Cloning, Characterization, and Sulfonamide and ... - ACS Publications

Article pubs.acs.org/jmc

Cloning, Characterization, and Sulfonamide and Thiol Inhibition Studies of an α‑Carbonic Anhydrase from Trypanosoma cruzi, the Causative Agent of Chagas Disease Peiwen Pan,† Alane Beatriz Vermelho,‡ Giseli Capaci Rodrigues,‡ Andrea Scozzafava,§ Martti E. E. Tolvanen,† Seppo Parkkila,† Clemente Capasso,∥ and Claudiu T. Supuran*,§,⊥ †

Institute of Biomedical Technology, Fimlab Ltd., School of Medicine and BioMediTech, University of Tampere and Tampere University Hospital, Medisiinarinkatu 3, 33520 Tampere, Finland ‡ Laboratório Proteases de Microrganismos, Instituto de Microbiologia Paulo de Góes, Universidade Federal do Rio de Janeiro, UFRJ, CCS, Bloco I, Sala 32, Cidade Universitária, Av. Carlos Chagas Filho, 373, Ilha do Fundão, Rio de Janeiro R.J., Brazil § Laboratorio di Chimica Bioinorganica, Rm. 188, Polo Scientifico, Università degli Studi di Firenze, Via della Lastruccia 3, 50019 Sesto Fiorentino, Florence, Italy ∥ Istituto di Biochimica delle Proteine, CNR, Via P. Castellino 111, 80131 Napoli, Italy ⊥ Dipartimento di Scienze Farmaceutiche, Università degli Studi di Firenze, Via Ugo Schiff 6, 50019 Sesto Fiorentino, Florence, Italy S Supporting Information *

ABSTRACT: An α-carbonic anhydrase (CA, EC 4.2.1.1) has been identified, cloned, and characterized from the unicellular protozoan Trypanosoma cruzi, the causative agent of Chagas disease. The enzyme (TcCA) has a very high catalytic activity for the CO2 hydration reaction, being similar kinetically to the human (h) isoform hCA II, although it is devoid of the His64 proton shuttle. A large number of aromatic/heterocyclic sulfonamides and some 5-mercapto-1,3,4-thiadiazoles were investigated as TcCA inhibitors. The aromatic sulfonamides were weak inhibitors (KI values of 192 nM to 84 μM), whereas some heterocyclic compounds inhibited the enzyme with KI values in the range 61.6−93.6 nM. The thiols were the most potent in vitro inhibitors (KI values of 21.1−79.0 nM), and some of them also inhibited the epimastigotes growth of two T. cruzi strains in vivo.

■

INTRODUCTION Chagas disease, or American trypanosomiasis, is a tropical disease caused by the flagellate unicellular protozoan Trypanosoma cruzi. The parasite is commonly transmitted to humans and other mammals by an insect vector, the bloodsucking “kissing bugs” belonging to the family Reduviidae (subfamily Triatominae), with most species belonging to the Triatoma, Rhodnius, and Panstrongylus genera.1−5 The disease affects more than 10 million people mostly in South and Central Americas, but it is estimated that more than 300 000 persons are affected in the United States and an indeterminate number of people in other nonendemic countries such as Spain, Canada, and Switzerland, mainly because of its transmission through congenital and oral routes (in nonendemic areas).6 Millions of individuals remain chronically infected because of prior exposure to T. cruzi and are at risk for future complications from the disease, among which is chronic cardiomyopathy which affects 20% of Chagas disease patients.7 Chagas disease chemotherapy armamentarium is rather poor, as only two drugs are clinically used, the nitroazoles, benznidazole A and nifurtimox B.7,8 The treatment during the acute and recent chronic phases in childhood is effective in 57−71% of © XXXX American Chemical Society

the patients. However, in several clinical trials during the late chronic phase, only 6% of parasitological cure was achieved with these drugs, which are also rather toxic and have a range of gastrointestinal and neurological side effects (the cure in the acute phase lasts from 30 to 60 days).7,8 Indeed, the mechanism of action of both drugs is the production of free radicals involving the NO2 groups of the drugs, to which T. cruzi is particularly sensitive given its reduced detoxification capabilities.7,8 Recently, the draft sequences of the genomes of T. brucei (the causative agent of the African trypanosomiasis, or sleeping sickness), T. cruzi, and Leishmania major (also known as the Tri-Tryp genomes) were published.5 As for many other bacterial, fungal, or protozoan parasites, availability of the genomic information may help the identification of new drug targets and therapeutic agents for fighting diseases provoked by them.9−11 The carbonic anhydrases (CAs, EC 4.2.1.1) are metalloenzymes found in organisms all over the tree of life, including Received: January 13, 2013

A

dx.doi.org/10.1021/jm4000616 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

i.e., the CA-mediated carbamoylphosphate biosynthetic pathway.23 Considering such promising facts on the druggability of protozoan CAs23 and continuing our investigations of CAs as possible new drug targets, we report here the DNA cloning, purification, and inhibition studies of a new α-CA isolated from T. cruzi, the protozoan provoking Chagas disease, denominated here as TcCA.

■

RESULTS AND DISCUSSION CA Cloning and Purification. The expression of TcCA was performed using the Bac-to-Bac baculovirus expression system in Spodoptera f rugiperda derived Sf9 insect cells.24 The protein contained a hexahistidine tag at the carboxyterminal part, as reported earlier for other α-CAs cloned by our groups, in order to facilitate its purification by means of affinity chromatography.24 The hexahistidine tag was cleaved with thrombin, thus allowing us to obtain pure TcCA with a molecular weigh of 34 kDa (see Supporting Information Figure 1 and Experimental Section for details). Catalytic Activity of TcCA. The TcCA catalytic activity for the CO2 hydration reaction is shown in Table 1, where data for other α-CAs (such as the widespread and highly investigated human (h) isoforms hCA I and hCA II and the Vibrio cholerae VchCA)21a are also included for comparison (no activity data are available for P. falciparum CA, PfaCA, for which only the esterase activity has been investigated so far).23 A stopped-flow CO2 hydrase assay has been used to measure the catalytic activity of these enzymes in identical conditions.25 It may be observed that TcCA has kinetic parameters very similar to those of the human isoform hCA II, thus being one of the catalytically most active of such enzymes known to date.26 Indeed, with a kcat/Km of 1.49 × 108 M−1·s−1, TcCA has basically almost the same kinetic parameters as hCA II (Table 1), being much more active as a catalyst for CO2 hydration compared to hCA I or VchCA, enzymes known to possess important physiological functions.12,13,21a However, unlike hCA II, TcCA is much less sensitive to the sulfonamide inhibitor acetazolamide (5-acetamido-1,3,4-thiadiazole-2-sulfonamide, AAZ). Some α-CAs considered here, such as hCA II or VchCA, were strongly inhibited by this sulfonamide in clinical use, with KI values in the range 6.8−12 nM (Table 1). Similar to hCA I, which is less sensitive to this sulfonamide (KI of 250 nM), TcCA was only inhibited with a KI of 61.6 nM by this compound, which is thus a medium potency inhibitor. Sequence and Phylogenetic Analyses. An alignment of the amino acid sequences of TcCA and other α-CAs (such as the mammalian hCA I and hCA II) is shown in Figure 1 in order to identify the salient features of this protozoan enzyme. It may be observed that, like other investigated α-CAs, TcCA

