Colorimetric Detection of Norovirus in Oyster Samples through

Jan 30, 2018 - Worldwide, norovirus is one of the most associated causes of acute gastroenteritis, which leads to nearly 50 000 child deaths every yea...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2018, 66, 3003−3008

Colorimetric Detection of Norovirus in Oyster Samples through DNAzyme as a Signaling Probe Bhagwan S. Batule,† Seong U Kim,‡ Hyoyoung Mun,† Changsun Choi,§ Won-Bo Shim,∥ and Min-Gon Kim*,†,‡ †

Department of Chemistry, School of Physics and Chemistry and ‡Advanced Photonics Research Institute, Gwangju Institute of Science and Technology, 261 Chemdan gwagiro, Gwangju 500-12, Republic of Korea § Department of Food and Nutrition, College of Biotechnology and Natural Resources, Chung-Ang University, Anseong, Gyounggi 17546, Republic of Korea ∥ Department of Agricultural Chemistry and Food Science and Technology, Gyeongsang National University, 900 Gajwa-dong, Jinju, Gyeongnam 660-701, Republic of Korea S Supporting Information *

ABSTRACT: Worldwide, norovirus is one of the most associated causes of acute gastroenteritis, which leads to nearly 50 000 child deaths every year in developing countries. Therefore, there is great demand to develop a rapid, low-cost, and accurate detection assay for the foodborne norovirus infection to reduce mortality caused by norovirus. Considering the importance of norovirus, we have demonstrated a highly sensitive and specific colorimetric detection method for analysis of human norovirus genogroups I and II (HuNoV GI and GII) in oyster samples. This is the first report to employ colorimetric HRPzyme-integrated polymerase chain reaction (PCR) for direct norovirus detection from the real shellfish samples. We found that the HRPzymeintegrated PCR method is more sensitive than the gel electrophoresis approach and could detect the HuNoV GI and GII genome up to 1 copy/mL. The specificity of the proposed method was successfully demonstrated for HuNoV GI and GII. Further, we performed testing HuNoVs in the spiked oyster samples, and the HRPzyme-integrated PCR method proved to be an ultrasensitive and selective method for detecting HuNoVs in the real samples. By integration of the proposed method with the portable PCR machine, it would be more reliable to improve food safety by detecting HuNoVs in the different types of shellfish, such as oyster and mussel, at the production field. KEYWORDS: norovirus, PCR, G-quadruplex, shellfish, colorimetric sensor

■

samples.18,19 Still, aforementioned methods need costly chemicals, advanced equipment, and expert assistants to perform the analysis.20−22 Considering the limited applicability of RT-PCR on-site detection of norovirus, there is great demand to develop rapid and reliable methods for on-site detection of HuNoVs. Recently, different colorimetric detection platforms have been developed on the basis of horseradish-peroxidasemimicking DNAzyme (HRPzyme) as a signaling probe for detection of different analytes, such as viruses and bacteria.23,24 The HRPzyme is composed of a guanine (G)-rich sequence, which folds into a G-quadruplex structure in the presence of hemin and catalyzes peroxidation with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS) and H2O2.25,26 The HRPzyme showed several characteristics, such as robust, inexpensive, and naked-eye detection.27 Recently, HRPzyme integrated primers have been employed as a colorimetric probe in the PCR amplification for sensitive and selective detection of pathogenic bacteria.28−30 Therefore, HRPzyme-integrated PCR would be ideal for the detection of norovirus. In this study, we

INTRODUCTION Noroviruses are now recognized as the most common foodborne pathogen causing diarrhea, acute gastroenteritis, and food poisoning in people of all ages.1−3 Noroviruses can survive in diverse environmental conditions, and they are often transmitted via ingestion of contaminated water or food, direct contact, or inhalation of aerosols.4−6 The genogroups (GI and GII) of noroviruses contain the most human-specific strains.7 In 2006, in 31 school cafeterias, 2400 students were infected by norovirus food poisoning in Korea.8 Recent studies revealed that noroviruses are present in seafood, such as shellfish and oyster.9,10 The contamination of oyster with noroviruses is a serious public health issue.11 Therefore, early detection of clinical infection of noroviruses is important because it can facilitate more rapid implementation of rigorous controls, which can result in reduced health care costs and improved public health. Several research groups reported detection methods for norovirus, such as enzyme-linked immunosorbent assay (ELISA),12 antibody-based magnetic separation,13 dipstick immunoassay,14 drop microfluidic system,15 isothermal amplification,16 and DNA aptasensor.17 Real-time reverse transcription-polymerase chain reaction (RT-PCR)-based methods are employed as a gold standard method to detect human norovirus (HuNoV) GI and GII RNA from seafood © 2018 American Chemical Society

