Cloning and Expression of a Nonribosomal Peptide Synthetase to

Subscriber access provided by University of South Dakota

Letter

Cloning and expression of a non-ribosomal peptide synthetase to generate blue rose Ankanahalli N Nanjaraj Urs, Yiling Hu, Pengwei Li, Michael Yuchi, Yihua Chen, and Yan Zhang ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.8b00187 • Publication Date (Web): 14 Sep 2018 Downloaded from http://pubs.acs.org on September 16, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Cloning and expression of a non-ribosomal peptide synthetase to generate blue rose Ankanahalli N Nanjaraj Urs1, Yiling Hu1, Pengwei Li2, Zhiguang Yuchi1, Yihua Chen2,3*, Yan Zhang1* 1

Tianjin Key Laboratory for Modern Drug Delivery & High-Efficiency, Collaborative Innovation Center of Chemical Science and Engineering, School of Pharmaceutical Science and Technology, Tianjin University, Tianjin 300072, China

2

State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China 3

University of Chinese Academy of Sciences, Beijing 100049, China

*

To whom correspondence should be addressed: Phone: (86) 22-87401835. Fax: (86) 22-87401830. E-mail: [email protected] Phone: (86) 10-64806121. Fax: (86) 10-64807468. E-mail: [email protected]

Abbreviations IdgS: Indigoidine synthetase NRPS: Non ribosomal peptide synthetase PPTase: Phosphopantetheinyl transferase RhAG: Rose homolog AGAMOUS C function gene CHS: Chalcone synthase gene

1 ACS Paragon Plus Environment

ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Graphical Abstract

Abstract Rose has been entwined with human culture and history. “Blue rose” in English signifies unattainable hope or impossible mission as it does not exist naturally and is not breedable regardless of centuries of efforts by gardeners. With the knowledge of genes and enzymes involved in flower pigmentation and modern genetic technologies, synthetic biologists have undertaken the challenge of producing blue rose by engineering the complicated vacuolar flavonoid pigmentation pathway and resulted in a mauve coloured rose. A completely different strategy presented in this study employs a dual expression plasmid containing bacterial idgS and sfp genes. The holo-IdgS, activated by Sfp from its apo-form, is a functional nonribosomal peptide synthetase that converts L-glutamine into a blue pigment indigoidine. Expression of these genes upon petal injection with agro-infiltration solution generates blue-hued rose flowers. We envision that implementing this proofof-concept with obligatory modifications may have tremendous impact in floriculture to achieve historic milestone in rose breeding. Keywords Blue rose, non-ribosomal peptide synthetase, indigoidine, petal specific promoters, agro-infiltration. 2 ACS Paragon Plus Environment