prokaryotes and eukaryotes.14−16 In vertebrates, 16 zinccontaining CAs belonging to the α-class have been characterized to date, many of which are involved in critical physiologic and pathologic processes.14−16 They catalyze the simple reaction between carbon dioxide and water with generation of bicarbonate and protons: CO2 + H2O ↔ H+ + HCO3−.14−16 In humans, the 15 different CAs known to date are present in a large variety of tissues including the gastrointestinal and reproductive tracts, central nervous system, kidney, lung, skin, and eye.14 Many of them are therapeutic targets with the potential to be inhibited/activated for treating a range of disorders, among which are glaucoma, obesity, epilepsy, and hypoxic tumors.14−16 These enzymes are encoded by five genetically distinct families, the α-, β-, γ-, δ-, and ζ-CA classes, respectively, and started to be investigated ultimately in many organisms other than vertebrates (which possess only α-CAs), among which are various pathogens (bacteria, fungi, and protozoa).17−23 Indeed, representatives of the α- and or β-CA class have been investigated in pathogenic bacteria such as Brucella spp.,18 Mycobacterium tuberculosis,19 Streptococcus pneumoniae,20a,b Salmonella enterica serovar Typhimurium,20c Vibrio cholerae,21a and Helicobacter pylori21b−d and the pathogenic fungi Candida albicans, C. glabrata, and Cryptococcus neoformans.22 Only one protozoan parasite has been investigated until now for the presence and druggability of CAs, the malaria-provoking organism Plasmodium falciparum.23 Studies from Krungkrai’s and our laboratories23 showed that Plasmodium spp. encode for several α-class CAs and that these enzymes have significant catalytic activity (as esterases with 4-nitrophenyl acetate as substrate) and are inhibited by primary sulfonamides, the main class of CA inhibitors (CAIs). The best investigated of such an enzyme has been denominated PfaCA.23 Some benzenesulfonamide derivatives were effective in vitro as P. falciparum CAIs and also inhibited the ex vivo growth of the parasite efficiently.23 One such sulfonamide CAI was also effective as an antimalarial agent in mice infected with P. berghei, an animal model of human malaria infection, with an efficiency similar to that of chloroquine, a standard clinically used drug.23 CAIs show antimalarial activity because they inhibit the first step of pyrimidine nucleotide biosynthesis in the protozoan parasite,

Table 1. Kinetic Parameters for CO2 Hydration Reaction Catalyzed by Some α-CA Isozymes of Human (h) hCA I and hCA II, Bacterial VchCA (Vibrio cholerae), and Protozoan TcCA (Trypanosoma cruzi) Origin at 20 °C and pH 7.5 and Their Inhibition Data with Acetazolamide (AAZ, 5-Acetamido-1,3,4-thiadiazole-2-sulfonamide), a Clinically Used Drug enzyme a

hCA I hCA IIa VchCAb TcCAc

kcat (s−1) 2.00 1.40 8.23 1.21

× × × ×

Km (M) 5

10 106 105 106

−3

4.0 × 10 9.3 × 10−3 11.7 × 10−3 8.1 × 10−3

kcat/Km (M−1·s−1)

KI(acetazolamide) (nM)

× × × ×

250 12 6.8 61.6

5.00 1.50 7.03 1.49

7

10 108 107 108

a Human recombinant isozymes, stopped-flow CO2 hydrase assay method, from refs 23 and 24. bFrom ref 21a. cRecombinant enzyme, stopped-flow CO2 hydrase assay method, this work.25a

B



Article

Figure 1. Multialignment of the amino acid sequences of α-CAs from different organisms performed with the program Clustal W, version 2.1: TcCA-protozoan, Trypanosoma cruzi, truncated CA (accession no. XP_806287.1); hCAI-human, Homo sapiens, isoform I (accession no. NP_001158302.1); hCAII-human, Homo sapiens, isoform II (accession no. AAH11949.1). The zinc ligands (His94, His96, and His119) are indicated in red; the gatekeeper residues (Glu106 and Thr199) are indicated in blue. The proton shuttle residue of hCA I and hCA II (His64, indicated in green) is conserved only in the human isoforms. hCA I numbering system was used. Two His residues in the protozoan enzymes (at positions 35 and −27) are indicated in magenta, as they may act as proton shuttle residues in this new CA. The asterisk (∗) indicates identity at all aligned positions. The symbol (:) relates to conserved substitutions, while (.) means that semiconserved substitutions are observed.

Thr residue.25e However, the sponge enzymes possesses a His at position 80 which has been hypothesized to act as the proton shuttle residue.25e As TcCA possesses a very high catalytic efficiency for the CO2 hydration reaction, as shown from the data of Table 1, it is obvious that this enzyme also must possess a proton shuttle. Asn64 cannot participate in such a process, as the pKa of this residue is not appropriate for such a proton transfer process. There are, however, two His residues in the amino terminal sequence of TcCA, more specifically His−27 and His35 (Figure 1). We suggest that one of these residues (or both of them) may participate in the proton-shuttling processes necessary to generate efficiently and rapidly the zinc hydroxide, nucleophilic species of the enzyme. Interestingly, we have also aligned the PfaCA enzyme with the α-CAs discussed above (Supporting Information Figure 2). We observed that similar to the TcCA enzyme investigated here, the plasmodial enzyme also does not possess His64 but a Phe residue in this position.

has the conserved three His ligands, which coordinate the Zn(II) ion crucial for catalysis (His94, His96, and His119; hCA I numbering system).12,14,25b,c TcCA also has the gatekeeping residues (Glu106 and Thr199), which orientate the substrate for catalysis and are also involved in the binding of inhibitors.12,14,25b,c However, surprisingly, the proton shuttle residue (His64), which is conserved in most α-CAs investigated to date,12,14 is not present in TcCA, being replaced by an Asn residue (Figure 1). His64 assists the rate-determining step of the catalytic cycle in α-CA,25d transferring a proton from the water coordinated to the Zn(II) ion to the environment, with formation of the zinc hydroxide nucleophilic species of the enzyme, and is thus essential for the high catalytic efficiency of these enzymes. Until now, this residue has been observed in all catalytically active α-CAs possessing high efficiency in the CO2 hydration reaction except one enzyme from the living fossil tropical sponge Astrosclera willeyana, in which it is replaced by a C



Article

Figure 2. Phylogenetic comparison of TcCA with other α-CAs from different organisms. The phylogenetic tree was constructed using the program PhyML 3.0. Branch support values are reported at branch points: hpαCA-BACTERIUM, Helicobacter pylori J99 (accession no. NP_223829.1); NgCA-BACTERIUM, Neisseria gonorrhoeae (accession no. CAA72038.1); VchCA-BACTERIUM, Vibrio cholera (accession no. AEA79886.1); hCAIHUMAN, Homo sapiens, isoform I (accession no. NP_001158302.1); hCAII-HUMAN, Homo sapiens, isoform II (accession no. AAH11949.1); SspCA-BACTERIUM, Sulf urihydrogenibium yellowstonense YO3AOP1 (accession no. ACD66216.1); SazCA-BACTERIUM, Sulf urihydrogenibium azorense (accession no. ACN99362.1); TcCA-PROTOZOAN, Trypanosoma cruzi (accession no. XP_806287.1); PfaCA-PROTOZOAN, Plasmodium falciparum (accession no. AE014186.2); TcruCA-BACTERIUM, Thiomicrospira crunogena XCL-2 (accession no. ABB42137.2).