Received: Revised: Accepted: Published: 3003

November 13, 2017 January 10, 2018 January 30, 2018 January 30, 2018 DOI: 10.1021/acs.jafc.7b05289 J. Agric. Food Chem. 2018, 66, 3003−3008

Article

Journal of Agricultural and Food Chemistry Table 1. Primer Information of HRPzyme-Integrated PCR Used for Detection of HuNoV GI and GII HuNoV detection

a

target region

HuNoV GI

RdRp

HuNoV GII

BPO

primer sequence (5′ → 3′)a

primer b

GI-F GI-Rb GII-Fb GII-Rb

AAAAAAAAAAGGGTAGGGCGGGTTGGGTAAAAACGYTGGATGCGITTYCATGA AAAAAAAAAAGGGTAGGGCGGGTTGGGTAAAAACTTAGACGCCATCATCATTYAC AAAAAAAAAAGGGTAGGGCGGGTTGGGTAAAAAAICCIATGTTYAGITGGATGAG AAAAAAAAAAGGGTAGGGCGGGTTGGGTAAAAATCGACGCCATCTTCATTCACA

Mixed bases in degenerate primers as follows: Y = C or T, and I = inosine. bPrimers as described by ref 22.

Figure 1. Schematic illustration of the HRPzyme-based colorimetric PCR method for norovirus detection from the oyster sample. buffer (pH 4) were mixed and the absorbance was measured at 410 nm after 10 min at room temperature with a microplate reader (Infinite M2000 Pro, Tecan Group, Ltd., Switzerland) or images were captured with a digital camera (Samsung, Seoul, South Korea). Detection of Norovirus in Spiked Oyster Samples. First, we collected aliquots of pancreatic tissues obtained from control oyster samples, which were tested as a negative for HuNoVs (GI and GII). Then, 200 μL dilutions of norovirus suspension were used for artificial contamination of oyster samples. The samples were vortexed for 1 min before preparation of different diluted virus concentrations. Three replicates were prepared from dilution and used for further experiment, such as feasibility and sensitivity studies. The detection procedure was used the same as mentioned above. Instrumentation. The absorbance of the ABTS oxidation product was determined using an Infinite 1000 reader (Tecan, Mannedorf, Switzerland) at 410 nm. PCR amplification reactions were performed on a C1000 thermal cycler (Bio-Rad, Hercules, CA, U.S.A.). Images were captured with a NX 200 digital camera (Samsung, Seoul, South Korea). The relative intensity (a.u.) value was obtained by subtracting the average intensity of the negative samples from the average intensity of the positive samples.

have developed a novel approach for rapid and precise detection of food-borne norovirus based on HRPzymeintegrated PCR. To the best our knowledge, this is the first report using HRPzyme-integrated primer-based colorimetric PCR for HuNoV GI and GII in the spiked and real samples of oyster.

