Communication Cite This: Bioconjugate Chem. XXXX, XXX, XXX−XXX
pubs.acs.org/bc
Cholesterol-Modified Caged siRNAs for Photoregulating Exogenous and Endogenous Gene Expression Jiali Yang,# Changmai Chen,# and Xinjing Tang* State Key Laboratory of Natural and Biomimetic Drugs, Beijing Key Laboratory of Molecular Pharmaceutics and New Drug Delivery Systems, the School of Pharmaceutical Sciences and Center for Noncoding RNA Medicine, Peking University Health Center, Peking University, Beijing 100191, China S Supporting Information *
ABSTRACT: siRNA has been widely applied in research and drug development due to its sequence-specific gene silencing ability. However, how to spatiotemporally control its function is still one of its challenges. Light, a fast and noninvasive trigger, is a promising tool for spatiotemporal control of gene expression. Here, we designed and synthesized a new series of caged siRNAs modified with single cholesterol at the 5′ terminal of antisense strand RNA through a photolabile linker (Chol-PL-siRNAs). We demonstrated that these caged siRNAs were successfully used to photochemically regulate both exogenous ( firef ly luciferase and gf p) and endogenous gene expression (mitotic kinesin-5, Eg5) in cells.
S
reduction of siRNA activity, which may be useful for conditional activation of RNAi gene silencing. Light activation may be a convenient method to control a specific gene activity with spatiotemporal resolution due to its fast and invasive triggering. Photolabile moieties have previously been introduced to functional oligonucleotides to temporarily mask their biological activities until light irradiation removes these moieties. This methodology of blocking biological functions is commonly referred to “cage”, and many types of functional oligonucleotides have been successfully caged, such as caged DNAzyme, 12−15 antisense reagents,16,17 aptamer,18,19 and CRISPER-Cas9.20,21 For siRNAs, different caging strategies have been achieved.22,23 One way is to incorporate a caged nucleobase to a specific position which could block the binding or processing of Dicer. Removing the caging group recovered the original nucleobases for further RNA interference.24 The other way is to cage phosphate backbone of siRNAs. Statistic caging phosphate backbone was first achieved for blocking siRNA activity; however, no structure−activity relationship could be illuminated.25 We previously synthesized four photolabile nucleotide phosphoramidites for site-specifically caging each phosphate backbone of siRNA and found some key caging phosphate positions.26 Among them, the 5′ terminal caged phosphate of siRNA still showed better photomodulation of gene silencing. McMaster et al. modified biotin to the 5′ terminal of the
ince the discovery of RNA interference (RNAi), short interfering RNA (siRNA) has been one of powerful tools for sequence-specific gene silencing and gene-based therapeutics in biological systems due to the factor that Argonaute (Ago) proteins induce catalytic degradation of target mRNA.1−3 However, the applications of siRNA still face many challenges, such as efficient gene delivery systems, poor serum stability, off-target effect, short-term effect, and immune response and toxicity.4 A variety of chemical modifications and delivery materials have been applied to improve its pharmacokinetic properties and gene-based therapeutics.5 One of the most popular and important modifications for siRNA duplex is covalent conjugation of cholesterol at the 3′ terminal of the sense strand of siRNA via a trans-4-hydroxyprolinol linker to improve the net lipophilicity of siRNA and therapeutic silencing activity.6−8 Cholesterol-modified siRNA is associated with high-density lipoprotein (HDL) and low-density lipoprotein (LDL) in circulation in vivo. Soutschek et al. successfully silenced endogenous gene encoding apolipoprotein B in the liver by intravenous injection of cholesterol-modified siRNA.9 DiFiglia et al. applied cholesterol-conjugated siRNA targeting huntington gene for therapy of Huntington’s disease,10 while Brück et al. found that the cholesterol-modified siRNA could be taken up by dendritic cells via scavenger receptor-mediated internalization, without using transfection reagents, which seem to resist siRNA delivery.11 In all these cases, cholesterol was linked to the 3′ terminal of the sense strand of siRNA with a long linker in order to minimize its effect on gene silencing activities of siRNA. Direct attachment of cholesterol to the 5′ terminal of the antisense strand of siRNA may cause great © XXXX American Chemical Society
Received: January 30, 2018 Revised: March 6, 2018 Published: March 7, 2018 A
DOI: 10.1021/acs.bioconjchem.8b00080 Bioconjugate Chem. XXXX, XXX, XXX−XXX
Communication
Bioconjugate Chemistry