Chart 1. Structures 1−24

D



Article

Chart 2. Structures AAZ−HCT

Thus, the absence of the proton shuttle residue in position 64 seems to be a more general feature of the protozoan α-CAs, revealed here for the first time. A phylogenetic analysis of TcCA has also been performed (Figure 2). α-CAs of bacterial, protozoan, and mammalian (human) origin have been considered for this purpose. As observed from the data of Figure 2, there are two main branches of the tree, one including the protozoan enzyme from P. falciparum and the bacterial one from the extremophilic bacterium Thiomicrospira crunogena (lower branch of Figure 2). Surprisingly, all other α-CAs, of bacterial, protozoan, and human origin, clustered together in the higher branch of Figure 2. This is rather interesting, as the T. cruzi enzyme seems to be

evolutionarily closer to these bacterial and even mammalian enzymes and not to the other protozoan CA investigated to date, i.e., the P. falciparum CA. In Vitro Inhibition Studies. Sulfonamides are the main class of CAIs,12,13,27 but several other classes of inhibitors were also reported recently, such as the thiols,28 dithiocarbamates,29 coumarins,30 and polyamines.31 Sulfonamides, thiols, and dithiocarbamates possess a similar mechanism of action, as they bind to the zinc ion within the active site cavity and substitute the non-protein zinc ligand (the hydroxide ion/water molecule).12,13,27−29 Coumarins on the other hand are prodrug inhibitors, undergoing an active-site hydrolysis (due to the esterase CA activity) with generation of 2-hydroxycinnamic E



Article

acids that bind at the entrance of the active site cavity.30 Polyamines also have a different inhibition mechanism compared to the other inhibitors mentioned above, as they bind within the active site cavity by anchoring to the Zn(II)coordinated water molecule/hydroxide ion (and also making other contacts of the aliphatic backbone with amino acid residues from the active site).31 Thus, we investigated a panel of 39 sulfonamides and one sulfamate (compounds 1−24 and AAZ−HCT) (Charts 1 and 2) for the inhibition of TcCA (Table 2). Simple aromatic and heteroaromatic sulfonamides of types 1−24 were among them, as well as derivatives AAZ−HCT, which are clinically used drugs (or agents in clinical development). Acetazolamide (AAZ), methazolamide (MZA), ethoxzolamide (EZA), and dichlorophenamide (DCP) are the classical, systemically acting CAIs.13,27 Dorzolamide (DZA) and brinzolamide (BRZ) are topically acting antiglaucoma agents.27 Benzolamide (BZA) is an orphan drug belonging to this class of pharmacological agents, whereas topiramate (TPM), zonisamide (ZNS), and sulthiame (SLT) are widely used antiepileptic drugs.32 Sulpiride (SLP), indisulam (IND), valdecoxib (VLX), celecoxib (CLX), saccharin (SAC), and hydrochlorothiazide (HCT) were recently shown by this group to belong to this class of pharmacological agents.27 Sulfonamides 1−24 and the clinically used agents investigated in this study were either commercially available or prepared as reported earlier by our group.33 The following could be observed from the data of Table 2, where inhibition data of hCA I and hCA II as well as VchCA are also reported for comparison: (i) The first group of sulfonamides, among which are derivatives 1−10, 15−18, and SAC, showed very ineffective TcCA inhibitory activity, with inhibition constants in the range 7.231−84.0 μM. It may be observed that all these compounds are aromatic derivatives, i.e., 3-/4-substituted benzenesulfonamides or 1,3-di-, 3,4-di-, and 2,3,5-trisubstituted benzenesulfonamides incorporating a range of rather simple moieties of the amino, hydroxyl, carboxyl, aminoalkyl, hydroxyalkyl, halogeno, or sulfamoyl type (Table 1). Only SAC is structurally diverse of the above-mentioned compounds, being an acylated secondary sulfonamide. (ii) More effective inhibitory activity against the protozoan enzyme TcCA has been observed with the following sulfonamides: 11−14, 19, 21−24, DCP, ZNS, and HCT (KI values in the range 128−867 nM, Table 2). Structure−activity relationship (SAR) is rather complicated, as these are quite heterogeneous compounds, among which are 1,3-disulfamoylbenzene derivatives (11, 12, and HCT), heterocyclic sulfonamides (13, 14, and ZNS), sulfonylated sulfonamides (21−24), and the pyrimidinylsulfanilamide 20, incorporating elongated molecules. For derivatives 21−24 it may be observed that activity improves with the increase in the spacer from 0 to 2 carbon atoms, whereas the presence of nitro or hydroxymethyl moieties on the second ring, as in 21, is also beneficial for the TcCA inhibition. In fact compounds 21−24 and dichlorophenamide (DCP) were the most effective inhibitors in this subgroup of compounds (KI values in the range 128−365 nM). (iii) The best TcCA inhibitors were 20, AAZ−EZA, DZA− TPM, and SLP−SLT, which showed inhibition constants under 100 nM, more precisely in the range 61.6−93.6 nM (Table 2). Again, SAR is complicated to envisage because of the many structural scaffolds present in these inhibitors (heterocyclic mononuclear and binuclear such as AAZ−MZA, DZA, and

Table 2. Inhibition of Human Isoforms hCA I and hCA II and V. cholerae (VchCA) and T. cruzi (TcCA) Enzymes with Sulfonamides 1−24 and the Clinically Used Agents AAZ− HCT KI a (nM) b

inhibitor

hCA I

hCA IIb

VchCAc

TcCAd

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 AAZ MZA EZA DCP DZA BRZ BZA TPM ZNS SLP IND VLX CLX SLT SAC HCT

28000 25000 79d 78500 25000 21000 8300 9800 6500 7300 5800 8400 8600 9300 5500 9500 21000 164 109 6 69d 164 109 95 250 50 25 1200 50000 45000 15 250 56 1200 31 54000 50000 374 18540 328

300 240 8 320 170 160 60 110 40 54 63 75 60 19 80 94 125 46 33 2 11d 46 33 30 12 14 8 38 9 3 9 10 35 40 15 43 21 9 5959 290

432d 471 25.7d 219 447 402 199 139 133 24.1d 62.9 45.3 23.5 12.1 54.5 55.3d 56.7 42.7 59.8 4.2 3.1d 45.9d 42.7 30.3 6.8 3.6 0.69 37.1 6.3 2.5 4.2 >1000 982 >1000 8.1 89.7 >1000 88.4 >1000 79.5

25460 57300 63800 44200 7231 9238 8130 6925 8520 9433 842 820 534 652 73880 71850 66750 84000 810 88.5 134 365 243 192 61.6 74.9 88.2 128 92.9 87.3 93.6 85.5 867 87.9 84.5 82.7 91.1 71.9 8210 134

a

Errors in the range 5−10% of the shown data, from three different assays. bHuman recombinant isozymes, stopped-flow CO2 hydrase assay method, from ref 24. cRecombinant bacterial enzyme, stoppedflow CO2 hydrase assay method, from ref 21a. dRecombinant protozoan enzyme, this work.

BRZ; elongated molecules such as 20, BZA, SLP, SLT; Yshaped molecules such as VLX, CLX). However, the most striking feature of these inhibition data was that no compound with an inhibition under 60 nM has been evidenced among all these sulfonamides/sulfamates. Indeed, the other α-CAs shown in Table 2 are inhibited in the low nanomolar range by many such compounds. (iv) The inhibition profile of the protozoan enzyme TcCA was very different from that of the mammalian enzymes hCA I and hCA II (which is a positive feature if one needs to inhibit F