■

MATERIALS AND METHODS

Materials and Reagents. ABTS and hemin were purchased from Sigma-Aldrich (Yongin, South Korea). Tris-buffered ethylenediaminetetraacetic acid buffer was obtained from LPS Solution (Daejeon, South Korea). Thermus thermophilus (Tth) DNA polymerase was purchased from Epicenter Technologies (Madison, WI, U.S.A.). The 100 bp DNA Ladder (Dye Plus) was purchased from Takara Bio (Seoul, South Korea). All primers used in this study were purchased from Genotech (Daejeon, South Korea). Agarose powder was purchased from Roche (Seoul, South Korea). All reagents and solvents used in this study were of analytical grade and used without further purification. The primer sets employed for norovirus detection are presented in Table 1. Sensitivity of Norovirus Detection. We used the most important HuNoV GI and GII genotypes as detection analytes.19 The highly homogeneous region of GI and GII was used to select HRPzyme-integrated PCR primers using primer3 software. PCR reactions were performed at optimized conditions in a total volume of 50 μL containing 5 μL of norovirus suspensions at different concentrations (0−103 copies per reaction), 2.5 μL of 10× PCR buffer, 6 μL of 25 mM MgCl2, 8 μL of 2.5 mM dNTP mix, 5 μL of 10× PCR enhancer, 1 μL of 25 mM MnSO4, 1 μL of 20 μM forward primer, 1 μL of 20 μM reverse primer, and 0.5 μL of Tth DNA polymerase. PCR was performed under the following conditions: denaturation at 95 °C for 5 min and 60 °C for 20 min, followed by 35 cycles of denaturation at 94 °C for 10 s, annealing at 60 °C for 25 s, and primer extension at 72 °C for 10 s. The final extension was performed at 72 °C for 1 min. Control PCR was performed in the absence of target norovirus copies. First, PCR-based amplification of norovirus with specific primers (F and R) was confirmed by electrophoresis in a 1.5% agarose gel. Then, at the end of the amplification, 10 μL of the PCR product, 5.5 μL of 300 μM hemin, 100 μL of 5.5 mM ABTS, 0.7 μL of 35% H2O2, and 1 mL of citrate

■

RESULT AND DISCUSSION Principle and Design of Colorimetric Detection of HuNoVs. In this work, a one-step colorimetric HRPzymeintegrated PCR method was successfully used for the detection of HuNoVs. The primers (forward and reverse) were modified with four regions, such as protector, HRPzyme, spacer, and complementary sequence to norovirus RNA. In our previous report,28 we have optimized the size of the protector and spacer sequence. On the basis of HRPzyme-integrated primers, we have developed a sensitive and selective colorimetric detection method for HuNoVs (Figure 1). The protector and spacer sequences were employed for blocking the folding of the HRPzyme sequence in the double-strand case and avoiding non-specific binding. However, the protector sequence did not show any negative effect on the catalytic activity of the folded HRPzyme sequence. Therefore, blocked HRPzyme could not produce a color signal in the presence of ABTS and H2O2 and 3004

DOI: 10.1021/acs.jafc.7b05289 J. Agric. Food Chem. 2018, 66, 3003−3008

Article

Journal of Agricultural and Food Chemistry vice versa. On the basis of previous reports,22 we designed primers for HuNoV GI and GII, which are mentioned in the Table 1. We have amplified HuNoV genes in one-step PCR. First, we lysed virus particles by boiling samples containing HuNoVs. Then, we employed thermostable Tth DNA polymerase from T. thermophilus, which have reverse transcriptase as well as polymerase activity. Further, cDNA synthesis and PCR amplification were simultaneously carried out in one step. In the presence of norovirus, double-stranded products were generated through HRPzyme-integrated PCR, and then blocked HRPzyme could not fold into a quadruplex structure in the presence of hemin. In the absence of norovirus, unamplified primers folded into G-quadruplex with a hemin molecule. Further, the catalytic hemin−G-quadruplex complex catalyzes the oxidation of ABTS in the presence of H2O2 and produces a colored product.29−31 Optimization of the Primer Concentration and Protector Sequence Length. On the basis of the colorimetric signal, we have tested the effect of the primer concentration and protector poly-adenine (A) nucleotide (ntd) length. First, we employed different concentrations of primer (10−800 nM) and found that 400 nM exhibited the highest relative intensity (Figure S1a of the Supporting Information). Then, we tested different lengths of poly-A (0−20 ntds) as the protector nucleotide sequence at the 5′ end of primers (forward and reverse primers) and found that 10 ntds showed maximum relative intensity (Figure S1b of the Supporting Information). On the basis of a previous report,28 poly-A nucleotides showed the least effect on G-quadruplex folding and catalytic activity. We employed these optimized conditions for further experiments. Feasibility Study of the Proposed Colorimetric Method. With optimized conditions, we have demonstrated our proposed strategy by successfully detecting HuNoV GI and GII in Figure 2. We have used optimized conditions from our