Page 2 of 17

Page 3 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Flower color is one of the vital characteristics of angiosperms to attract pollinators for efficient reproduction. Wild plants depict limited flower color range as the degree of variability of flower coloration has co-evolved with pollinators color vision1. Flowers have long been admired and used by humans as decorations of their environments, objects of romance, rituals, religions, medicines and foods, in addition to their role in sexual hybridization. Accordingly, from the floricultural viewpoint, production of novel colored varieties of flowers with commercial value is of great interest. In general, flavonoids, carotenoids and betalains are the major pigments responsible for flower colors. Among them, flavonoids (especially anthocyanins) contribute most to the range and type of colored pigments2. Thus, to unravel the ingenuity of plants to produce flowers with diverse color range, anthocyanin biosynthetic pathway leading to floral pigment accumulation has been well studied in terms of biochemistry, genetics and molecular biology3-4. The major chromophores of anthocyanins are pelargonidin, cyanidin and delphinidin5. B-ring hydroxylation patterns of dihydrokaempferol (DHK), the common precursor of these chromophores plays a key role in determining flower color. DHK can be hydroxylated at the 3' position to produce dihydroquercetin (DHQ) and at 3' and 5' positions to produce dihydromyricetin (DHM). DHK leads to the production of pelargonidin-based anthocyanins contributing to yellow flowers. DHQ leads to the generation of cyanidin-based anthocyanins contributing to red and pink flowers. DHM leads to the generation of delphinidin-based anthocyanins generating blue or violet flowers (Supplementary Figure 1). These hydroxylation reactions are usually catalyzed by two cytochrome P450 mono-oxygenases, namely flavonoid 3'hydroxylase (F3'H) and flavonoid 3',5'-hydroxylase (F3'5'H). Therefore, the presence or absence of these enzymes in different plant species contributes to observed petal color variations among angiosperms3, 6. Other factors also influence the petal coloration; methylation instead of hydroxylation at the same position of the DHK Bring results in slight reddening7. The pH of the vacuole where anthocyanins localize is also critical; weakly acidic or neutral pH imparts a blue color, while acidic pH gives a red color. Presence of co-pigments, usually flavones and flavonols, causes a bathochromic shift, when they stack with anthocyanins8. The formation of a complex with metal ions is another determinant of petal color9. Thus, final petal coloration depends on regulations of all these factors and is of great complexity. Roses are the most important commercial cut flowers with an annual global market value of ~5 billion USD (an estimate of US international trade commission). Wild roses usually have limited range of flower colors (white, pink and red) accumulating anthocyanins derived from cyanidin3. Extensive selection, mutation and hybridization breeding of wild rose species over hundreds of years ensued a variety of shapes, sizes and colors except for long missing blue, because roses do not naturally possess F3'5'H6, 10. Japanese Suntory/Australian Florigene companies recently marketed "SUNTORY blue rose APPLAUSE", a rose cultivar with engineered anythocyanin biosynthetic pathway. A pansy (Viola spp) F3'5'H gene and 3 ACS Paragon Plus Environment


an iris dihydroflavonol 4-reductase (DFR) gene were introduced to direct the 'blue' pigment synthesis pathway and the rose endogenous DFR was silenced to block the “red and yellow” pathways11-12. In addition, roses with higher vacuolar pH, large amount of co-pigments and weak F3'H activity were selected. Regardless of these 20-year-lasting meticulous efforts, "SUNTORY APPLAUSE" is indeed of mauve color13. Considering the complexity and challenges associated with engineering rose flavonoid biosynthetic pathway, present study demonstrates a completely novel alternative: Introducing a microbial non-ribosomal peptide synthetase (NRPS) that can synthesize the blue pigment indigoidine, to generate blue rose. Inspiration was stimulated by the use of a NRPS capable of producing indigoidine as cross-kingdom reporter system14-16. Non-ribosomal peptides are exclusively produced by microorganisms and belong to a class of peptide secondary metabolites with diverse properties such as toxins, siderophores, pigments, antibiotics, cytostatics, immunosuppressants and anticancer agents17. Unlike RNA encoded proteins, each non-ribosomal peptide is produced by a specific NRPS, which contains a specific set of domains such as adenylation (A), condensation (C), cyclization (Cy), thiolation (T), and thioesterase (TE) forming a chemical assembly line that synthesizes peptides in a sequential multi-step enzymatic process18. NRPS activation from apo- to holo- form requires post-translational modification catalyzed by a super family of enzyme known as 4'-phosphopantetheinyl transferase (PPTase), which transfers the phosphopantetheinyl group of coenzyme A (CoA) to a conserved serine residue within the T-domain. The resulting functional NRPS activates individual amino acids by respective A-domains as amino acyl adenylates, which subsequently bind to the thiol group of the phosphopantetheinyl arm of T-domain. The C-domain located downstream of each T-domain then catalyzes the condensation between the amino acid or peptide chain and the amino acid tethered by the downstream T-domain so that a growing peptide chain moves from one module to the next until, finally, the completed peptide chain at the last module is released by the catalysis of the TEdomain19-20. Heterologous expression of recombinant NRPS is usually technically challenging due to its large size. However, the relatively small (140 kDa) indigoidine synthetases (IdgSs) from Streptomyces or other bacterial IdgSs were readily expressed in E. coli, Streptomyces, and mammalian cells14. Compared to other NRPS, IdgS is peculiar in that it contains only one A domain and the C-domain is absent21. IdgS catalyzes the cyclization, oxidation and dimerization of L-glutamine (L-Gln), forming indigoidine. The catalytic mechanism has been proposed involving a FMN-dependent oxidation domain (OX) that is integrated into A-domain22. Briefly, the A domain of IdgS activates L-Gln and loads it to the T domain of holo-IdgS. Subsequent cyclization and oxidation steps catalyzed by IdgS TE and OX domains form the lactam monomer, which is then dimerized and oxidized to shape indigoidine possibly by spontaneous reactions (Figure 1)22.The abundance of L-Gln inside the 4 ACS Paragon Plus Environment