Article

properties, with inhibition constants in the range 21.1−125 nM. The least effective compound was the semicarbazide 25, whereas the Schiff bases were much more effective CAIs (KI values in the range 21.1−94.7 nM, Table 3). The best inhibitors were the Schiff bases 26 and 28, incorporating phenylazomethine and 3-methoxyphenylazomethine moieties (inhibition constants of 21.1−34.5 nM). The 4-chlorophenyl analogue 27, the compound incorporating the aliphatic moiety 31, and the ones with isatin scaffolds 32 and 33 were slightly less effective compared to 26 and 28. It is thus obvious that small changes in the scaffold of a compound (thiol or sulfonamide) dramatically change its affinity for the protozoan enzyme TcCA. For example, the chloro derivatives 27 and 30 differ only by the presence of a supplementary methyl moiety in 30, which leads to a reduction of the inhibitory activity by 33% compared to 27. Whereas the thiols 25−33 are effective nanomolar TcCA inhibitors, they are much less effective (micromolar to millimolar range) as hCA I and hCA II inhibitors. This is an important issue in order to achieve selective inhibition of the parasite over the host enzymes and thus lack of side effects due to off-target inhibition.35 In Vivo Inhibition Studies. As thiols were generally better TcCA inhibitors compared to the sulfonamides (and also because they are more lipophilic compared to the sulfonamides), compounds 26−33 were investigated in vivo for their antitrypanosomal effects, using epimastigotes of T. cruzi strains DM28 and Y, by the procedure of Rolon et al.36 The test compounds were used at 256, 128, and 64 μM, and benznidazole B was used as a standard drug (Table 3). It may be observed that all thiols investigated here (except 30 against one T. cruzi strain) inhibited the growth of both strains of T. cruzi at 256 μM concentrations, with a variable potency (inhibition of growth in the range 9−87% against strain DM28 and of 20−87% against strain Y). The most potent derivatives in the initial assay, i.e., 26, 27, and 28, were also investigated at lower concentrations. Indeed, compound 26 inhibited strain DM28 by 43% at 128 μM, whereas strain Y was inhibited even more, by 84% at 128 μM and 64% at 64 μM (Table 3). The same strain was also inhibited in the range 44−51% by compounds 27 and 28 at 128 μM inhibitor. Benznidazole B was, however, a stronger in vivo inhibitor of parasite gowth compared to the thiols investigated by us (Table 3). All these preliminary data are quite promising and prove that TcCA may indeed be considered as an interesting target for developing antitrypanosomal drugs with a novel mechanism of action.

the parasite and not also the host enzymes) or the bacterial one from V. cholerae (Table 2).

Considering the above sulfonamide inhibition data, we decided to investigate thiols as possible TcCA inhibitors, being well-documented that the mercapto moiety (in ionized, anionic form) may act as a good zinc-binding group (similar to the SO2NH− one) for obtaining effective CAIs.28,34 The 1,3,4thiadiazole-5-mercapto derivatives 25−33 were reported earlier by our group as medium potency hCA I and hCA II inhibitors28 and were here investigated for their interaction with TcCA (Table 3). We included the simple semicarbazido derivative 25 and the Schiff bases obtained from it, incorporating an elongated molecule of types 26−33, as we observed that in the case of the sulfonamides the best TcCA inhibitors were those possessing an elongated molecule (as well as a 1,3,4thiadiazole ring system). Data of Table 3 show that indeed mercapto derivatives 25−33 possess relevant TcCA inhibitory Table 3. hCA I, hCA II, and TcCA Inhibition Data with Thiols 25−33 and Antitrypanosomal in Vivo Data with Some of These Derivativesa % inhibition of growthd

KI (nM) compd

hCA Ib

hCA IIb

TcCAc

T. cruzi (DM28)

T. cruzi (Y)

25 26 27 28 29 30 31 32 33 benznidazole

7100 3000 18740 8540 71600 144000 8530 7890 3710 ni

9200 354000 13460 2670 235000 3890 8850 8360 7970 ni

125 21.1 64.3 34.5 43.1 94.7 52.4 79.0 72.5 ni

nt 87e 10 43 34 0 20 9 22 nt

nt 87f 67g 77h 58 32 43 30 20 91i

■

CONCLUSIONS We report here the identification, cloning, and characterization of the α-CA from the unicellular protozoan T. cruzi, the causative agent of Chagas disease. This enzyme, TcCA, showed a very high catalytic activity for the CO2 hydration reaction, being similar kinetically to the human isoform hCA II, one of the best catalysts in this family of metalloproteins. A large number of aromatic/heterocyclic sulfonamides and some 5mercapto-1,3,4-thiadiazoles were investigated as TcCA inhibitors. The aromatic sulfonamides were generally weak inhibitors (KI values of 192 nM to 84 μM), whereas some heterocyclic compounds inhibited the enzyme with KI values in the range 61.6−93.6 nM. The thiols were the most potent in vitro inhibitors (KI values of 21.1−94.7 nM), and some of them also efficiently inhibited the epimastigotes growth of two T. cruzi strains in vivo. TcCA may be an interesting target for

a

T. cruzi strains DM28 and Y epimastigotes were used for the in vivo experiments.36 Benznidazole B was used as standard drug for the in vivo tests. nt = not tested. ni = no inhibition. bFrom ref 28. cThis work. dDetermined as described in ref 36, representing the % inhibition observed at 256 μM test compound. e% inhibition at 128 μM: 43%. f% inhibition at 128 μM: 84%. At 64 μM: 64%. g% inhibition at 128 μM: 51%. h% inhibition at 128 μM: 44%. i% inhibition at 128 μM: 80%. At 64 μM: 75%. At 32 μM: 60%. At 16 μM: 66%. At 8 μM: 51%. G



Article

uncatalyzed rates were determined in the same manner and subtracted from the total observed rates. Stock solutions of inhibitors (10 mM) were prepared in distilled−deionized water, and dilutions up to 0.01 nM were done thereafter with the assay buffer. Inhibitor and enzyme solutions were preincubated together for 15 min at room temperature prior to assay in order to allow for the formation of the E−I complex. The inhibition constants were obtained by nonlinear least-squares methods using PRISM 3, as reported earlier,21−23 and represent the mean from at least three different determinations. All CA isoforms were recombinant ones obtained in house as reported earlier.21−23 In Vivo Antitrypanosomal Activity. A quantitative colorimetric assay using the oxidation−reduction indicator resazurin was employed to measure the cytotoxicity of compounds 26−33 against two strains of T. cruzi.36 The method is based on the detection of colorimetric changes caused by the oxidation (blue) and reduction (pink) capabilities of the resazurin dye, as an indicator for metabolic cell function. The inoculum of T. cruzi epimastigotes, the resazurin concentration, and the incubation time of different inocula of parasites were as described in ref 36. A log-phase culture ranging from 0.25 × 106 to 9 × 106 cells/mL was seeded in different culture tubes for 24 h at 28 °C. Epimastigotes were then seeded on 96-well microtiter plates (Sarstedt, Sarstedt, Inc.) at 200 μL/well volumes and incubated for another 48 h at 28 °C. After incubation time, 20 μL of various dilutions of resazurin solutions ranging from 0.5 to 3 mM to each inoculum was added, and the plates were returned to the incubator. To choose the optimal duration of incubation for cultures in the presence of resazurin solution, the plates were incubated for periods ranging from 1 to 6 h to allow optimal oxidation−reduction. The absorbance values were read at dual wavelengths using an ELx800 enzyme-linked immunosorbent assay (ELISA) reader (Bio-Tek Instruments Inc.) at 490 and 595 nm. Background was subtracted. All experiments were performed three times each in triplicate at concentrations of test compound of 256, 128, and 64 μM. Benznidazole was used as standard drug.

developing antitrypanosomal drugs with a novel mechanism of action.

