Chem. Res. Toxicol. 1991,4, 638-641
638
(10) Farmer, P. B., Foster, A. B., Jarman, M., and Tisdale, M. J. (1973) The alkylation of 2'-deoxyguanosine and of thymidine with diazoalkanes. Biochem. J. 135, 203-213. (11) Jones, J. W., and Robins, R. K. (1963) Purine nucleosides. 111. Methylation studies of certain naturally occurring purine nucleosides. J . Am. Chem. SOC.85, 193. (12) Robins, M. J., and Basom, G. L. (1973) Nucleic acid related compounds. 8. Direct conversion of 2'-deoxyinosine to 6-chloropurine 2'-deoxyriboside and selected 6-substituted deoxy-
nucleosides and their evaluation as substrates of adenosine deaminase. Can. J . Chem. 51, 3161. (13) Singer, B., and Bartach, H. (1986) The role of cyclic nucleic acid adducts in carcinogenesis and mutagenesis, IARC, Lyon. (14) Seto, H., Seto, T., Takesue, T., and Ikemura, T. (1986) Reaction of malonaldehyde with nucleic acid. 111. Studies of the fluorescent substances released by enzymatic digestion of nucleic acids modified with malonaldehyde. Chem. Pharm. Bull. 34, 5079-5085.
Chromium Bound to DNA Alters Cleavage by Restriction Endonucleases Kim M. Borgesti* and Karen E. Wetterhahn* Department of Biochemistry, Dartmouth Medical School, and Department of Chemistry, Dartmouth College, Hanover, New Hampshire 03755 Received June 10, 1991
Introduction Chromium(V1) compounds are known carcinogens in humans and animals (1) and mutagens in bacterial and eukaryotic systems (2). Chromium(V1)-induced DNA damage has been observed in the form of chromium-DNA complexes, DNA interstrand cross-links, DNA-protein cross-links, and DNA strand breaks (3-9). In vitro, significant interaction between chromium and purified DNA has been shown to occur only in the presence of substances able to reduce chromium(V1) to chromium(II1); e.g., reaction of chromium(V1) with DNA in the presence of microsomal enzymes led to chromium-DNA binding and DNA-protein cross-linking (10). Reaction of chromium(VI) with thiols, i.e., glutathione, cysteine, dithiothreitol, or 0-mercaptoethanol, in the presence of DNA resulted in chromium-DNA binding, as well as formation of glutathione-chromium(II1)-DNA and cysteine2-4-chromium(111)-DNA complexes (11,12). Chromium-DNA adduct formation, which appears to occur preferentially at guanine bases (10,12-14), induced aggregation and other conformational changes in DNA (11). Cross-linking of protein to DNA in CHO cells treated with chromium(V1) was shown to be mediated by chromium(III), and it was suggested that DNA replication, as well as RNA transcription and processing, would be affected by the DNA-protein cross-links (8). There is both in vitro and in vivo evidence for the ability of chromium-DNA complexes to affect normal DNAprotein interactions. Chromium(II1) increased the processivity of the Klenow fragment of DNA polymerase I and thereby enhanced the incorporation of nucleotides into newly synthesized DNA during replication of a singlestranded DNA template in vitro (15). Binding of chromium(II1) to plasmid DNA resulted in the inhibition of cleavage by the restriction enzyme HaeII, and it was suggested that modification of DNA structure by chromium(II1) could influence the interaction of regulatory proteins with specific DNA recognition sequences (16). Treatment of chick embryos in vivo with chromium(V1) resulted in differential effects on the expression of inducible and constitutive genes in liver, and the changes in expression of targeted genes correlated with chromium-
* To whom correspondence should be addressed at the Department of Chemistry, Steele Hall, Dartmouth College, Hanover, NH 03755. Department of Biochemistry, Dartmouth Medical School. *Present address: Department of Cellular and Molecular Biology, University of Auckland, Auckland, New Zealand.