Page 4 of 17

Page 5 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


epidermal cells of rose petals makes IdgS-produced indigoidine an ideal alternative to delphinidin for our purpose. Towards this end, the 26 kDa Bacillus subtilis PPTase (Sfp, UniProt ID: P39135) was used as an activator for converting IdgS to its functional holo-form23-24. A dual expression plasmid was constructed from the widely used plant binary vector pBI121. Transfer-DNA (T-DNA) region of this plasmid necessary for the transfer of foreign DNA into host was reconstituted with idgS and sfp under the control of RhAG/NOS and CHS/MAS petal-specific promoter/terminator cassettes respectively25. RhAG, a rose homolog of the Arabidopsis thaliana AGAMOUS C-function gene plays an essential role in rose flower patterning by regulating petal development26. Chalcone synthase (CHS) is a key enzyme of flavonoid/isoflavonoid biosynthetic pathway27. Both genes are known for their petal specific functions, henceforth their promoters were selected. The terminators from nopaline synthase gene (NOS) and mannopine synthase (MAS) of Agrobacterium tumefaciens are known efficient terminators in rose13, 28 and therefore used in our construct (Figure 2). GV3101 carries a disarmed Ti plasmid that possesses the Vir genes needed for TDNA transfer, but has no functional T-DNA region of its own. The dual expression plasmid construct, specifically designed, containing all elements to support agrobacterium mediated T-DNA gene transfer to plant cells with mechanisms as illustrated in Supplementary Figure 2, was thus transformed into agrobacterium GV3101 competent cells. Control plasmids (pBI121 empty vector, pBI121-sfp and pBI121-idgS) were also processed simultaneously. Petals were subsequently injected with agro-infiltration solution for the expression of idgS and sfp genes on rose petals as detailed in “Materials and methods” (Scheme 1). White rose petals injected with agrobacterial cells containing duel expression plasmid resuspended with infiltration buffer containing 150 µg/mL acetosyringone exhibited blue color after 12 hours of incubation. Pictures of two typical flowers, one with multiple spots of royal blue and the other with a single patch of steel blue color, were displayed in Figure 3a and 3b. The appearance of blue color indicates successful TDNA transfer, gene expression and catalytically active recombinant protein produced. By contrast, in the absence of added acetosyringone, introduced blue color was locally restricted to a small area of the petal, at around the injection site, likely due to local and low concentration of acetosyringone released from the wounded petal tissue upon needle injection (Figure 3c). The blue pigment was not observed in the petals injected with control plasmids (Figure 3d-f). The fact that both genes are needed for the formation of blue pigment in the petals suggests that it is a result of IdgS enzymatic activity upon holoenzyme assembly. To further confirm the nature of the blue pigment observed on the engineered rose petals, the raw extract was dissolved in dimethyl sulfoxide (DMSO) and subjected to visible light and mass spectrometric analyses. An all-wavelength scan in the visible range of the petal extract resulted in a prominent peak with a λmax at 612 nm (Figure 4a), consistent with the previously reported λmax of indigoidine in DMSO21. 5 ACS Paragon Plus Environment