■

EXPERIMENTAL SECTION

Chemistry. Sulfonamides 1−24 and AAZ−HCT were commercially available or reported earlier by us.33 Thiols 25−31 were prepared as reported earlier by this group.28 The purity of all compounds was checked by HPLC and was >99%. Expression and Purification of Trypanosoma cruzi Strain CL Brener α-CA (TcCA) Using the Insect Cell Baculovirus System. The expression of a truncated form of TcCA was performed using the Bac-to-Bac baculovirus expression system (Invitrogen) according to the manufacturer’s instruction. Total RNA was purified from 108 cells of trypanosomatid, and the first-strand cDNA was synthesized using first strand cDNA synthesis kit (Fermentas). After that, the full-length cDNA encoding TcCA was amplified by PCR using the first-strand cDNA as a template and a synthetic primer set 64F (5′-GGCCAGATCTATGACTTGTGGCATACGGCGA-3′) and 64R (5′CGCCGTCGACTTAATGGTGGTGATGGTGGTGGGAACCACGGGGCACCAGTACGACGCGTCCATTCAGAG-3′) (Biomers) that incorporated the desired restriction sites, BglII and SalI (underlined), at the 5′-ends, respectively. In addition, a thrombin protease site plus a hexahistidine tag (bolded sequence) were intergrated into the C-terminus of the coding sequence to produce a fusion protein. The obtained PCR product was digested and directionally ligated to BamHI/SalI digested expression vector pFastBac1. The ligated plasmid was transformed into E. coli TOP10 competent cells and the nucleotide sequence of trypanosoma gene was verified by DNA sequencing. The recombinant pFastBac1-trypanosoma CA plasmid was then used to tranform E. coli DH10Bac competent cells for transposition into the bacmid. The successful transposition was confirmed by blue/white screening, and the recombinant bacmid DNA was isolated using the PureLink HiPure plasmid purification kit (Invitrogen). PCR analysis using the recombinant bacmid as template source and the primers M13/pUC forward (5′-CCCAGTCACGACGTTGTAAAACG-3′) and reverse (5′-AGCGGATAACAATTTCACACAGG-3′) amplification primer was performed to verify once more the successful transposition to the bacmid. The recombinant baculovirus harboring the trypanosome CA gene was produced by transfecting the recombinant bacmid DNA to Spodoptera f rugiperda derived Sf9 cells using CellFECTIN reagent (Invitrogen) as described by the manufacturer. To purify the recombinant TcCA, an amount of 400 mL of Sf9 cells (2 × 106 cells/mL) grown in HyQ SFXinsect serum-free cell culture medium (HyClone, Logan, UT) in a 2 L flask shaken at 125 rpm at 27 °C was inoculated with 4 mL of the recombinant TcCA baculovirus. At 72 h postinfection, the cells were collected by centrifugation (2000g, 5 min, 20 °C) and the supernatant was transferred to a 2 L beaker. The binding and purification of TcCA were performed using Probond purification system (Invitrogen) as described by Hilvo et al.24 After purification, TcCA was buffer-changed to 50 mM Tris-Cl (pH 7.5) using an Amicon Ultra 10 kDa cutoff centrifugal filter device (Millipore). To remove the His tag from recombinant TcCA, 1 mg of protein was treated with 100 μL of thrombin from thrombin Cleancleave kit (Sigma) with shaking at room temperature overnight. Figure 1 shows that the recombinant TcCA, comprising the full-length trypanosome CA plus the thrombin site and hexahistidine tag, was around 36 kDa in size, whereas the enzyme without the tag was around 34 kDa (Supporting Information Figure 1). CA Inhibition. An Applied Photophysics stopped-flow instrument was used for assaying the CA catalyzed CO2 hydration activity. Phenol red (at 0.2 mM) has been used as indicator, working at the absorbance maximum of 557 nm, with 20 mM Hepes (pH 7.4) as buffer and 20 mM Na2SO4 (for maintaining constant the ionic strength), following the initial rates of the CA-catalyzed CO2 hydration reaction for a period of 10−100 s.25 The CO2 concentrations ranged from 1.7 to 17 mM for the determination of the kinetic parameters and inhibition constants. For each inhibitor at least six traces of the initial 5−10% of the reaction were used for determining the initial velocity. The

■

ASSOCIATED CONTENT

S Supporting Information *

Results from SDS−PAGE of the purified TcCA and a figure showing multiple sequence alignment including that of the Plasmodium falciparum CA. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +39-055-457 3005. Fax: +39-055-4573385. E-mail: claudiu.supuran@unifi.it. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS

This research was financed by two FP7 EU projects (Dynano and Metoxia) to C.T.S., by grants from the Academy of Finland, Sigrid Jusélius Foundation, and Competitive Research Funding of Tampere University Hospital (Grant 9N054) to ́ S.P., and by Coordenaçaõ de Aperfeiçoamento Pessoal de Nivel Superior (CAPES), Conselho Nacional de Desenvolvimento ́ Cientifico e Tecnológico (MCT/CNPq), and Fundaçaõ Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ) to A.B.V. We thank Alfonso Maresca for technical support.

■

ABBREVIATIONS USED CA, carbonic anhydrase; CAI, carbonic anhydrase inhibitor; TcCA, Trypanosoma cruzi carbonic anhydrase H



■

Article

Tekaia, F.; Badcock, K.; Basham, D.; Brown, D.; Chillingworth, T.; Connor, R.; Davies, R.; Devlin, K.; Feltwell, T.; Gentles, S.; Hamlin, N.; Holroyd, S.; Hornsby, T.; Jagels, K.; Krogh, A.; McLean, J.; Moule, S.; Murphy, L.; Oliver, K.; Osborne, J.; Quail, M. A.; Rajandream, M. A.; Rogers, J.; Rutter, S.; Seeger, K.; Skelton, J.; Squares, R.; Squares, S.; Sulston, J. E.; Taylor, K.; Whitehead, S.; Barrell, B. G. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 1998, 393, 537−544. (12) (a) Supuran, C. T. Carbonic anhydrases: novel therapeutic applications for inhibitors and activators. Nat. Rev. Drug Discovery 2008, 7, 168−181. (b) Supuran, C. T. Carbonic anhydrase inhibitors. Bioorg. Med. Chem. Lett. 2010, 20, 3467−3474. (c) Supuran, C. T. Structure-based drug discovery of carbonic anhydrase inhibitors. J. Enzyme Inhib. Med. Chem. 2012, 27, 759−772. (13) (a) Supuran, C. T. Bacterial carbonic anhydrases as drug targets: toward novel antibiotics? Front. Pharmacol. 2011, 2, 34. (b) Supuran, C. T. Carbonic anhydrase inhibitors and activators for novel therapeutic applications. Future Med. Chem. 2011, 3, 1165−1180. (14) (a) Pastorekova, S.; Parkkila, S.; Pastorek, J.; Supuran, C. T. Carbonic anhydrases: current state of the art, therapeutic applications and future prospects. J. Enzyme Inhib. Med. Chem. 2004, 19, 199−229. (b) Alterio, V.; Di Fiore, A.; D’Ambrosio, K.; Supuran, C. T.; De Simone, G. Multiple binding modes of inhibitors to carbonic anhydrases: how to design specific drugs targeting 15 different isoforms ? Chem. Rev. 2012, 112, 4421−4468. (15) (a) Neri, D.; Supuran, C. T. Interfering with pH regulation in tumours as a therapeutic strategy. Nat. Rev. Drug Discovery 2011, 10, 767−777. (b) Alterio, V.; Hilvo, M.; Di Fiore, A.; Supuran, C. T.; Pan, P.; Parkkila, S.; Scaloni, A.; Pastorek, J.; Pastorekova, S.; Pedone, C.; Scozzafava, A.; Monti, S. M.; De Simone, G. Crystal structure of the extracellular catalytic domain of the tumor-associated human carbonic anhydrase IX. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 16233−16238. (16) (a) Supuran, C. T.; Scozzafava, A.; Casini, A. Carbonic anhydrase inhibitors. Med. Res. Rev. 2003, 23, 146−189. (b) Casini, A.; Scozzafava, A.; Mincione, F.; Menabuoni, L.; Ilies, M. A.; Supuran, C. T. Carbonic anhydrase inhibitors: water soluble 4-sulfamoylphenylthioureas as topical intraocular pressure lowering agents with long lasting effects. J. Med. Chem. 2000, 43, 4884−4892. (17) (a) Smith, K. S.; Ferry, J. G. Prokaryotic carbonic anhydrases. FEMS Microbiol. Rev. 2000, 24, 335−366. (b) Maresca, A.; Vullo, D.; Scozzafava, A.; Manole, G.; Supuran, C. T. Inhibition of the β-class carbonic anhydrases from Mycobacterium tuberculosis with carboxylic acids. J. Enzyme Inhib. Med. Chem. 2013, 28, 392−396. (18) (a) Joseph, P.; Ouahrani-Bettache, S.; Montero, J. L.; Nishimori, I.; Vullo, D.; Scozzafava, A.; Winum, J. Y.; Köhler, S.; Supuran, C. T. A new Brucella suis β-carbonic anhydrase, bsCA II: inhibition of bsCA I and II with sulfonamides and sulfamates inhibits the pathogen growth. Bioorg. Med. Chem. 2011, 19, 1172−1178. (b) Joseph, P.; Turtaut, F.; Ouahrani-Bettache, S.; Montero, J. L.; Nishimori, I.; Minakuchi, T.; Vullo, D.; Scozzafava, A.; Köhler, S.; Winum, J. Y.; Supuran, C. T. Cloning, characterization and inhibition studies of a β-carbonic anhydrase from Brucella suis. J. Med. Chem. 2010, 53, 2277−2285. (19) (a) Suarez Covarrubias, A.; Larsson, A. M.; Hogbom, M.; Lindberg, J.; Bergfors, T.; Bjorkelid, C.; Mowbray, S. L.; Unge, T.; Jones, T. A. Structure and function of carbonic anhydrases from Mycobacterium tuberculosis. J. Biol. Chem. 2005, 280, 18782−18789. (b) Nishimori, I.; Minakuchi, T.; Vullo, D.; Scozzafava, A.; Innocenti, A.; Supuran, C. T. Carbonic anhydrase inhibitors. cloning, characterization, and inhibition studies of a new β-carbonic anhydrase from Mycobacterium tuberculosis. J. Med. Chem. 2009, 52, 3116−3120. (c) Güzel, Ö .; Maresca, A.; Scozzafava, A.; Salman, A.; Balaban, A. T.; Supuran, C. T. Discovery of low nanomolar and subnanomolar inhibitors of the mycobacterial β-carbonic anhydrases Rv1284 and Rv3273. J. Med. Chem. 2009, 52, 4063−4067. (d) Carta, F.; Maresca, A.; Suarez Covarrubias, A.; Mowbray, S. L.; Jones, T. A.; Supuran, C. T. Carbonic anhydrase inhibitors. Characterization and inhibition studies of the most active β-carbonic anhydrase from Mycobacterium tuberculosis, Rv3588c. Bioorg. Med. Chem. Lett. 2009, 19, 6649−6654.