(VI)-inducedDNA damage in the form of chromium-DNA binding and DNA cross-links (3, 17). These studies indicate that chromium-DNA complexes may affect normal DNA-protein and DNA-enzyme interactions and thus potentially could interfere with both replication and transcription processes. Restriction endonucleases provide a well-characterized model system for studying sequence-specific DNA-protein interactions that are important in fundamental cellular processes (18). In order to determine whether glutathione-chromium(II1)-DNA complexes and other chromium-DNA adducts can alter the ability of enzymes to interact with DNA, we studied cleavage of chromiummodified DNA by restriction endonucleases. We report that the presence of chromium-DNA adducts can inhibit as well as enhance cleavage by restriction endonucleases, depending on the endonuclease involved, the DNA substrate, and the extent of chromium-DNA binding.
Experimental Procedures Supercoiled (form I) or PstI-linearized (form III) pBR322 DNA, or EcoRI-linearized SV40 DNA (form 111),was purified of contaminating metal ions by dialysis for 12 h a t 4 "C against 0.05 M Tris-HC1 (pH 7.0) containing 1 mM diethylenetriaminepentaacetic acid (Aldrich Chemical Co., Milwaukee, WI), followed by dialysis against the buffer only for 12 h at 4 "C. DNA (48 pM DNA-P') was incubated with 480 pM chromium(V1) (240 pM potassium dichromate, Fisher Scientific, Medford, MA) and dithiothreitol(O.48 or 2.4 mM, Bethesda Research Laboratories, Gaithersburg, MD), P-mercaptoethanol (2.4 or 4.8 mM, Sigma Chemical Co., St. Louis, MO), or glutathione (9.6 mM, Sigma Chemical Co.) at 37 OC for 30 min in 0.05 M Tris-HC1 (pH 7.0). Reactions containing 1.8 mM chromium(V1) and 18 mM glutathione were also prepared. Chromium(V1) solutions contained 0.12 pCi of [51Cr]sodiumchromate/nmol of chromium (15.631.2 Ci/mmol of Cr, New England Nuclear-Du Pont, Boston, MA). The reactions were stopped by cooling 0 OC, and chromium-DNA complexes were isolated by NENsorb 20 column (New England Nuclear-Du Pont) chromatography (11). DNA was assayed fluorimetrically using a modification of the diaminobenzoic acid technique of Kissane and Robbins (19),and levels of chromium were measured by scintillation counting in Aquasol-2 (New England Nuclear-Du Pont) using a Packard 1900CA liquid scintillation counter. The counting efficiency for [61Cr]chromium was 35% based on a quench curve. The residual chromium levela (typically less than 5%) in control samples lacking thiol, chromium, or DNA were subtracted from the levels in the complete Abbreviations: bp, DNA base pair, BME, 8-mercaptoethanol;DTT, dithiothreitol; DNA-P, DNA nucleotide: EDTA, disodium ethylenediaminetetraacetic acid; GSH, reduced glutathione.