The petal extract was also subjected to mass spectrometry (MS) in positive ionization mode, using atmospheric pressure chemical ionization (APCI) method. A prominent peak at 287.0540 m/z (Fig. 4b) matching the mass of indigoidine with potassium ionization was observed, which is absent in the extract of control petals transformed with empty plasmid (Fig. 4c). Taken together, the blue pigment formed on our biologically engineered rose petals is indigoidine. The novel strategy we employed overcomes all the difficulties that the previous design on engineering flavonoid biosynthetic pathway encountered. These include insufficient precursor supply, competition of intermediates among different color pigmentation pathways and acidic vacuolar pH. Although short-lived and spotted, to our best knowledge, the rose produced in this study is the first biologically engineered blue one in human history. Generation of stably inheritable transgenic rose plant is time-consuming, but doable through friable embryonic tissues29 or leaf explants30. Efforts on this in line with the choice of promoters to fine tune the intensity of blue color may eventually produce marketable blue rose for human daily life and change the definition of “blue rose” in our dictionary.


Page 6 of 17

Page 7 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1: Proposed working architecture and mechanism of IdgS. Indigoidine is produced through sequential cyclization, oxidation and dimerization of L-glutamine. The four functional modules (domains) of IdgS involved in these reactions are shown as spheres with different colors. A: adenylation (red), OX: oxidation (blue), T: thiolation (green), and TE: thioesterase (orange). It is noted that the OX domain is integrated into the A domain.



Figure 2: Physical map of the dual expression plasmid. RB: Right border repeat from nopaline C58 T-DNA, MASt: Mannopine synthase terminator (synthetic construct), sfp: Bacillus subtilis PPTase, CHSp: Chalcone synthase promoter (synthetic construct), RhAGp: Rose homolog AGAMOUS C function promoter (synthetic construct), idgS: Indigoidine synthetase A, NOSt: Nopaline synthase terminator, LB: Left border repeat from nopaline C58 T-DNA, KanR: Kanamycin resistance gene. PmeI, SacI, BamHI and SpeI are the restriction enzyme sites.


Page 8 of 17

Page 9 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1: T-DNA region of binary vector pBI121 was reconstructed by inserting idgS and sfp genes along with rose petal specific promoter/terminator cassettes. The resulting dual expression plasmid was transformed into GV3101 agrobacterium strain. Petals were injected with agro-infiltration solution for the expression of indigoidine in rose petals.



Figure 3: Formation of blue pigment on transgenic white rose petals. Rose petals infiltrated with GV3101 strain harbouring pBI121-derived dual expression plasmid in the presence of acetosyringone (a and b) or absence of acetosyringone (c); pBI121 empty vector (d), pBI121-sfp (e), and pBI121- idgS (f) in the presence of acetosyringone. Photographs were taken following 12 hours of incubation at room temperature. Arrows indicate the injection site.


Page 10 of 17

Page 11 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4: Spectral analyses of indigoidine extracted from transgenic rose petals. (a). Visible light spectra. The extract of petals transformed with duel expression plasmid and control empty plasmid, and the solvent DMSO alone are as indicated. Inset shows the photographs of glass vials that contain the extract and controls as indicated. (b). APCI mass spectrum of the transgenic petal extract. (c). APCI mass spectrum of the control petal extract with empty plasmid. 11 ACS Paragon Plus Environment


Materials and methods

Chemicals and reagents Luria-Bertani Lennox (LB) medium was prepared with yeast extract and tryptone procured from Oxoid Ltd. (Hants, UK). Acetosyringone, MES buffer Rifampicin, Gentamycin and Kanamycin were purchased from J&K (Beijing, China). Plasmid DNA mini prep, Gel purification and PCR clean up kits were purchased from Omega Bio-tek, Inc. (Norcross, GA). Restriction enzymes (AflII, BamHI, PmeI, SpeI, SacI, XhoI and XmaI), T4 DNA ligase and Gibson Assembly® Cloning Kit were procured from New England Biolabs, USA. All other chemicals and reagents used in this study were of analytical grade and were procured from local firms (Tianjin, China).

Petal specific promoters and terminators Promoter sequences of Rosa hybrida cv. Kardinal Chalcone synthase gene (CHS) (NCBI Accession No. FW556946) and a rose homolog of the Arabidopsis thaliana AGAMOUS C function gene - RhAG (NCBI Accession number U43372) were retrieved from NCBI. The terminator sequence of nopaline synthase (NOS) was derived from pBI121 and that of mannopine synthase (MAS; Gene ID: 1224202) was retrieved from NCBI.