phase synthesizer. After cleavage from CPG and oligonucleotide deprotection, the as-prepared RNA oligonucleotides were purified using reverse phase HPLC and further confirmed by ESI-MS (Table S1). In this work, three siRNAs were chosen for targeting both exogenous genes (f iref ly luciferase and gf p) and endogenous gene (Eg5). According to their sequences, a series of cholesterol-modified caged siRNAs were synthesized for photomodulation of three corresponding gene functions (Table 1). We first evaluated the ability of photoinduced siRNA release using cholesterol-modified caged siRNA. The caged siRNA was irradiated for different exposure times (2−6 min) and irradiated samples were then assayed using 20% native PAGE gels. The data showed that cholesterol-modified siRNA moved a little bit more slowly than native siRNA in PAGE gel. Only around 3 min irradiation could recover the naked siRNA under our photolysis condition, as shown in Figure S1. Optochemical Regulation of firef ly luciferase Gene Expression with Caged Chol-PL-siRNAs. Dual-luciferase reporter system was first used for evaluating the photomodulation of luciferase gene silencing activity using caged siRNAs with cholesterol-modified caged antisense strand or sense strand RNAs (ALPC/SL and AL/SLPC, respectively) (Table 1). Gene silencing potency of cholesterol-modified caged siRNAs was evaluated together with their linear counterpart (PC). HepG2 cells were then cotransfected with two plasmids (pGL-3 and pRL-TK encoding firefly and renilla luciferase, respectively) as well as siRNAs (ALPC/SL, AL/ SLPC, or AL/SL). Here, transfection agent was still needed for cellular uptake due to low concentration of cholesterol modified siRNA and cotransfection of plasmids. We first optimized the irradiation condition for achieving RNAi gene silencing using the caged siRNA (ALPC/SL). Similar to gel shift results in Figure S1, 3 min light irradiation was enough to achieve maximum recovery of gene silencing, as shown in Figure S2. Cholesterol modification at the 5′ terminal of antisense strand RNA (ALPC/SL) led to the loss of siRNA gene silencing activity, as we can see in Figure 1A. However, light activation removed the caging group and greatly enhanced RNA interference, leading to obvious reduction of firefly luciferase activity. More than 4-fold of photomodulation of gene silencing was achieved with 3 min light irradiation. If the cholesterol was attached to the terminal of the sense strand RNA of caged siRNA (AL/SLPC), only around 50% lucifersase activity was inhibited even without light activation, indicating less blocking effect than caged siRNA with modification of the 5′ terminal of antisense strand RNA. The inhibited siRNA activity of AL/SLPC could be recovered by photocleavage of the photolabile linker, and ∼2.5-fold photomodulation was still achieved with light activation. According to the cholesterol labeled siRNA reported in the literature, the low activity of cholesterol-modified caged siRNA was probably due to shorter linker between the cholesterol and the terminal of siRNA.29 By increasing the concentration of cholesterol-modified caged siRNA, more enhancement (up to 5.7-fold) of photomodulation of firefly luciferase activity was achieved in 24 h (Figure 1B). With the same experimental conditions, up to 10fold photomodulation of luciferase activity could be observed in 48 h using the same caged ALPC/SL (Figure 1C). These results demonstrated that cholesterol-modified caged siRNAs could be successfully applied for efficient photomodulation of RNAi gene silencing at 2−20 nM range of concentration,
antisense strand of siRNA with a photolinker, showing moderate regulation of gene suppression and phenotypes. Friedman et al. attached a bigger photocleavable group (CDDMNPE) to all four terminals of dsRNA, which achieved the patterning of green fluorescent protein (gfp) gene expression.27 We also successfully realized effective photomodulation of siRNA activities using terminal vitamin E modified antisense strand RNA.28 Since cholesterol has been widely used to modified the terminal of sense strand RNA of siRNAs in basic research and drug development, the photolabile version of cholesterol-modified siRNAs at the 5′ terminal of the antisense strand RNA will be expected to achieve the photomodulation of target gene silencing activities through light activation. Here, we rationally designed and synthesized the photolabile version of cholesterol-modified siRNAs by incorporation of the photolabile linker (PL) and cholesterol phosphoramidites, as shown in Table 1. Three caged siRNAs targeting both Table 1. Structure (Top) and Sequences (Bottom) Of Native and Caged Cholesterol Modified Oligonucleotidesa
target gene
name
sequence (5′→3′)
Firefly luciferase
SL SLPC AL ALPC SG AG AGPC SE AE AEPC
CCCUAUUCUCCUUCUUCGCTT Chol-PL-CCCUAUUCUCCUUCUUCGCTT GCGAAGAAGGAGAAUAGGGTT Chol-PL-GCGAAGAAGGAGAAUAGGGTT GAACGGCAUCAAGGUGAACTT GUUCACCUUGAUGCCGUUCTT Chol-PL-GUUCACCUUGAUGCCGUUCTT CAACAAGGAUGAAGUCUAUTT AUAGACUUCAUCCUUGUUGTT Chol-PL-AUAGACUUCAUCCUUGUUGTT
gfp
Eg5
“S”, sense strand RNA; “A”, antisense strand RNA; “C or chol”, cholesterol; “P or PL”, photolabile linker; “L”, firefly luciferase; “G”, GFP; “E”, Eg5.