0893-228~/91/2704-0638$02.50/0 0 1991 American Chemical Society
Communications
Chem. Res. Toxicol., Vol. 4, No. 6, 1991 639
Table I. Summary of the Effects of Chromium-DNA Binding on the Restriction Endonuclease Cleavage of pBR322 and SV40 DNA at the NdeI and BamHI Recognition Sites" DNA sequence plasmid (form) nuclease Cr/DNA-P (thiol) effect GTACTGAGAGTGCACCATATGCGGTGTGAAATACCG pBR322(I) NdeI 0.02 (GSH) inhibition pBR322 (I, 111) 0.005 to 0.2 (@ME,DTT) enhancement TCAACAGCCTGTTGGCATATGGTTTTTTGGTTTTTG SV40 (111) NcleI 0.017 (GSH) none AGTAAGCACAGCAAGCATATGCAGTTAGCAGACATT
CCACACCCGTCCTGTGGATCCTCTACGCCGGACGCA AGAGGAGCTTCCTGGGGATCCAGACATGATAAGATA
pBR322 (I, 111) SV40(III)
BamHI RamHI
0.006 (@ME) 0.03 (@ME) 50.055 (@ME,GSH) 0.017 (GSH) 0.006, 0.03 (@ME)
none enhancement none enhancement inhibition
"Recognition sites (bold type) and 15 bases on each side are listed. reaction mixtures to obtain ratios of chromium bound per DNA nucleotide. Chromium-modified DNA (0.2 pg) was digested with BamHI, DraI, NarI, or NdeI restriction endonuclease (Bethesda Research Laboratories, Gaithersburg, MD) a t 37 "C for 30 min in a 90-pL reaction volume using buffers supplied by the manufacturer. Sufficient endonuclease was present such that control DNA digests were - 7 0 4 0 % complete after a 30-min incubation a t 37 "C. Units of enzyme per 0.1 pg of DNA were as follows: 1.0-2.0 for BamHI, 0.9 for DraI, 0.4 for NarI, and 0.5-2 for NdeI digestion reactions. Reactions were stopped by cooling to 0 "C and addition of a stop solution to give final concentrations of 12.5 mM EDTA, 0.1% SDS, 0.005% bromophenol blue, 0.005% xylene cyanol, and 5% glycerol. Restriction fragments were analyzed immediately by agarose (0.7%) gel electrophoresis (11).
Results DNA cleavage patterns were equivalent when control DNA (processed as above in the absence of chromium and thiol) and chromium(V1)-treated DNA (typically 1 X Cr/DNA-P without thiol present) were used as substrates for restriction endonuclease digestion (data not shown). No change in restriction enzyme cleavage, relative to cleavage of DNA incubated with chromium(V1) only, was observed when chromium(V1) reduction by any of the thiols led to low levels of chromium-DNA binding (< -5 X Cr/DNA-P, data not shown). However, when the concentrations of chromium(V1) and glutathione produced chromium binding to supercoiled pBR322 plasmid a t a level of -2 X Cr/DNA-P, linearization by NdeI endonuclease was inhibited; DNA without chromium, DNA treated with chromium(V1) only, and DNA treated with chromium(V1) and 0-mercaptoethanol were cleaved completely by NdeI enzyme (Figure 1). Reaction of supercoiled pBR322 DNA with these higher concentrations of chromium and glutathione induced nicking of the plasmid to the open circular from (Figure 1, lane 4), and therefore it appears that NdeI endonuclease was unable to cleave the glutathionechromium-DNA complex of open circular plasmid. Linearized SV40 DNA treated with the higher concentrations of chromium(V1) and glutathione (-1.7 X Cr/DNA-P) was cleaved by B Q ~ Hendonuclease I to a 4492 bp fragment and a 751 bp fragment more readily than were untreated and chromium(V1)-treated DNA (Table I). DNA treated with chromium(V1) and 0-mercaptoethanol to similar levels of chromium binding (6 X and 3 X Cr/DNA-P) was not cleaved by BamHI endonuclease. Thus, when the reducing agent present was glutathione, treatment of linear SV40 DNA with chromium(V1) enhanced R Q ~ Hcleavage, I but when the reducing agent was P-mercaptoethanol, BamHI cleavage was inhibited. The same chromium-SV40 DNA samples showed different cleavage effects when treated with NdeI endonuclease (Table I). No change in NdeI cleavage ability was apparent [relative to chromium(V1)-treated DNA] when the P-mercaptoethanol/chromium(VI)reaction led to a low
-
1
2
3
4
5
6
7
8
9
10
11
Figure 1. Restriction endonuclease cleavage of supercoiled pBR322 DNA isolated after treatment with chromium(V1) in the presence of P-mercaptoethanol or glutathione. Form I (supercoiled) pBR322 DNA was incubated with potassium dichromate and P-mercaptoethanol @ME) or glutathione (GSH), and DNA was isolated as described in the text. DNA (0.1 pg) treated with Cr(V1) only, or Cr(V1) and thiol, was digested with NdeI (1unit) a t 37 "C for 30 min as described in the text and was analyzed on an agarose gel. Lanes 2 and 7 contain untreated DNA (no chromium); lanes 3 and 8 contain DNA teated f Cr(VI) only; lanes 4 and 9 contain DNA treated with 1.8 mM Cr(V1) and 18 mM GSH (final Cr/DNA-P -2 X lanes 5 and 10 contain DNA treated with Cr(VI) and PME (final Cr/DNA-P -1.4 X lanes 6 and 11 contain DNA treated with Cr(V1) and @ME (final Cr/DNA-P -5.5 X Lane 1, X DNA-BstEII digest; lanes 2-6, undigested; lanes 7-11, NdeI.