Binary plasmid construction Binary vector pBI121 was used for duel expression construct. PmeI and SacI restriction enzymes were used to remove T-DNA region. This region was then replaced with synthetic gene fragment containing MASt, BamHI restriction site, CHSp, RhAGp and SpeI restriction site (Supplementary sequence 1) to generate a recombinant plasmid pBI121-CHS-RhAG (Figure 1). Recombinant plasmid was further subjected to double digestion with BamHI and SpeI restriction enzymes to separate out promoters fragment from the plasmid backbone and subsequently recovered by gel purification. After recovery, backbone and fragment were assembled with idgS and sfp genes amplified with Gibson assembly primers (Table 1) by PCR using pIDG0215 and pCIM200216 as template plasmids. The idgS and sfp genes were consequently inserted at SpeI and BamHI sites respectively (Figure 1). This dual expression plasmid was verified following transformation, plasmid rescue and sequencing. Control vectors containing sfp alone and idgs alone were constructed by digesting the duel expression plasmid with AflII and XmaI ; XhoI and XmaI restriction enzymes respectively. Linearized vector DNA was then ligated with linker DNA fragments with cohesive ends (AflII and XmaI for pBi121-sfp and XhoI and XmaI for pBi121-idgS respectively) generated by annealing the single stranded DNA fragments (Table 1 and Supplementary Figure 3).


Page 12 of 17

Page 13 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1: Primers used in this study Target Sequence idgS

Name of the primer idgS-F

idgS

idgS-R

sfp

sfp-F

sfp

sfp-R

pBI121-sfp

Linker DNA-F Linker DNA-R Linker DNA-F Linker DNA-R

pBI121-idgS

Sequence (5' to 3') agaaaaaacccaaaagctgcaactaatgacccttcaaga aaccagcgt ttgaacgatcggggaaattcgagctcattattcacccagcag atagcgaatatgt gagatgggtaccgagctcgaattcgatgaagatttacagaa tttatatggaccgccc cctttgccaacatgggagtccaaggctataaaagctcttcgt acgacaccattgt ccgggactccagagcggccc ttaagggccgctctggagtc tcgaggcttgctgaagcttc ccgggaagcttcagcaagcc

Preparation of agrobacterium competent cells Agrobacterium competent cells were prepared according to the method31 with slight modifications using CCMB80 buffer. Briefly, agrobacterium strain (GV3101) was streaked on LB plate with appropriate antibiotics (Rifampicin 10 µg/mL and Gentamycin 50 µg/mL) and grown for single colony at 28°C for 2 days. Single colony of choice was then inoculated into 5 mL LB with appropriate antibiotics and incubated overnight at 28°C with gentle shaking (~ 150 RPM). 2 mL of overnight culture was transferred to 200 ml LB and incubated at 28°C with vigorous shaking (250 RPM) at 28°C until OD600 is around 0.3 to 0.5. The culture was then added to 50 mL falcon tubes chilled on ice and centrifuged at 1500 g for 10 min. Supernatant was discarded and the pellet was gently re-suspended in 80 mL of ice cold CCMB80 buffer and incubated for 20 min on ice. Following incubation, cells were centrifuged again and resuspended in 5 mL of ice cold CCMB80 buffer. 100 µL aliquots of cells were dispensed into pre-chilled 1.5 mL micro-centrifuge tubes. The aliquots were then flash frozen using liquid nitrogen and stored at -80°C until further use.

Agrobacterium transformation About 1 μg of dual expression plasmid and control plasmids were added to respective micro-centrifuge tubes containing GV3101 competent cells placed on ice. The tubes were immediately flash frozen with liquid nitrogen and thawed at 37°C water bath for 5 min. The tubes were then gently shaken (~ 150 RPM) for 3 hours at 28°C following addition of 1 mL LB to allow bacterial strains to express antibiotic resistance genes within the plasmid and centrifuged gently for 1 min at low speed to pellet the cells. Following centrifugation, the cells were spread on LB plate with



appropriate antibiotics (Rifampicin: 10 µg/mL; Gentamycin 50 µg/mL and Kanamycin 50 µg/mL) and incubated at 28°C for 2-3 days.