REFERENCES

(1) (a) Coura, J. R.; Borges-Pereira, J. Chagas disease. What is known and what should be improved: a systemic review. Rev. Soc. Bras. Med. Trop. 2012, 45, 286−296. (b) Rassi, A., Jr.; Rassi, A.; Marcondes de Rezende, J. American trypanosomiasis (Chagas disease). Infect. Dis. Clin. North Am. 2012, 26, 275−291. (2) (a) Hemmige, V.; Tanowitz, H.; Sethi, A. Trypanosoma cruzi infection: a review with emphasis on cutaneous manifestations. Int. J. Dermatol. 2012, 51, 501−508. (b) Fernandes, M. C.; Andrews, N. W. Host cell invasion by Trypanosoma cruzi: a unique strategy that promotes persistence. FEMS Microbiol. Rev. 2012, 36, 734−747. (3) (a) Schofield, C. J.; Jannin, J.; Salvatella, R. The future of Chagas disease control. Trends Parasitol. 2006, 22, 583−588. (b) Maeda, F. Y.; Cortez, C.; Yoshida, N. Cell signaling during Trypanosoma cruzi invasion. Front. Immunol. 2012, 3, 361. (4) Osorio, L.; Ríos, I.; Gutiérrez, B.; González, J. Virulence factors of Trypanosoma cruzi: Who is who? Microbes Infect. 2012, 14, 1390− 1402. (5) Teixeira, S. M.; de Paiva, R. M.; Kangussu-Marcolino, M. M.; Darocha, W. D. Trypanosomatid comparative genomics: contributions to the study of parasite biology and different parasitic diseases. Genet. Mol. Biol. 2012, 35, 1−17. (6) Sánchez, L. V.; Ramírez, J. D. Congenital and oral transmission of American trypanosomiasis: an overview of physiopathogenic aspects. Parasitology 2012, 25, 1−13. (7) (a) Salomon, C. J. First century of Chagas’ disease: an overview on novel approaches to nifurtimox and benzonidazole delivery systems. J. Pharm. Sci. 2012, 101, 888−894. (b) Matta Guedes, P. M.; Gutierrez, F. R.; Nascimento, M. S.; Do-Valle-Matta, M. A.; Silva, J. S. Antiparasitical chemotherapy in Chagas’ disease cardiomyopathy: current evidence. Trop. Med. Int. Health 2012, 17, 1057−1065. (8) (a) Cerecetto, H.; González, M. Anti-T. cruzi agents: our experience in the evaluation of more than five hundred compounds. Mini-Rev. Med. Chem. 2008, 8, 1355−1383. (b) Alvarez, G.; AguirreLópez, B.; Cabrera, N.; Marins, E. B.; Tinoco, L.; Batthyány, C. I.; de Gómez-Puyou, M. T.; Puyou, A. G.; Pérez-Montfort, R.; Cerecetto, H.; González, M. 1,2,4-Thiadiazol-5(4H)-ones: a new class of selective inhibitors of Trypanosoma cruzi triosephosphate isomerase. Study of the mechanism of inhibition. J. Enzyme Inhib. Med. Chem. 2012, DOI: 10.3109/14756366.2012.700928. (9) Heidelberg, J. F.; Eisen, J. A.; Nelson, W. C.; Clayton, R. A.; Gwinn, M. L.; Dodson, R. J.; Haft, D. H.; Hickey, E. K.; Peterson, J. D.; Umayam, L.; Gill, S. R.; Nelson, K. E.; Read, T. D.; Tettelin, H.; Richardson, D.; Ermolaeva, M. D.; Vamathevan, J.; Bass, S.; Qin, H.; Dragoi, I.; Sellers, P.; McDonald, L.; Utterback, T.; Fleishmann, R. D.; Nierman, W. C.; White, O.; Salzberg, S. L.; Smith, H. O.; Colwell, R. R.; Mekalanos, J. J.; Venter, J. C.; Fraser, C. M. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 2000, 406, 477−483. (10) (a) DelVecchio, V. G.; Kapatral, V.; Redkar, R. J.; Patra, G.; Mujer, C.; Los, T.; Ivanova, N.; Anderson, I.; Bhattacharyya, A.; Lykidis, A.; Reznik, G.; Jablonski, L.; Larsen, N.; D’Souza, M.; Bernal, A.; Mazur, M.; Goltsman, E.; Selkov, E.; Elzer, P. H.; Hagius, S.; O’Callaghan, D.; Letesson, J. J.; Haselkorn, R.; Kyrpides, N.; Overbeek, R. The genome sequence of the facultative intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 443−448. (b) Tomb, J. F.; White, O.; Kerlavage, A. R.; Clayton, R. A.; Sutton, G. G.; Fleischmann, R. D.; Ketchum, K. A.; Klenk, H. P.; Gill, S.; Dougherty, B. A.; Nelson, K.; Quackenbush, J.; Zhou, L.; Kirkness, E. F.; Peterson, S.; Loftus, B.; Richardson, D.; Dodson, R.; Khalak, H. G.; Glodek, A.; McKenney, K.; Fitzegerald, L. M.; Lee, N.; Adams, M. D.; Hickey, E. K.; Berg, D. E.; Gocayne, J. D.; Utterback, T. R.; Peterson, J. D.; Kelley, J. M.; Cotton, M. D.; Weidman, J. M.; Fujii, C.; Bowman, C.; Watthey, L.; Wallin, E.; Hayes, W. S.; Borodovsky, M.; Karp, P. D.; Smith, H. O.; Fraser, C. M.; Venter, J. C. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 1997, 388, 539−547. (11) Cole, S. T.; Brosch, R.; Parkhill, J.; Garnier, T.; Churcher, C.; Harris, D.; Gordon, S. V.; Eiglmeier, K.; Gas, S.; Barry, C. E., 3rd; I