level of bound chromium (6 X Cr/DNA-P), or when the DNA template contained glutathione-chromium-DNA adducts. However, NdeI cleavage was enhanced on chromium(VI)/P-mercaptoethanol-treated DNA with 3 x Cr/DNA-P. Since single-strand breaks cannot be detected in linear DNA under these electrophoresis conditions, it is not known whether chromium-induced DNA nicking occurred in any of these samples. Enhancement of DNA cleavage by NdeI endonuclease also was observed on pBR322 DNA with moderate levels of bound chromium after chromium(VI)/dithiothreitol or chromium(VI)/P-mercaptoethanoltreatment. Chromium-DNA binding ( -0.2-0.24 Cr/DNA-P), which induced slight DNA conformational distortion in supercoiled plasmid, enhanced linearization by NdeI enzyme, even though DNA cleavage by the other enzymes was inhibited under these conditions (Figure 2A). Linearized pBR322 DNA with 2 X Cr/DNA-P after chromium(VI)/Pmercaptoethanol treatment showed increased cleavage by NdeI endonuclease only; the other enzymes cleaved control and chromium-modified DNA to the same extent (Figure 2B). Enhanced NdeI endonuclease cleavage also was apparent when only -5 X chromium per nucleotide were bound after chromium(V1) and P-mercaptoethanol treatment (Table I).
-
Communications
640 Chem. Res. Toxicol., Vol. 4, No. 6, 1991 1
A
2 3
4
5
6
7
8
9101112
1 2
3675
I
3
4
5
6
7
8 9101112
3675
1929 1929
702
B
1
2
3
4
5
6
7
8
9101112
111 3675
1929
Figure 2. Restriction endonuclease cleavage of pBR322 DNA isolated after treatment with chromium(V1) in the presence of 0-mercaptoethanol or dithiothreitol. Form I (supercoiled) pBR322 DNA was incubated with potassium dichromate and dithiothreitol (DTT), form 111 (PstI linearized) pBR322 DNA was incubated with potassium dichromate and P-mercaptoethanol (PME), and DNA was isolated, digested, and analyzed on agarose gels. (A) Form I pBR322 DNA treated with dithiothreitol (final Cr/DNA-P = 2.43 X 10-l); (B) form 111 pBR322 DNA treated with 6-merLanes 2,4, 6, 8, captoethanol (final Cr/DNA-P = 2.07 X and 10 contain DNA treated with Cr(V1) only; lanes 3, 5, 7, 9, and 11 contain DNA treated with Cr(V1) and thiol. Lanes 1and 12, X DNA-BstEII digest; lanes 2 and 3, undigested; lanes 4 and 5,RamHI; lanes 6 and 7, NarI; lanes 8 and 9, NdeI; lanes 10 and 11, DraI.