Preparation of agrobacterium for infiltration Single colony of Agrobacterium strain (GV3101) confirmed by colony PCR was inoculated into 5 mL LB with appropriate antibiotics (Rifampicin: 10 µg/ml; Gentamycin 50 µg/ml and Kanamycin 50 µg/mL) and incubated at 28°C with gentle shaking (~200 RPM, overnight). 1 mL of this starter culture was transferred to 100 mL LB with appropriate antibiotics and incubated at 28°C with gentle shaking (~200 RPM) until OD600 is around 1.5. The cells were then centrifuged at 2500 g for 10 min and the pellet was re-suspended with infiltration buffer (10 mmol/L MgCl2, 10 mmol/L MES, pH 5.6) alone and infiltration buffer containing 150 µg/mL acetosyringone at a cell density of OD600 0.5-1.0 and incubated in dark for 3-5 hours at 22°C. Control plasmids were processed simultaneously in a similar manner.

Petal injection Cut white roses were purchased from local florist house (Tianjin China). The main veins of the petals were marked from the dorsal side. Around 100-150 µL of infiltration inoculums without and with 150 µg/mL acetosyringone were slowly injected into the main vein using 1 mL sterile disposable syringes and flowers were then Incubated in dark at room temperature (22°C) for 12-72 hours with stems immersed in a water-containing bottle to help maintain freshness.

Preparation of crude petal extract Colored spots were excised from petals, frozen with liquid nitrogen and stored at -80ºC until later homogenization with a grinder (Retsch GmbH MM301, Germany). Briefly, frozen petals were transferred to 50 mL screw-top stainless steel grinding jars containing 30 mm grinding ball charge. The jars containing the frozen petals were pre-immersed in liquid nitrogen in a cryo box for 10 min, and then fastened in the quick-clamping device of the MM 301 with a self-locking system. The sample was then immediately ground for 2 min at a frequency of 20 radial oscillations in a horizontal position to obtain the pulverized petal sample. The resulting powder was then transferred to a 50 mL centrifuge tube, washed first with water, and subsequently with methanol using water-bath ultrasonication for 10 min. The polar impurities were removed by centrifugation (10,000g for 10 min at 4ºC). The pellet was dried using a hot air oven set at 60ºC overnight, and the pigment was dissolved in DMSO with 10 min water-bath ultrasonication and successively centrifuged twice (10,000g for 10 min at 4ºC) to remove debris. The supernatant containing pigment of interest was filtered through a 0.2 µ polytetrafluorethylene filter and used for spectral analyses. Petals injected with infiltration inoculums containing control plasmid (pBI121) was also processed simultaneously.


Page 14 of 17

Page 15 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Visible light spectrometry Petal extract in DMSO was transferred to a 1 cm cuvette. An all wavelength scan from 400nm to 800nm was performed using a Cary 60 UV-Vis spectrometer (Agilent Technologies).

Mass spectrometry The petal extract in DMSO was diluted 100 fold with methanol. Formic acid was added to a final concentration of 0.01%. The sample was then injected to micrOTOF-QII (Bruker Daltonics Inc.) for MS analysis using APCI method. Supporting information Generalized flavonoid biosynthetic pathway relevant to flower color (Supplementary Figure 1); Mechanism illustrating the processing and transfer of TDNA from agrobacterium to plant cells (Supplementary Figure 2); Physical map of the control plasmids: pBI121-sfp and pBI121-idgS (Supplementary Figure 3); Synthetic DNA fragment containing terminator region of manopine synthase (MASt) and promoter regions of chalcone synthase gene (CHS) and rose homolog of the Arabidopsis thaliana AGAMOUS C function gene (RhAG) (Supplementary Sequence 1); Supporting references. Conflict of interest A patent application related to this work has been filed. Acknowledgments This work was supported by National Science Foundation China grant 31570060 to Y.Z. and 31522001 to Y.C. National Key Research and Development Program of China 2017YFD0201400 and 2017YFD0201403 to Z.Y. Foreign Young Talent Program sponsorship from State Administration of Foreign Experts Affairs, China to A.N.N. We would like to thank Dazhi Liu and Xinhua Jin for their technical assistance in MS data acquisition.