a
exogenous genes (f iref ly luciferase and gf p) and endogenous gene (mitotic kinesin-5, Eg5) have been developed for photomodulation of siRNA induced gene silencing in cells. The terminal cholesterol would possibly increase the inhibitory effect on Ago2 protein binding or processing. Upon light activation, breakage of the photosensitive linker will fully release native siRNAs with terminal phosphate group, and recover their gene silencing activities. These results indicated that cholesterol-modified caged siRNAs (Chol-PL-siRNAs) could be successfully applied to photochemical control of both exogenous and endogenous genes in cells.
■
RESULTS AND DISCUSSION Synthesis and Characterization of Cholesterol-Modified Caged siRNAs. β-[Bis(4-methoxyphenyl)phenylmethoxy]-2-nitro-benzene ethanol (photolinker) and cholesterol phosphoramidites were readily synthesized according to standard phosphoramidite synthetic protocol (see Supporting Information). These two phosphoramidites were then coupled to the 5′ terminal of oligoribonucleotides through the phosphoramidite chemistry using ABI394 DNA/RNA solid B
DOI: 10.1021/acs.bioconjchem.8b00080 Bioconjugate Chem. XXXX, XXX, XXX−XXX
Communication
Bioconjugate Chemistry
targeting GFP. RFP fluorescence signal was chosen as the internal reference control. As we can see from Figure 2A,
Figure 2. Photomodulation of GFP expression (RFP as internal control) with caged siRNA AGPC/SG. The concentration of PC siRNA is 10 nM. (A) Concentration dependence of photomodulating GFP expression. Scale bar = 25 μm. (B) Quantification of GFP expression with RFP expression as control using flow cytometry. Error bars represent standard deviations from three independent experiments. (C) Spatial control of GFP expression with patterned irradiation. Scale bar = 2 mm.
without light irradiation, all GFP and RFP fluorescence was barely silenced, similar to negative control cells with only two plasmids transfection. However, light irradiation could activate siRNA gene silencing activity and GFP fluorescence in cells was greatly decreased with concentration dependence. Further flow cytometry studies (Figure 2B) confirmed this observation and over 4.5-fold photomodulation of GFP gene expression was achieved upon light irradiation after 24 h, which is similar to the observation for firefly luciferase. The advantage of caged siRNA is to control gene silencing in spatial resolution. So, we further tested the possibility of achieving spatial regulation of GFP gene expression using cholesterol-modified caged siRNA. Part of the cells in the plate well with cotransfection of GFP plasmid and cholesterolmodified caged siRNA were irradiated. As shown in Figure 2C, obvious down-regulation of GFP fluorescence intensity was observed for irradiated cells with cholesterol-modified caged siRNA (AGPC/SG). However, cells without light irradiation maintained the normal GFP expression. These data confirmed that siRNA with cholesterol-modification of 5′ terminal of antisense RNA was inert and spatial photomodulation of gene expression was achievable using the cholesterol-modified caged siRNA and light activation. Photoregulation of Endogenous Eg5 Gene with Caged Chol-PL-siRNAs. In addition to target exogenous genes ( f iref ly luciferase and gf p), we also wanted to show that photomodulation of endogenous gene expression was also possible using our cholesterol-modified caged siRNA. Eg5 gene expresses mitotic motor protein which mediates centrosome separation and formation of the bipolar mitotic spindle.30 Silencing Eg5 gene will induce mitotic arrest of cells in prometaphase, which leads to phenotypic changes of nucleus.31 According to above design of caged siRNA, we further developed the cholesterol-modified caged siRNA (AEPC/SE) for targeting Eg5 mRNA. HepG2 cells were transfected with
Figure 1. Photomodulation of firefly luciferase activity (renilla luciferase activity as the internal control). (A) Photomodulation of firefly luciferase activity using caged siRNAs with cholesterol-modified at 5′-terminal of sense strand (AL/SLPC) or antisense strand (ALPC/ SL). The concentrations of all siRNAs were 5 nM. (B) and (C) Concentration dependence of photomodulation of firefly luciferase activity using ALPC/SL at 24 h (B) and 48 h (C) after transfection; PC concentration was 5 nM. Error bars represent standard deviations from three independent experiments.
