. Biophys. Acta 2001, 1534 (1), 1− 13. (9) Hirose, N.; Inoue, T.; Nishihara, K.; Sugano, M.; Akimoto, K.; Shimizu, S.; Yamada, H. Inhibition of cholesterol absorption and synthesis in rats by sesamin. J. Lipid Res. 1991, 32 (4), 629−638. (10) Ide, T.; Hong, D. D.; Ranasinghe, P.; Takahashi, Y.; Kushiro, M.; Sugano, M. Interaction of dietary fat types and sesamin on hepatic fatty acid oxidation in rats. Biochim. Biophys. Acta 2004, 1682 (1−3), 80−91. (11) Ide, T. Combined effect of sesamin and soybean phospholipid on hepatic fatty acid metabolism in rats. J. Clin. Biochem. Nutr. 2014, 54 (3), 210−218. (12) Grundy, S. M. Absorption and metabolism of dietary cholesterol. Annu. Rev. Nutr. 1983, 3, 71−96. (13) Grundy, S. M.; Metzger, A. L. A physiological method for estimation of hepatic secretion of biliary lipids in man. Gastroenterology 1972, 62, 1200−1217. (14) Howles, P. N.; Carter, C. P.; Hui, D. Y. Dietary free and esterified cholesterol absorption in cholesterol esterase (bile saltstimulated lipase) gene-targeted mice. J. Biol. Chem. 1996, 271, 7196− 7202. (15) Grober, J.; Lucas, S.; Sorhede-Winsell, M.; Zaghini, I.; Mairal, A.; Contreras, J. A.; Besnard, P.; Holm, C.; Langin, D. Hormonesensitive lipase is a cholesterol esterase of the intestinal mucosa. J. Biol. Chem. 2003, 278, 6510−6515. (16) Davis, H. R., Jr.; Zhu, L. J.; Hoos, L. M.; Tetzloff, G.; Maguire, M.; Liu, J.; Yao, X.; Iyer, S. P.; Lam, M. H.; Lund, E. G.; Detmers, P. A.; Graziano, M. P.; Altmann, S. W. Niemann-Pick C1 Like 1 (NPC1L1) is the intestinal phytosterol and cholesterol transporter and a key modulator of whole-body cholesterol homeostasis. J. Biol. Chem. 2004, 279, 33586−33592. (17) Atzel, A.; Wetterau, J. R. Mechanism of microsomal triglyceride transfer protein catalyzed lipid transport. Biochemistry 1993, 32, 10444−10450. (18) Lee, M. H.; Lu, K.; Hazard, S.; Yu, H.; Shulenin, S.; Hidaka, H.; Kojima, H.; Allikmets, R.; Sakuma, N.; Pegoraro, R.; Srivastava, A. K.; Salen, G.; Dean, M.; Patel, S. B. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption. Nat. Genet. 2001, 27, 79−83. (19) Berge, K. E.; Tian, H.; Graf, G. A.; Yu, L.; Grishin, N. V.; Schultz, J.; Kwiterovich, P.; Shan, B.; Barnes, R.; Hobbs, H. H. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 2000, 290, 1771− 1775. (20) Eberlé, D.; Hegarty, B.; Bossard, P.; Ferré, P.; Foufelle, F. SREBP transcription factors: master regulators of lipid homeostasis. Biochimie 2004, 86 (11), 839−848. (21) Gupta, S.; Pandak, W. M.; Hylemon, P. B. LXR alpha is the dominant regulator of CYP7A1 transcription. Biochem. Biophys. Res. Commun. 2002, 26, 338−343. (22) Zhang, Z. S.; Wang, H.; Jiao, R.; Peng, C.; Wong, Y. M.; Yeung, V. S. Y.; Huang, Y.; Chen, Z. Y. Choosing hamsters but not rats as a model for studying plasma cholesterol-lowering activity of functional foods. Mol. Nutr. Food Res. 2009, 53, 921−930. (23) Lei, L.; Liu, Y.; Wang, X.; Jiao, R.; Ma, K. Y.; Li, Y. M.; Wang, L.; Man, S. W.; Sang, S.; Huang, Y.; Chen, Z. Y. Plasma cholesterollowering activity of gingerols- and shogaols-riched extract is mediated by increasing sterol excretion. J. Agric. Food Chem. 2014, 62, 10515− 10521. (24) Jiao, R.; Guan, L.; Yang, N.; Peng, C.; Liang, Y.; Ma, K. Y.; Huang, Y.; Chen, Z. Y. Frequent cholesterol intake up-regulates intestinal NPC1L1, ACAT2, and MTP. J. Agric. Food Chem. 2010, 58, 5851−5857.

(25) Lei, L.; Wang, X.; Huang, W.; Liu, Y.; Zheng, F.; Ma, K. Y.; Li, Y. M.; Wang, L.; Man, S. W.; Zhang, C.; Chen, Z. Y. Cholesterol side chain analogs but not its ether analogs possess cholesterol-lowering activity. Food Funct. 2015, 6, 630−634. (26) National Cholesterol Education Program, National Heart, Lung, and Blood Institute, National Institutes of Health, NIH. Publication 025215; U.S. GPO: Washington, DC, USA, Sept 2002. (27) Zhao, C.; Dahlman-Wright, K. Liver X receptor in cholesterol metabolism. J. Endocrinol. 2010, 204, 233−240. (28) Fu, Z. D.; Cui, J. Y.; Klaassen, C. D. Atorvastatin induces bile acid-synthetic enzyme Cyp7a1 by suppressing FXR signaling in both liver and intestine in mice. J. Lipid Res. 2014, 55, 2576−2586.

2969

DOI: 10.1021/jf5063606 J. Agric. Food Chem. 2015, 63, 2963−2969