Article

(20) (a) Burghout, P.; Vullo, D.; Scozzafava, A.; Hermans, P. W. M.; Supuran, C. T. Inhibition of the β-carbonic anhydrase from Streptococcus pneumoniae by inorganic anions and small molecules: towards innovative drug design of antiinfectives ? Bioorg. Med. Chem. 2011, 19, 243−248. (b) Supuran, C. T. Carbonic anhydrase inhibition/activation: trip of a scientist around the world in the search of novel chemotypes and drug targets. Curr. Pharm. Des. 2010, 16, 3233−3245. (c) Vullo, D.; Nishimori, I.; Minakuchi, T.; Scozzafava, A.; Supuran, C. T. Inhibition studies with anions and small molecules of two novel β-carbonic anhydrases from the bacterial pathogen Salmonella enterica serovar Typhimurium. Bioorg. Med. Chem. Lett. 2011, 21, 3591−3595. (d) Maresca, A.; Carta, F.; Vullo, D.; Supuran, C. T. Dithiocarbamates strongly inhibit the β-class carbonic anhydrases from Mycobacterium tuberculosis. J. Enzyme Inhib. Med. Chem. 2013, 28, 407−411. (21) (a) Del Prete, S.; Isik, S.; Vullo, D.; De Luca, V.; Carginale, V.; Scozzafava, A.; Supuran, C. T.; Capasso, C. DNA cloning, characterization and inhibition studies of an α-carbonic anhydrase from the pathogenic bacterium Vibrio cholerae. J. Med. Chem. 2012, 55, 10742− 10748. (b) Nishimori, I.; Minakuchi, T.; Morimoto, K.; Sano, S.; Onishi, S.; Takeuchi, H.; Vullo, D.; Scozzafava, A.; Supuran, C. T. Carbonic anhydrase inhibitors: DNA cloning and inhibition studies of the alpha-carbonic anhydrase from Helicobacter pylori, a new target for developing sulfonamide and sulfamate gastric drugs. J. Med. Chem. 2006, 49, 2117−2126. (c) Nishimori, I.; Onishi, S.; Takeuchi, H.; Supuran, C. T. The α and β classes carbonic anhydrases from Helicobacter pylori as novel drug targets. Curr. Pharm. Des. 2008, 14, 622−630. (d) Nishimori, I.; Minakuchi, T.; Kohsaki, T.; Onishi, S.; Takeuchi, H.; Vullo, D.; Scozzafava, A.; Supuran, C. T. Carbonic anhydrase inhibitors. The β-carbonic anhydrase from Helicobacter pylori is a new target for sulfonamide and sulfamate inhibitors. Bioorg. Med. Chem. Lett. 2007, 17, 3585−3594. (e) Maresca, A.; Scozzafava, A.; Vullo, D.; Supuran, C. T. Dihalogenated sulfanilamides and benzolamides are effective inhibitors of the three β-class carbonic anhydrases from Mycobacterium tuberculosis. J. Enzyme Inhib. Med. Chem. 2013, 28, 384−387. (f) Maresca, A.; Vullo, D.; Scozzafava, A.; Supuran, C. T. Inhibition of the alpha- and beta-carbonic anhydrases from the gastric pathogen Helycobacter pylori with anions. J. Enzyme Inhib. Med. Chem. 2013, 28, 388−391. (22) (a) Klengel, T.; Liang, W. J.; Chaloupka, J.; Ruoff, C.; Schroppel, K.; Naglik, J. R.; Eckert, S. E.; Mogensen, E. G.; Haynes, K.; Tuite, M. F.; Levin, L. R.; Buck, J.; Muhlschlegel, F. A. Fungal adenylyl cyclase integrates CO2 sensing with cAMP signaling and virulence. Curr. Biol. 2005, 15, 2021−2026. (b) Mogensen, E. G.; Janbon, G.; Chaloupka, J.; Steegborn, C.; Fu, M. S.; Moyrand, F.; Klengel, T.; Pearson, D. S.; Geeves, M. A.; Buck, J.; Levin, L. R.; Muhlschlegel, F. A. Cryptococcus neoformans senses CO2 through the carbonic anhydrase Can2 and the adenylyl cyclase Cac1. Eukaryotic Cell 2006, 5, 103−111. (c) Schlicker, C.; Hall, R. A.; Vullo, D.; Middelhaufe, S.; Gertz, M.; Supuran, C. T.; Muhlschlegel, F. A.; Steegborn, C. Structure and inhibition of the CO2-sensing carbonic anhydrase Can2 from the pathogenic fungus Cryptococcus neoformans. J. Mol. Biol. 2009, 385, 1207−1220. (23) (a) Krungkrai, J.; Scozzafava, A.; Reungprapavut, S.; Krungkrai, S. R.; Rattanajak, R.; Kamchonwongpaisan, S.; Supuran, C. T. Carbonic anhydrase inhibitors. Inhibition of Plasmodium falciparum carbonic anhydrase with aromatic sulfonamides: towards antimalarials with a novel mechanism of action? Bioorg. Med. Chem. 2005, 13, 483− 489. (b) Krungkrai, J.; Krungkrai, S. R.; Supuran, C. T. Malarial parasite carbonic anhydrase and its inhibitors. Curr. Top. Med. Chem. 2007, 7, 909−917. (c) Krungkrai, J.; Supuran, C. T. The alphacarbonic anhydrase from the malarial parasite and its inhibition. Curr. Pharm. Des. 2008, 14, 631−640. (d) Krungkrai, J.; Krungkrai, S. R.; Supuran, C. T. Carbonic anhydrase inhibitors. Inhibition of Plasmodium falciparum carbonic anhydrase with aromatic/heterocyclic sulfonamides: in vitro and in vivo studies. Bioorg. Med. Chem. Lett. 2008, 18, 5466−5471. (24) Hilvo, M.; Baranauskiene, L.; Salzano, A. M.; Scaloni, A.; Matulis, D.; Innocenti, A.; Scozzafava, A.; Monti, S. M.; Di Fiore, A.;