especially for siRNA with cholesterol-modified 5′ terminal of the antisense strand RNA. Photochemical Regulation of gfp Gene Expression. To show the generality of gene silencing using cholesterolmodified caged siRNA, we also tested the photomodulation of GFP expression in HepG2 cells. The cells were cotransfected plasmids pEGFP-N1 (encoding GFP) and pDsRed2-N1 (encoding RFP) together with cholesterol-modified caged siRNA AGPC/SG (native AG/SG for positive control) C
DOI: 10.1021/acs.bioconjchem.8b00080 Bioconjugate Chem. XXXX, XXX, XXX−XXX
Bioconjugate Chemistry cholesterol-modified caged siRNA (AEPC/SE) or native siRNA (AE/SE) targeting Eg5. After transfection, the cells were either kept in the dark or activated with light exposure under the same irradiation condition. After 48 h incubation, the cells were fixed and stained with phalloidin−tetramethylrhodamine conjugate to label actin filaments and Hoechst 33342 to label cell nuclei. As shown in Figure 3A, the phenotypes of cells transfected with
Communication
■
CONCLUSIONS
■
MATERIALS AND METHODS
We rationally designed and synthesized a series of new caged siRNAs with single cholesterol modification at the 5′ terminal of antisense strand of siRNAs. Short-term light irradiation could remove the photolabile linker together with cholesterol and recover native siRNAs with phosphate moiety at the 5′ terminal. Based on this strategy, three cholesterol-modified caged siRNAs were developed for targeting both exogenous genes ( firef ly luciferase and gf p) and endogenous gene (Eg5). The gene silencing activities of all these caged Chol-PL-siRNAs were temporally masked due to the attachment of cholesterol at the 5′ terminal of antisense strand RNAs. Upon light activation, all caged Chol-PL-siRNAs could be efficiently activated and expression levels of corresponding exogeneous genes (f iref ly luciferase and gf p) and endogenous gene (Eg5) were greatly downregulated up to 3−10-fold. All these results indicated that the effective photomodulation of cholesterol-modified caged siRNA was successfully achieved and this strategy could be a general way to design caged siRNAs for many gene studies.
Synthesis and Purification of Caged Chol-PL-siRNAs. RNA oligonucleotides were synthesized on a 1 μmol scale using an ABI394 DNA/RNA synthesizer on the DMT-ON mode based on standard phosphoramidite chemistry. Photolinker (PL) phosphoramidite and cholesterol phosphoramidite were respectively coupled to the 5′ terminal of RNAs with different sequences for different target genes. The oligonucleotide-bound CPGs were soaked in 1 mL of 33% ammonium hydroxide solution for 24 h at room temperature. The solid CPGs were filtered off and the filtrate was concentrated to dryness. Then 50 μL DMSO and 50 μL TEA × 3HF was added to the above residue. The mixture was vibrated for 9 h at room temperature to remove the TBDMS protecting group. 40 μL 3 M sodium acetate and 1 mL n-butyl alcohol was added and completely mixed. The turbid liquid was stored in a −80 °C freezer for 1 h. The precipitates were collected through centrifugation (13,000 × g, 10 min, 4 °C) and were then dissolved by DEPC-treated water. Oligonucleotide samples were injected to HPLC system (Waters, Alliance e2695) using reverse-phase HPLC column (C18) and eluted at 1.0 mL/min with a gradient of acetonitrile/0.05 M triethylammonium bicarbonate buffer (TEAB, pH 8.5). A = 0.05 M TEAB buffer, B = acetonitrile. For uncaged oligonucleotides: B, 0−20% in 20 min. For caged oligonucleotides: B, 0−60% in 30 min. The detection frequency was set at 1 datum per second. Product fractions were collected and characterized by electrospray ionization mass spectroscopy (ESI-MS). Gel-Shift Assay for Evaluating Photocleavable Ability of Caged Chol-PL-siRNAs. Caged antisense RNA oligonucleotide (ALPC) and 1.0 equiv of their corresponding complementary sense strand were mixed in PBS buffer. The mixture was heated at 60 °C for 5 min and then cooled down to room temperature for siRNA duplex hybridization. siRNA duplexes were irradiated at 365 nm for 2−6 min (7 mW/cm2). The irradiated samples were then loaded to 20% native PAGE gel to analyze the photorelease of caged siRNA. Native siRNA and caged siRNA without irradiation were chosen as control. The gels were run at 100 V for 2 h and were then stained using SYBR Gold nucleic acid gel stain (Invitrogen) for 15 min. The gel was imaged using Chemiluminescence gel imaging system (ChemiDoc XRS).