When high levels of DNA-bound chromium induced detectable DNA conformational changes (-0.2-> 1 Cr/ DNA-P), as manifested as diffuse DNA bands and decreased electrophoretic mobility, cleavage by RamHI, NarI, NdeI, and DraI restriction endonucleases was inhibited. Decreased cleavage of linearized pBR322 DNA that had been reacted with chromium(V1) in the presence of pmercaptoethanol ( -0.4 Cr/DNA-P) was observed for all four endonucleases [relative to chromium(V1)-treated DNA] (Figure 3). The extent of endonuclease cleavage inhibition was similar for supercoiled and linearized substrate DNA, and results were identical for chromium-DNA complexes formed during reaction with either dithiothreitol or 0-mercaptoethanol (data not shown). In order to test whether decreased DNA cleavage resulted from a chromium-induced effect on the endonuclease itself, rather than an effect on the DNA substrate, X DNA was digested with BamHI or NdeI endonuclease in the presence and absence of either untreated pBR322 DNA or pBR322 DNA highly modified with chromium (-0.47 Cr/DNA-P). As expected, chromium-DNA complexes alone showed decreased cleavage relative to control pBR322 DNA. How-
Figure 3. Restriction endonuclease cleavage of pBR322 DNA isolated after treatment with chromium(V1) in the presence of 6-mercaptoethanol. Form I11 (PstI linearized) pBR322 DNA was incubated with potassium dichromate and P-mercaptoethanol (PME), and DNA was isolated as described in the text. Chromium-DNA (0.2 pg, final Cr/DNA-P = 4.01 X 10-l) was digested with BamHI (2.8 units), NarI (0.8 unit), NdeI (4 units), or DraI (1.8 units) a t 37 "C for 30 min as described in the text, samples were loaded onto a 0.7% agarose gel containing 0.5 pg/mL ethidium bromide, and the gel was electrophoresed a t 4 V/cm for 3 h. Lanes 2,4,6,8, and 10 contain DNA treated with Cr(V1) only; lanes 3, 5, 7, 9, and 11 contain DNA treated with Cr(V1) and thiol. Lanes 1 and 12, X DNA-BstEII digest; lanes 2 and 3, undigested; lanes 4 and 5, BamHI; lanes 6 and 7, NarI; lanes 8 and 9, NdeI; lanes 10 and 11, DraI.
ever, X DNA was cleaved to the same extent regardless of whether it was digested alone, in the presence of untreated pBR322 DNA, or in the presence of chromium-DNA complexes (data not shown). As the restriction endonucleases were able to cleave the X DNA in the presence of chromium-DNA complexes, the enzymes were not affected by the chromium present.
Discussion The varied endonuclease reactivity observed with the different chromium-DNA substrates could result from different chromium-DNA interactions. The chromium(V) species formed upon reaction of chromium(V1) with thiols differ qualitatively and quantitatively depending on the thiol involved in chromium(V1) reduction and influence the extent of chromium binding to the DNA (11). It is likely that different chromium(V1) reduction pathways lead to formation of structurally different DNA adducts. The fact that glutathione-chromium-DNA complexes result in inhibition of NdeI cleavage of pBR322 DNA and enhancement of RamHI cleavage of SV40 DNA, whereas the chromium-DNA complexes formed in reactions of DNA with chromium(V1) and p-mercaptoethanol result in enhancement of NdeI cleavage of pBR322 DNA and inhibition of BamHI cleavage of SV40 DNA, suggests that restriction endonucleases can be sensitive to the nature of the chromium-DNA adduct. Preferential chromium binding to certain DNA bases or conformations in the vicinity of the enzyme recognition site also could influence the DNA-protein interaction by changing either the enzyme contact points or the DNA conformation. Previous studies implicate guanine as the preferred base for chromium interaction (10,12-14). The GC base pair content of the NdeI recognition site plus 10 base pairs on each side is 50% for both pBR322 DNA and SV40 sites (Table I), and chromium bound to these guanine bases may account for the alterations in NdeI cleavage. However, high guanine content proximal to the enzyme recognition site cannot be the only factor deter-