De Simone, G.; Lindfors, M.; Janis, J.; Valjakka, J.; Pastorekova, S.; Pastorek, J.; Kulomaa, M. S.; Nordlund, H. R.; Supuran, C. T.; Parkkila, S. Biochemical characterization of CA IX: one of the most active carbonic anhydrase isozymes. J. Biol. Chem. 2008, 283, 27799− 27809. (25) (a) Khalifah, R. G. The carbon dioxide hydration activity of carbonic anhydrase. I. Stop-flow kinetic studies on the native human isoenzymes B and C. J. Biol. Chem. 1971, 246, 2561−2573. (b) Fisher, S. Z.; Aggarwal, M.; Kovalevsky, A. Y.; Silverman, D. N.; McKenna, R. Neutron diffraction of acetazolamide-bound human carbonic anhydrase II reveals atomic details of drug binding. J. Am. Chem. Soc. 2012, 134, 14726−14729. (c) Genis, C.; Sippel, K. H.; Case, N.; Cao, W.; Avvaru, B. S.; Tartaglia, L. J.; Govindasamy, L.; Tu, C.; AgbandjeMcKenna, M.; Silverman, D. N.; Rosser, C. J.; McKenna, R. Design of a carbonic anhydrase IX active-site mimic to screen inhibitors for possible anticancer properties. Biochemistry 2009, 48, 1322−1331. (d) Mikulski, R.; West, D.; Sippel, K. H.; Avvaru, B. S.; Aggarwal, M.; Tu, C.; McKenna, R.; Silverman, D. N. Water networks in fast proton transfer during catalysis by human carbonic anhydrase II. Biochemistry 2013, 52, 125−131. (e) Ohradanova, A.; Vullo, D.; Pastorekova, S.; Pastorek, J.; Jackson, D. J.; Wörheide, G.; Supuran, C. T. Cloning, characterization and sulfonamide inhibition studies of an α-carbonic anhydrase from the living fossil sponge Astrosclera willeyana. Bioorg. Med. Chem. 2012, 20, 1403−1410. (26) (a) Vullo, D.; De Luca, V.; Scozzafava, A.; Carginale, V.; Rossi, M.; Supuran, C. T.; Capasso, C. Anion inhibition studies of the fastest carbonic anhydrase (CA) known, the extremo-CA from the bacterium Sulf urihydrogenibium azorense. Bioorg. Med. Chem. Lett. 2012, 22, 7142−7145. (b) De Luca, V.; Vullo, D.; Scozzafava, A.; Carginale, V.; Rossi, M.; Supuran, C. T.; Capasso, C. An α-carbonic anhydrase from the thermophilic bacterium Sulphurihydrogenibium azorense is the fastest enzyme known for the CO2 hydration reaction. Bioorg. Med. Chem. [Online early access]. DOI: 10.1016/j.bmc.2012.09.047. Published Online: Sep 29, 2012. (c) Capasso, C.; De Luca, V.; Carginale, V.; Cannio, R.; Rossi, M. Biochemical properties of a novel and highly thermostable bacterial alpha-carbonic anhydrase from Sulf urihydrogenibium yellowstonense YO3AOP1. J. Enzyme Inhib. Med. Chem. 2012, 27, 892−897. (27) Carta, F.; Scozzafava, A.; Supuran, C. T. Sulfonamides (RSO2NH2): a patent review 2008−2012. Expert Opin. Ther. Pat. 2012, 22, 747−758. (28) Abdel-Hamid, M. K.; Abdel-Hafez, A. A.; El-Koussi, N. A.; Mahfoouz, N. M.; Innocenti, A.; Supuran, C. T. Design, synthesis and docking studies of new 1,3,4-thiadiazole-2-thione derivatives with carbonic anhydrase inhibitory activity. Bioorg. Med. Chem. 2007, 15, 6975−6984. (29) (a) Carta, F.; Aggarwal, M.; Maresca, A.; Scozzafava, A.; McKenna, R.; Supuran, C. T. Dithiocarbamates: a new class of carbonic anhydrase inhibitors. Crystallographic and kinetic investigations. Chem. Commun. (Cambridge, U. K.) 2012, 48, 1868−1870. (b) Kolayli, S.; Karahalil, F.; Sahin, H.; Dincer, B.; Supuran, C. T. Characterization and inhibition studies of an α-carbonic anhydrase from the endangered sturgeon species Acipenser gueldenstaedti. J. Enzyme Inhib. Med. Chem. 2011, 26, 895−900. (c) Maresca, A.; Carta, F.; Vullo, D.; Supuran, C. T. Dithiocarbamates strongly inhibit the beta-class carbonic anhydrases from Mycobacterium tuberculosis. J. Enzyme Inhib. Med. Chem. 2013, 28, 407−411. (d) Carta, F.; Aggarwal, M.; Maresca, A.; Scozzafava, A.; McKenna, R.; Masini, E.; Supuran, C. T. Dithiocarbamates strongly inhibit carbonic anhydrases and show antiglaucoma action in vivo. J. Med. Chem. 2012, 55, 1721−1730. (30) (a) Maresca, A.; Temperini, C.; Vu, H.; Pham, N. B.; Poulsen, S. A.; Scozzafava, A.; Quinn, R. J.; Supuran, C. T. Non-zinc mediated inhibition of carbonic anhydrases: coumarins are a new class of suicide inhibitors. J. Am. Chem. Soc. 2009, 131, 3057−3062. (b) Maresca, A.; Temperini, C.; Pochet, L.; Masereel, B.; Scozzafava, A.; Supuran, C. T. Deciphering the mechanism of carbonic anhydrase inhibition with coumarins and thiocoumarins. J. Med. Chem. 2010, 53, 335−344. (c) Maresca, A.; Supuran, C. T. Coumarins incorporating hydroxyand chloro-moieties selectively inhibit the transmembrane, tumorJ



Article

associated carbonic anhydrase isoforms IX and XII over the cytosolic ones I and II. Bioorg. Med. Chem. Lett. 2010, 20, 4511−4514. (31) Carta, F.; Temperini, C.; Innocenti, A.; Scozzafava, A.; Kaila, K.; Supuran, C. T. Polyamines inhibit carbonic anhydrases by anchoring to the zinc-coordinated water molecule. J. Med. Chem. 2010, 53, 5511−5522. (32) De Simone, G.; Scozzafava, A.; Supuran, C. T. Which carbonic anhydrases are targeted by the antiepileptic sulfonamides and sulfamates? Chem. Biol. Drug Des. 2009, 74, 317−321. (33) (a) Scozzafava, A.; Mastrolorenzo, A.; Supuran, C. T. Modulation of carbonic anhydrase activity and its applications in therapy. Expert Opin. Ther. Pat. 2004, 14, 667−702. (b) Supuran, C. T.; Scozzafava, A.; Casini, A. Development of Sulfonamide Carbonic Anhydrase Inhibitors. In Carbonic Anhydrase: Its Inhibitors and Activators; Supuran, C. T., Scozzafava, A., Conway, J., Eds.; CRC Press: Boca Raton, FL, 2004; pp 67−147. (c) Liu, F.; Martin-Mingot, A.; Lecornué, F.; Jouannetaud, M. P.; Maresca, A.; Thibaudeau, S.; Supuran, C. T. Carbonic anhydrases inhibitory effects of new benzenesulfonamides synthesized by using superacid chemistry. J. Enzyme Inhib. Med. Chem. 2012, 27, 886−891. (d) Ozensoy, O.; Arslan, M.; Supuran, C. T. Carbonic anhydrase inhibitors: purification and inhibition studies of pigeon (Columba livia var. domestica) red blood cell carbonic anhydrase with sulfonamides. J. Enzyme Inhib. Med. Chem. 2011, 26, 749−753. (e) Bootorabi, F.; Jänis, J.; Hytönen, V. P.; Valjakka, J.; Kuuslahti, M.; Vullo, D.; Niemelä, O.; Supuran, C. T.; Parkkila, S. Acetaldehyde-derived modifications on cytosolic human carbonic anhydrases. J. Enzyme Inhib. Med. Chem. 2011, 26, 862−870. (34) Barrese, A. A., 3rd; Genis, C.; Fisher, S. Z.; Orwenyo, J. N.; Kumara, M. T.; Dutta, S. K.; Phillips, E.; Kiddle, J. J.; Tu, C.; Silverman, D. N.; Govindasamy, L.; Agbandje-McKenna, M.; McKenna, R.; Tripp, B. C. Inhibition of carbonic anhydrase II by thioxolone: a mechanistic and structural study. Biochemistry 2008, 47, 3174−3184. (35) Supuran, C. T. Carbonic Anhydrases: Off-Targets, Add-On Activities, or Emerging Novel Targets? In Polypharmacology in Drug Discovery; Peters, J. U., Ed.; Wiley: Hoboken, NJ, 2012; pp 459−491. (36) Rolon, M.; Vega, C.; Escario, J. A.; Gomez-Barrio, A. Deveolopment of resazurin microtiter assay for drug sensibility testing of Trypanosoma cruzi epimastigotes. Parasitol. Res. 2006, 99, 103−107.

K


Cloning, Characterization, and Sulfonamide and ... - ACS Publications

Recommend Documents