Figure 3. Photomodulation of Eg5 expression in HepG2 cells. (A) Cell phenotypes of cell nuclei after treatment of native siRNA and caged siRNA (AEPC/SE) with staining of Hoechst33342 (blue) and phalloidin−tetramethylrhodamine (red). (B) Photomodulation of Eg5 mRNA expression using real time-qPCR quantification. Error bars represent standard deviations from three independent experiments. (C) Cell cycle analysis of mitotic arrest at 48 h with cytofluorometry after DNA staining with propidium iodide.
AEPC/SE were the same as that of negative control cells with the normal shape of cell nuclei. However, once the cells transfected with AEPC/SE were irradiated, it was activated to trigger the gene silencing machinery system. We clearly observed similar irregular binuclear cell phenotypes as those of cells transfected with positive control siRNA (AE/SE). We then quantified the arrest of cells in prometaphase by analyzing the cell cycle. Cells transfected with caged AEPC/SE without irradiation showed the same percentage (15%) of G2/M phase cells as the negative control, and the percentage increased to 37% after irradiation, close to the positive control with native siRNA (AE/SE). The data in Figure 3C show that Eg5 targeting siRNA could cause significant increase of G2/M phase cells. To further confirm photomodulation of Eg5 expression on the mRNA level, subsequent real-time qPCR experiments were carried out with GAPDH mRNA as the internal control. As shown in Figure 3B, the mRNA level of Eg5 was barely silenced by caged AEPC/SE without light activation. Once it was activated, Eg5 mRNA level was greatly decreased up to 3.8-fold. The result was consistent with the phenotypes of irradiated cells in Figure 3A and cell cycle analysis in Figure 3C. D
DOI: 10.1021/acs.bioconjchem.8b00080 Bioconjugate Chem. XXXX, XXX, XXX−XXX
Communication
Bioconjugate Chemistry Cell Culture and Transfection Procedure. HepG2 cells were grown at 37 °C, 5% CO2 in DMEM (M&C), supplemented with 10% fetal bovine serum (Pan) and 100 U/mL penicillin, and 100 mg/mL streptomycin. HepG2 cells were seeded into 24-well plates with the density of 5 × 104 cells/well (for 12-well plate the density is 1 × 105 cells/well and 6-well plate the density is 2 × 105 cells/well) and incubated for 24 h. Cotransfection of plasmids and siRNAs to cells were performed using Lipofectamine2000 (Invitrogen) and transfection of only siRNAs were performed using RNAiMAX (Invitrogen) according to the manufacturer’s protocol. After 4 h incubation, HepG2 cells were either irradiated with 365 nm UV light at 7 mW/cm2 for 3 min or kept in dark. After replacement with fresh medium, the cells were incubated at 37 °C, 5% CO2 for another 20 or 44 h. Dual-Luciferase Reporter System Assay. HepG2 cells were seeded in 24-well plates with the density of 5 × 104 cells/ well. 100 ng firefly plasmids (pGL-3), 20 ng renilla plasmids (pRL-TK), and corresponding siRNAs were cotransfected to cells in each well. After 24 or 48 h incubation, firefly luciferase activity was evaluated using high sensitivity microplate luminometer (Centro XS3 LB 960, Berthold technologies) use the kit of Dual-Luciferase Reporter Assay System (Promega) according to the standard protocol. Firefly luciferase activity was normalized by Renilla luciferase activity. Fluorescence Analysis of GFP. HepG2 cells were seeded in 12-well plates with the density of 1 × 105 cells/well. 200 ng GFP plasmids (pEGFP-N1), 300 ng RFP plasmids (pDsRed2N1), and corresponding siRNAs were cotransfected to cells in each well. After 48 h incubation, GFP expression was evaluated by automatic inverted fluorescence microscope (Olymups, IX83). The excitation and emission wavelengths are 488 and 509 nm for