Communications mining chromium-induced changes in enzyme activity, because BamHI cleavage was unaltered when pBR322 substrate DNA was digested (69% GC bp near the recognition site and surrounding 20 bp), but cleavage of SV40 DNA (50% GC b p ) was enhanced. The g u a n i n e content of the recognition site alone does not correlate with altered enzyme cleavage, since the NarI recognition site (GG’CGCC) consists only of g u a n i n e and cytosine bases, but showed no evidence of specific chromium-induced cleavage alteration, and NdeI endonuclease,which has only 2 GC bp in its 6 bp recognition site (CA’TATG), did exhibit altered cleavage activity. It is also possible that chromium interacts with the pentanucleotide GAGAG, which occurs six base pairs upstream from the NdeI recognition sequence in pBR322 DNA. Chromium has been shown to bind avidly to poly(dA-dG).poly(dC-dT) in the presence of g l u t a t h i o n e (12). In contrast, enzymes with varied recognition sequences and sequence contexts were inhibited upon interaction with highly chromium-modified substrate DNA, suggesting that chromium binding cannot be localized to particular DNA bases or base sequences under these conditions. Endonuclease inhibition may have resulted from overall DNA conformational distortions induced by extensive chromium binding, rather than from interference by chromium bound at specific enzyme recognition sites. DNA supercoiling can influence the chromium-DNA interaction (11) and may account for some of the differences observed with endonuclease cleavage of supercoiled and linear DNA modified with chromium. However, enhancement of NdeI cleavage was observed on both supercoiled and linear pBR322 DNA, and thus supercoiling or other long-range conformational effects were not required for the increased cleavage in this case. It is possible that the chromium-DNA complexes differentially affect the processivity of the various restriction endonucleases, since the interaction of chromium(II1) with DNA has been shown to increase the processivity of DNA polymerase I (15).
Other studies indicate that chromium induces both enhancement and inhibition of DNA processing enzymes. Chromium(II1) binding to DNA (20),and chromatin in vitro (21) and in vivo (22), enhanced transcription b y Escherichia coli RNA polymerase. Basal transcription of two inducible genes in vivo was enhanced b y administration of chromium(V1) to chick embryos; however, inhibition of xenobiotic-induced expression of these same genes was observed, suggesting that chromium-induced DNA damage interferes with binding of transcription factors to specific recognition sequences (3). Inhibition of DNA synthesis occurred in cultured cells treated with chromium(V1) compounds ( 2 0 , 2 3 , 2 4 ) .In vitro, the presence of potassium chromate during DNA synthesis by E. coli DNA polymerase I inhibited DNA polymerization (24). Low levels of chromium(II1) (0.5-5 p M ) enhanced DNA polymerase I (Klenow fragment) activity in vitro, while higher concentrations of the metal inhibited the enzyme (15). In summary, glutathione-chromium-DNA adducts, as well as other chromium-DNA complexes, induced both inhibition and enhancement of restriction endonuclease DNA supercoiling, the n a t u r e of the DNA template, the n a t u r e of the reducing a g e n t involved in generation of reactive chromium, and the level of chromium binding on the DNA molecule were all factors which altered the activity of a given restriction endonuclease on a chromium-modified DNA template. Modulation of the interactions of DNA with enzymes and proteins b y chromium-DNA adducts m a y be important to the biological activity of chromium. cleavage.
Chem. Res. Toxicol., Vol. 4, No. 6, 1991 641
Acknowledgment. This research was supported by
USPHS Grants CA34869 and CA45735 awarded by the National Cancer Institute, DHHS. References (1) Fan, A. M., and Harding-Barlow, I. (1987) Chromium. Adu. Mod. Enuiron. Toxicol. 11, 87-125.