HuNoV GI and GII, respectively. Further, the colorimetric signal was generated by the addition of hemin, H2O2, and ABTS, which can be confirmed by the naked eye (Figure 2b), and corresponding quantitative data are presented in Figure 2c. Notably, the PCR reaction without a target did not show any specific bands, but the solution turned to blue−green color as a result of catalytic activity of unamplified primers. There was a significant difference between with and without the norovirus sample for sensitive detection. Sensitivity Study of the Proposed Strategy for HuNoV GI and GII Detection. We have successfully quantified HuNoV GI and GII based on our proposed strategy by detecting different concentrations. First, we prepared different concentrations of HuNoV GI and GII with the range of 0−104 copies mL−1 diluted in the PBS buffer. Further, The PCR amplification was performed with different concentrations of norovirus particles without RNA extraction. The PCR amplification of HuNoV GI and GII confirmed by agarose gel electrophoresis. In Figures 3a and 4a, the band intensities

Figure 3. Sensitivity of HuNoV GI: (a) gel electrophoresis data of different concentrations of GI, (b) naked eye detection of GI, and (c) calibration curve toward GI. Each data represents the mean value ± standard deviation for replicates (n = 3).

were directly proportional to concentrations of respective HuNoV GI and GII. The colorimetric signals were inversely proportional to the concentration of respective HuNoV GI and GII (Figures 3b and 4b). Figures 3c and 4c represent the quantitative data of color intensities. The color intensities of PCR products depict a negative linear relationship with the concentration of HuNoV GI and GII (Figures 3c and 4c). The standardization curve of color intensities versus different concentrations of HuNoV GI and GII showed excellent linearity in the range of concentrations from 1.0 to 1.0 × 104 copies mL−1 (Figure 3c). Our colorimetric HRPzymeintegrated PCR detection platform exhibited 10-fold (HuNoV GI) and 100-fold (HuNoV GII) better results than the agarosegel-electrophoresis-based assay. Further, the proposed strategy of HuNoV detection was compared to some previously reported methods (Table S1 of the Supporting Information).

Figure 2. Feasibility study for detection of HuNoV GI and GII: (a) electrophoresis data of (1) with HuNoV GI, (2) without HuNoV GI, (3) with HuNoV GII, and (4) without HuNoV GII, (b) colorimetric images of (1) with HuNoV GI, (2) without HuNoV GI, (3) with HuNoV GII, and (4) without HuNoV GII, and (c) quantitative data of panel b. Each data represents the mean value ± standard deviation for replicates (n = 3).

previous report.28 For this purpose, we designed HuNoV GI and GII specific primers (forward and reverse), containing target specific, spacer, HRPzyme, and protector sequence at the 3′ end. We performed PCR amplification of HuNoV GI and GII with modified primers presented in Table 1. First, we confirmed PCR amplification of the HuNoV GI and GII gene product through 1.5% agarose gel electrophoresis (Figure 2a). In Figure 2a, the bands in lanes 2 and 4 correspond to samples 3005

DOI: 10.1021/acs.jafc.7b05289 J. Agric. Food Chem. 2018, 66, 3003−3008

Article

Journal of Agricultural and Food Chemistry

norovirus in the spiked oyster samples, which were purchased from a local market. We have spiked a known concentration of HuNoV GI and GII (0−103 copies mL−1) in oyster samples. The accuracy and precision of proposed HRPzyme-integrated PCR were estimated using recovery analysis from the spiked oyster samples, which were obtained from a local market. Satisfactory recoveries of GI and GII in the range of 92−105% were obtained after sample analysis with three replicates (Table 2). Further, we detected norovirus from the HuNoV-infected Table 2. Recovery Study of HuNoV GI and GII in the Spiked Oyster Sample (n = 3) HuNoV HuNoV GI

HuNoV GII

a

Figure 4. Sensitivity of HuNoV GII: (a) gel electrophoresis data of different concentrations of GII, (b) naked eye detection of GII, and (c) calibration curve toward GII. Each data represents the mean value ± standard deviation for replicates (n = 3).

sample number 1 2 3 4 1 2 3 4

added (copies) 1 1 1 1 1 1

found (copies)