GFP, and 560 and 585 nm for RFP, respectively. After imaging, cells were digested by trypsin and collected through centrifugation (1000 × g, 5 min). Collected cells were measured by flow cytometer (BD FACSAria II) at the excitation wavelength of 488 and 560 nm. Half-Well Patterning Experiment. HepG2 cells were seeded in 6-well plates (NUNC) with density of 2 × 105 cells/ well. 200 ng GFP plasmids (pEGFP-N1) and 20 pmol caged siRNA (AGPC/SG) were cotransfected into each well. After 4 h incubation, half of the well was masked with light-proof black tape and the other half was irradiated with 365 nm UV light at 7 mW/cm2 for 3 min. Then, cells were replaced with fresh DMEM medium and incubated at 37 °C, 5% CO2 for another 44 h. Imaging of GFP expression was performed with a high content analyzer (Operetta). Phenotypic Eg5 Inhibition Assay. HepG2 cells were seeded in 35 mm laser confocal culture dish with the density of 1 × 105 cells/well. 5 pmol native siRNA or 5 pmol cholesterolmodified caged siRNA were transfected to each well. After 48 h incubation at 37 °C, all cells were fixed with 3.75% formaldehyde. The fixed cells were washed with PBS for three times and then strained with phalloidin−tetramethylrhodamine conjugate (AAT) and Hoechst33342 (Sigma) for 1 h according to the manufacture’s protocol. The cells were washed with PBS for three times. Imaging of cells was performed by a laser scanning confocal microscope (Nikon, A1R) at excitation wavelength of 561 nm for phalloidin−tetramethylrhodamine and 405 nm for Hoechst33342. Real-Time Polymerase Chain Reaction. HepG2 cells were seeded in 12-well plates with the density of 1 × 105 cells/ well. 2.5 pmol native siRNA (AE/SE) or 2.5 pmol caged siRNA
(AEPC/SE) was transfected to each well. After 48 h incubation at 37 °C, total RNA was extracted using BioZol reagent (BioDee) according to standard protocol provided by manufacture. cDNA were synthesized with HiScript II Q RT SuperMix for PCR (Vazyme Biotech) and real time-polymerase chain reactions were performed with GoTaq qPCR Master Mix (Promega) according to standard protocol provided by manufacture. The threshold cycles of each sample were normalized to the GAPDH housekeeping gene. All the samples contain three parallel wells and the experiments were repeated for three times. The data were averaged and standard deviations were calculated. The sequences of primers were listed as follows: Eg5 forward primer 5′ CAGCTGAAAAGGAAACAGCC, Eg5 reverse primer 5′ ATGAACAATCCACACCAGCA,32 GAPDH forward primer 5′ TGCACCACCAACTGCTTAGC, and GAPDH reverse primer 5′ GGCATGGACTGTGGTCATGAG.33 Cell Cycle Analysis. HepG2 cells were seeded in 6-well plates with the density of 2 × 105 cells/well. 5 pmol uncaged siRNA (AE/SE) or 5 pmol caged siRNA (AEPC/SE) were transfected to cells in each well. After 48 h incubation at 37 °C, the cells were digested by trypsin-EDTA and collected by centrifugation (1000 × g, 5 min). Then, these cells were fixed by 1 mL cold 70% ethanol at 4 °C for 12 h and collected by centrifugation (1000 × g, 5 min). After the cells were resuspended in 1 mL cold PBS buffer and collected by centrifugation (1000 × g, 5 min), cells were incubated with propidium iodide and RNase A solution at 37 °C for 30 min in the dark and were then analyzed with a flow cytometry (BD FACSAria II). The percentage of cells in the G2/M phase of the cell cycle was calculated using the software ModFitLT.
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.bioconjchem.8b00080.
■
Synthesis; RNA extraction and PCR conditions; NMR and ESI-MS (PDF)
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. ORCID
Xinjing Tang: 0000-0002-9959-1167 Author Contributions #
J.Y and C.C. contributed equally.