(2) DeFlora, S., and Wetterhahn, K. E. (1989) Mechanisms of chromium metabolism and genotoxicity. Life Chem. Rep. 7, 169-244. (3) Hamilton, J. W., and Wetterhahn, K. E. (1989) Differential effects of chromium(V1) on constitutive and inducible gene expression in chick embryo liver in vivo and correlation with chromium(V1)-induced DNA damage. Mol. Carcinog. 2, 274-286. (4) Tsapakos, M. J., Hampton, T. H., and Wetterhahn, K. E. (1983) Chromium(V1)-induced DNA lesions and chromium distribution in rat kidney, liver, and lung. Cancer Res. 43, 5662-5667. (5) Hamilton, J. W., and Wetterhahn, K. E. (1986) Chromium(VI)-induced DNA damage in chick embryo liver and blood cells in uiuo. Carcinogenesis 7,2085-2088. (6) Cupo, D. Y., and Wetterhahn, K. E. (1984) Repair of chromate-induced DNA damage in chick embryo hepatocytes. Carcinogenesis 5, 1705-1708. (7) Wedrychowski, A., Schmidt, W. N., and Hnilica, L. S. (1986) DNA-protein crosslinking by heavy metals in Novikoff hepatoma. Arch. Biochem. Biophys. 251, 397-402. (8) Miller, C. A., and Costa, M. (1988) Characterization of DNAprotein complexes induced in intact cells by the carcinogen chromate. Mol. Carcinog. 1, 125-133. (9) Sugiyama, M., Ando, A., Nakao, K., Ueta, H., Hidaka, T., and Ogura, R. (1989) Influence of vitamin B2 on formation of chromium(V), alkali-labile sites, and lethality of sodium chromate(V1) in Chinese hamster V-79 cells. Cancer Res. 49, 6180-6184. (10) Tsapakos, M. J., and Wetterhahn, K. E. (1983) The interaction of chromium with nucleic acids. Chem.-Bid. Interact. 46, 265-277. (11) Borges, K. M., Boswell, J. S., Liebross, R. H., and Wetterhahn, K. E. (1991) Activation of chromium(V1) by thiols results in chromium(V) formation, chromium binding to DNA and altered DNA conformation. Carcinogenesis 12, 551-561. (12) Borges, K. M., and Wetterhahn, K. E. (1989) Chromium cross-links glutathione and cysteine to DNA. Carcinogenesis 10, 2165-2168. (13) Tamino, G., Peretta, L., and Levis, A. G . (1981) Effects of trivalent and hexavalent chromium on the physicochemical properties of mammalian cell nucleic acids and synthetic polynucleotides. Chem.-Bid. Interact. 37, 309-319. (14) Wolf, Th., Kasemann, R., and Ottenwalder, H. (1989) Molecular interaction of different chromium species with nucleotides and nucleic acids. Carcinogenesis 10, 655-659. (15) Snow, E. T., and Xu, L. S. (1989) Effects of chromium(II1) on DNA replication in vitro. Biol. Trace Elem. Res. 21, 61-71. (16) Persson, D., Osterberg, R., and Bjursell, G. (1986) Mechanism of chromium carcinogenesis. Acta Pharmacol. Toxicol. 59, 260-263. (17) Alcedo, J. A,, and Wetterhahn, K. E. (1990) Chromium toxicity and carcinogenesis. Int. Reu. Exp. Pathol. 31, 85-108. (18) Conrad, M., and Topal, M. D. (1989) DNA and spermidine provide a switch mechanism to regulate the activity of restriction enzyme NaeI. Proc. Natl. Acad. Sci. U.S.A. 86, 9707-9711. (19) Kissane, J. M., and Robins, E. (1958) The fluorometric measurement of deoxyribonucleic acid in animal tissues with special reference to the central nervous system. J. Biol. Chem. 233, 184-1 88. (20) Okada, S., Taniyama, M., and Ohba, H. (1982) Mode of enhancement in ribonucleic acid synthesis directed by chromium(111)-bounddeoxyribonucleic acid. J.Inorg. Biochem. 17, 41-49. (21) Ohba, H., Suketa, Y., and Okada, S. (1986) Enhancement of in vitro ribonucleic acid synthesis on chromium(II1)-bound chromatin. J . Inorg. Biochem. 27, 179-189. (22) Okada, S., Tsukada, H., and Ohba, H. (1984) Enhancement of nucleolar RNA synthesis by chromium(II1) in regenerating rat liver. J . Inorg. Biochem. 21, 113-124. (23) Levis, A. G., Buttignol, M., Bianchi, V., and Sponza, G. (1987) Effects of potassium dichromate on nucleic acid and protein syntheses and on precursor uptake in BHK fibroblasts. Cancer Res. 38, 110-116. (24) Nishio, A., and Uyeki, E. M. (1985) Inhibition of DNA synthesis by chromium compounds. J. Toxicol. Enuiron. Health 15, 237-244.