References 1. Dyer, A. G.; Boyd-Gerny, S.; McLoughlin, S.; Rosa, M. G.; Simonov, V.; Wong, B. B., Parallel evolution of angiosperm colour signals: common evolutionary pressures linked to hymenopteran vision. Proc Biol Sci 2012, 279 (1742), 3606-15. 2. Tanaka, Y.; Sasaki, N.; Ohmiya, A., Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J 2008, 54 (4), 733-49. 3. Tanaka, Y.; Brugliera, F.; Chandler, S., Recent progress of flower colour modification by biotechnology. Int J Mol Sci 2009, 10 (12), 5350-69. 4. Tanaka, Y.; Ohmiya, A., Seeing is believing: engineering anthocyanin and carotenoid biosynthetic pathways. Curr Opin Biotechnol 2008, 19 (2), 190-7. 5. Veitch, N. C.; Grayer, R. J., Flavonoids and their glycosides, including anthocyanins. Nat Prod Rep 2008, 25 (3), 555-611. 6. Tanaka, Y.; Brugliera, F., Flower colour and cytochromes P450. Philos Trans R Soc Lond B Biol Sci 2013, 368 (1612), 20120432. 7. Honda, T.; Saito, N., Recent Progress in the Chemistry of Polyacylated Anthocyanins as Flower Color Pigments. 2002; Vol. 56. 8. Goto, T.; Kondo, T., ChemInform Abstract: Structure and Molecular Stacking of Anthocyanins - Flower Color Variation. 2010; Vol. 22. 9. Shoji, K.; Miki, N.; Nakajima, N.; Momonoi, K.; Kato, C.; Yoshida, K., Perianth Bottom-Specific Blue Color Development in Tulip cv. Murasakizuisho Requires Ferric Ions. 2007; Vol. 48, p 243-51. 10. Chandler, S.; Tanaka, Y., Genetic Modification in Floriculture. Critical Reviews in Plant Sciences 2007, 26 (4), 169-197. 11. Holton, T. A.; Brugliera, F.; Lester, D. R.; Tanaka, Y.; Hyland, C. D.; Menting, J. G. T.; Lu, C.-Y.; Farcy, E.; Stevenson, T. W.; Cornish, E. C., Cloning and expression of cytochrome P450 genes controlling flower colour. Nature 1993, 366, 276. 12. Nakamura, N.; Fukuchi-Mizutani, M.; Miyazaki, K.; Suzuki, K.; Tanaka, Y., RNAi suppression of the anthocyanidin synthase gene in Torenia hybrida yields white flowers with higher frequency and better stability than antisense and sense suppression. Plant Biotechnology 2006, 23 (1), 13-17. 13. Katsumoto, Y.; Fukuchi-Mizutani, M.; Fukui, Y.; Brugliera, F.; Holton, T. A.; Karan, M.; Nakamura, N.; Yonekura-Sakakibara, K.; Togami, J.; Pigeaire, A.; Tao, G. Q.; Nehra, N. S.; Lu, C. Y.; Dyson, B. K.; Tsuda, S.; Ashikari, T.; Kusumi, T.; Mason, J. G.; Tanaka, Y., Engineering of the rose flavonoid biosynthetic pathway successfully generated blue-hued flowers accumulating delphinidin. Plant Cell Physiol 2007, 48 (11), 1589-600. 14. Muller, M.; Auslander, S.; Auslander, D.; Kemmer, C.; Fussenegger, M., A novel reporter system for bacterial and mammalian cells based on the non-ribosomal peptide indigoidine. Metab Eng 2012, 14 (4), 325-35. 15. Xie, Z.; Zhang, Z.; Cao, Z.; Chen, M.; Li, P.; Liu, W.; Qin, H.; Zhao, X.; Tao, Y.; Chen, Y., An external substrate-free blue/white screening system in Escherichia coli. Appl Microbiol Biotechnol 2017, 101 (9), 3811-3820. 16. Li, P.; Li, J.; Guo, Z.; Tang, W.; Han, J.; Meng, X.; Hao, T.; Zhu, Y.; Zhang, L.; Chen, Y., An efficient blue-white screening based gene inactivation system for Streptomyces. Appl Microbiol Biotechnol 2015, 99 (4), 1923-33. 17. Martínez-Núñez, M. A.; López, V. E. L. y., Nonribosomal peptides synthetases and their applications in industry. Sustainable Chemical Processes 2016, 4 (1), 13. 18. Marahiel, M. A.; Essen, L. O., Chapter 13. Nonribosomal peptide synthetases mechanistic and structural aspects of essential domains. Methods Enzymol 2009, 458, 337-51. 19. Schwarzer, D.; Mootz, H. D.; Linne, U.; Marahiel, M. A., Regeneration of misprimed nonribosomal peptide synthetases by type II thioesterases. Proc Natl Acad Sci U S A 2002, 99 (22), 14083-8.