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS
We thanks Dr. Bo Xu and MS Yufang Sun (State Key Laboratory of Natural and Biomimetic Drugs) for help with cell imaging and flow cytometry. This work was supported by National Major Scientific and Technological Special Project for “Significant New Drugs Development” (Grant No. 2017ZX09303013) and the National Natural Science Foundation of China (Grant No. 21422201, 21372018, and 21672015). E
DOI: 10.1021/acs.bioconjchem.8b00080 Bioconjugate Chem. XXXX, XXX, XXX−XXX
Communication
Bioconjugate Chemistry
■
opposed terminal extensions: improvement of light-regulation efficiency. Nucleic Acids Res. 38, 2111−2118. (20) Hemphill, J., Borchardt, E. K., Brown, K., Asokan, A., and Deiters, A. (2015) Optical control of CRISPR/Cas9 gene editing. J. Am. Chem. Soc. 137, 5642−5645. (21) Jain, P. K., Ramanan, V., Schepers, A. G., Dalvie, N. S., Panda, A., Fleming, H. E., and Bhatia, S. N. (2016) Development of LightActivated CRISPR Using Guide RNAs with Photocleavable Protectors. Angew. Chem., Int. Ed. 55, 12440−12444. (22) Ankenbruck, N., Courtney, T., Naro, Y., and Deiters, A. (2018) Optochemical Control of Biological Processes in Cells and Animals. Angew. Chem., Int. Ed. 57, 2768−2798. (23) Blidner, R. A., Svoboda, K. R., Hammer, R. P., and Monroe, W. T. (2008) Photoinduced RNA interference using DMNPE-caged 2′deoxy-2′-fluoro substituted nucleic acids in vitro and in vivo. Mol. BioSyst. 4, 431−440. (24) Govan, J. M., Young, D. D., Lusic, H., Liu, Q., Lively, M. O., and Deiters, A. (2013) Optochemical control of RNA interference in mammalian cells. Nucleic Acids Res. 41, 10518−10528. (25) Shah, S., Rangarajan, S., and Friedman, S. H. (2005) LightActivated RNA Interference. Angew. Chem., Int. Ed. 44, 1328−1332. (26) Wu, L., Pei, F., Zhang, J., Wu, J., Feng, M., Wang, Y., Jin, H., Zhang, L., and Tang, X. (2014) Synthesis of site-specifically phosphate-caged siRNAs and evaluation of their RNAi activity and stability. Chem. - Eur. J. 20, 12114−12122. (27) Jain, P. K., Shah, S., and Friedman, S. H. (2011) Patterning of gene expression using new photolabile groups applied to light activated RNAi. J. Am. Chem. Soc. 133, 440−446. (28) Ji, Y., Yang, J., Wu, L., Yu, L., and Tang, X. (2016) Photochemical regulation of gene expression using caged siRNAs with single terminal vitamin E modification. Angew. Chem. 128, 2192− 2196. (29) Petrova, N. S., Chernikov, I. V., Meschaninova, M. I., Dovydenko, I. S., Venyaminova, A. G., Zenkova, M. A., Vlassov, V. V., and Chernolovskaya, E. L. (2012) Carrier-free cellular uptake and the gene-silencing activity of the lipophilic siRNAs is strongly affected by the length of the linker between siRNA and lipophilic group. Nucleic Acids Res. 40, 2330−2344. (30) Sawin, K. E., and Mitchison, T. J. (1995) Mutations in the kinesin-like protein Eg5 disrupting localization to the mitotic spindle. Proc. Natl. Acad. Sci. U. S. A. 92, 4289−4293. (31) Müller, K., and Wagner, E. (2014) RNAi-Based NanoOncologicals: Delivery and Clinical Applications, in Nano-Oncologicals, pp 245−268, Springer. (32) Zhu, C., Zhao, J., Bibikova, M., Leverson, J. D., Bossy-Wetzel, E., Fan, J.-B., Abraham, R. T., Jiang, W., et al. (2005) Functional analysis of human microtubule-based motor proteins, the kinesins and dyneins, in mitosis/cytokinesis using RNA interference. Mol. biol 16, 3187− 3199. (33) Nielsen, R., Courtoy, P. J., Jacobsen, C., Dom, G., Lima, W. R., Jadot, M., Willnow, T. E., Devuyst, O., and Christensen, E. I. (2007) Endocytosis provides a major alternative pathway for lysosomal biogenesis in kidney proximal tubular cells. Proc. Natl. Acad. Sci. U. S. A. 104, 5407−5412.