Page 16 of 17

Page 17 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


20. Challis, G. L.; Naismith, J. H., Structural aspects of non-ribosomal peptide biosynthesis. Curr Opin Struct Biol 2004, 14 (6), 748-56. 21. Takahashi, H.; Kumagai, T.; Kitani, K.; Mori, M.; Matoba, Y.; Sugiyama, M., Cloning and characterization of a Streptomyces single module type non-ribosomal peptide synthetase catalyzing a blue pigment synthesis. J Biol Chem 2007, 282 (12), 9073-81. 22. Walsh, C. T.; Wencewicz, T. A., Flavoenzymes: versatile catalysts in biosynthetic pathways. Nat Prod Rep 2013, 30 (1), 175-200. 23. Lambalot, R. H.; Gehring, A. M.; Flugel, R. S.; Zuber, P.; LaCelle, M.; Marahiel, M. A.; Reid, R.; Khosla, C.; Walsh, C. T., A new enzyme superfamily — the phosphopantetheinyl transferases. Chemistry & Biology 1996, 3 (11), 923-936. 24. Wipat, A.; Harwood, C. R., The Bacillus subtilis genome sequence: the molecular blueprint of a soil bacterium. FEMS Microbiology Ecology 1999, 28 (1), 1-9. 25. Chen, P.-Y.; Wang, C.-K.; Soong, S.-C.; To, K.-Y., Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants. Molecular Breeding 2003, 11 (4), 287-293. 26. Ma, N.; Chen, W.; Fan, T.; Tian, Y.; Zhang, S.; Zeng, D.; Li, Y., Low temperature-induced DNA hypermethylation attenuates expression of RhAG, an AGAMOUS homolog, and increases petal number in rose (Rosa hybrida). BMC Plant Biol 2015, 15, 237. 27. Dao, T. T.; Linthorst, H. J.; Verpoorte, R., Chalcone synthase and its functions in plant resistance. Phytochem Rev 2011, 10 (3), 397-412. 28. Vladimirov, I. A.; Matveeva, T. V.; Lutova, L. A., [Opine biosynthesis and catabolism genes of Agrobacterium tumefaciens and Agrobacterium rhizogenes]. Genetika 2015, 51 (2), 137-46. 29. Firoozabady, E.; Moy, Y.; Gutterson, N.; Robinson, K., Regeneration of Transgenic Rose (Rosa hybrida) Plants from Embryogenic Tissue. 1994; Vol. 12, p 609-613. 30. Tian, C.; Chen, Y.; Zhao, X.; Zhao, L., Plant regeneration through protocorm-like bodies induced from rhizoids using leaf explants of Rosa spp. Plant Cell Rep 2008, 27 (5), 823-31. 31. Hanahan, D.; Jessee, J.; Bloom, F. R., Plasmid transformation of Escherichia coli and other bacteria. Methods Enzymol 1991, 204, 63-113.


Cloning and Expression of a Nonribosomal Peptide Synthetase to

Recommend Documents