ABBREVIATIONS RNAi, RNA interference; siRNA, short interfering RNA; Ago, Argonaute; HDL, high-density lipoprotein; LDL, low-density lipoprotein (LDL); GFP, green fluorescent protein
■
REFERENCES
(1) Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806− 811. (2) Hannon, G. J. (2002) RNA interference. Nature 418, 244−251. (3) Jinek, M., and Doudna, J. A. (2009) A three-dimensional view of the molecular machinery of RNA interference. Nature 457, 405−12. (4) Wittrup, A., and Lieberman, J. (2015) Knocking down disease: a progress report on siRNA therapeutics. Nat. Rev. Genet. 16, 543−552. (5) Chen, C., Yang, Z., and Tang, X. (2018) Chemical modifications of nucleic acid drugs and their delivery systems for gene-based therapy. Med. Res. Rev. 2018, 21479 DOI: 10.1002/med.21479. (6) Raouane, M., Desmaële, D., Urbinati, G., Massaad-Massade, L., and Couvreur, P. (2012) Lipid conjugated oligonucleotides: a useful strategy for delivery. Bioconjugate Chem. 23, 1091−1104. (7) Ueno, Y., Kawada, K., Naito, T., Shibata, A., Yoshikawa, K., Kim, H.-S., Wataya, Y., and Kitade, Y. (2008) Synthesis and silencing properties of siRNAs possessing lipophilic groups at their 3′-termini. Bioorg. Med. Chem. 16, 7698−7704. (8) Nielsen, C., Kjems, J., Sørensen, K. R., Engelholm, L. H., and Behrendt, N. (2014) Advances in targeted delivery of small interfering RNA using simple bioconjugates. Expert Opin. Drug Delivery 11, 791− 822. (9) Soutschek, J., Akinc, A., Bramlage, B., Charisse, K., Constien, R., Donoghue, M., Elbashir, S., Geick, A., Hadwiger, P., Harborth, J., et al. (2004) Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature 432, 173−178. (10) DiFiglia, M., Sena-Esteves, M., Chase, K., Sapp, E., Pfister, E., Sass, M., Yoder, J., Reeves, P., Pandey, R. K., Rajeev, K. G., et al. (2007) Therapeutic silencing of mutant huntingtin with siRNA attenuates striatal and cortical neuropathology and behavioral deficits. Proc. Natl. Acad. Sci. U. S. A. 104, 17204−17209. (11) Brück, J., Pascolo, S., Fuchs, K., Kellerer, C., Glocova, I., Geisel, J., Dengler, K., Yazdi, A. S., Röcken, M., and Ghoreschi, K. (2015) Cholesterol modification of p40-specific small interfering RNA enables therapeutic targeting of dendritic cells. J. Immunol. 195, 2216−2223. (12) Young, D. D., Lively, M. O., and Deiters, A. (2010) Activation and deactivation of DNAzyme and antisense function with light for the photochemical regulation of gene expression in mammalian cells. J. Am. Chem. Soc. 132, 6183−6193. (13) Richards, J. L., Seward, G. K., Wang, Y. H., and Dmochowski, I. J. (2010) Turning the 10−23 DNAzyme on and off with light. ChemBioChem 11, 320−324. (14) Hwang, K., Wu, P., Kim, T., Lei, L., Tian, S., Wang, Y., and Lu, Y. (2014) Photocaged DNAzymes as a general method for sensing metal ions in living cells. Angew. Chem., Int. Ed. 53, 13798−13802. (15) Wang, X., Feng, M., Xiao, L., Tong, A., and Xiang, Y. (2016) Postsynthetic modification of DNA phosphodiester backbone for photocaged dnazyme. ACS Chem. Biol. 11, 444−451. (16) Wu, L., Wang, Y., Wu, J., Lv, C., Wang, J., and Tang, X. (2013) Caged circular antisense oligonucleotides for photomodulation of RNA digestion and gene expression in cells. Nucleic Acids Res. 41, 677−686. (17) Deiters, A., Garner, R. A., Lusic, H., Govan, J. M., Dush, M., Nascone-Yoder, N. M., and Yoder, J. A. (2010) Photocaged morpholino oligomers for the light-regulation of gene function in zebrafish and Xenopus embryos. J. Am. Chem. Soc. 132, 15644−15650. (18) Heckel, A., and Mayer, G. (2005) Light regulation of aptamer activity: an anti-thrombin aptamer with caged thymidine nucleobases. J. Am. Chem. Soc. 127, 822−823. (19) Buff, M. C., Schäfer, F., Wulffen, B., Müller, J., Pötzsch, B., Heckel, A., and Mayer, G. (2010) Dependence of aptamer activity on F
DOI: 10.1021/acs.bioconjchem.8b00080 Bioconjugate Chem. XXXX, XXX, XXX−XXX