0 × 101 × 102 × 103 0 × 101 × 102 × 103

(0.9258 (0.9645 (1.0008 (1.0051 (0.9811 (1.0844

NDa ± 0.020) ± 0.035) ± 0.053) ND ± 0.058) ± 0.042) ± 0.049)

recovery (%)

× 101 × 102 × 103

92.58 96.45 100.08

× 101 × 102 × 103

100.51 98.11 108.44

ND = not detected.

oyster real samples. The HuNoV-infected oyster was obtained from the Korean Sea. We directly tested a real sample with our proposed method and successfully detected HuNoV GI and GII (Table 3). Further, we reliability investigated our proposed

In comparison to previous methods of HuNoV detection, our proposed method showed several advantages, such as one-tube two-step, cost-effective, genomic RNA extraction-free, and naked eye detection. Further, we successfully verified the selectivity of the proposed strategy for the detection of HuNoV GI and GII with different pathogenic bacteria (such as Escherichia coli O157:H7, Listeria monocytogenes, Vibrio parahemolyticus, Salmonella enterica, Salmonella typhimurium, and Bacillus cereus), which are commonly contaminated at low levels in oyster samples.32 On the basis of the aforementioned optimized conditions, we selectively detected HuNoV GI and GII with other pathogenic bacteria with a concentration of 104 colonyforming units (cfu) mL−1 and found that there was obtained negligible colorimetric intensity with non-target pathogenic bacteria and vice versa (Figure S2 of the Supporting Information). The results showed the excellent specificity of the proposed strategy toward HuNoV GI and GII detection. In addition, there are many ions (such as Fe, Cu, Co, and Pt), which can affect the color change of peroxidase substrate [such as ABTS, 3,3′,5,5′-tetramethylbenzidine (TMB), and amplex ultra red (AUR)] by H2O2.33−36 Importantly, the nanomolar concentration of metal ions in the biological sample does not produce any colorimetric signal in the presence of ABTS. Therefore, in our experiments, we did not found any interference of metal ions, such as Fe, Cu, Co, and Pt, on the final colorimetric signal of oxidized ABTS. Detection of HuNoV GI and GII in the Spiked Oyster Sample. Recently, many cases were reported as a result of consumption of norovirus-infected raw or undercooked oysters or shellfish. Therefore, the detection of norovirus from fresh oysters or shellfish is more important to stop the spread of norovirus infection. In this work, we have validated the applicability of the proposed colorimetric detection method for

Table 3. Detection of Real Oyster Samples Obtained from the Korean Sea real-time PCR (copies) sample S1 S2 S3

GI

GII

our proposed method (copies) GI

8.45 94.26 1041.14

142.22

GII 11.27

100.01 995.50

146.33

method for real oyster samples from a local market along with the conventional real-time PCR method. Table 3 represents that our method showed good agreement with the conventional method. Moreover, this proposed method has several advantages, such as label-free, low-cost, naked eye, and pointof-care diagnosis. Detection of norovirus is clinically important as a result of many norovirus-infected cases showing acute gastroenteritis and also reporting morbidity worldwide. Therefore, we developed a simple, sensitive, and selective reverse-signalingbased colorimetric HRPzyme-integrated PCR. In this strategy, we have designed an integrated primer containing four regions, such as target specific, spacer, HRPzyme, and protector sequence. We have successfully detected norovirus up to a single with a suitable detection range through a colorimetric signal generated by the HRPzyme−hemin-complex-mediated oxidation of ABTS with H2O2. In addition, we have confirmed diagnostic capability by detection of norovirus in spiked and real oyster samples. Integration of this proposed strategy with the portable PCR machine could be applied in the detection of norovirus in a resource-limited area. 3006

DOI: 10.1021/acs.jafc.7b05289 J. Agric. Food Chem. 2018, 66, 3003−3008

Article

Journal of Agricultural and Food Chemistry

■

(9) Loisy, F.; Atmar, R.; Guillon, P.; Le Cann, P.; Pommepuy, M.; Le Guyader, F. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods 2005, 123, 1−7. (10) Jeon, S. B.; Seo, D. J.; Oh, H.; Kingsley, D. H.; Choi, C. Development of one-step reverse transcription loop-mediated isothermal amplification for norovirus detection in oysters. Food Control 2017, 73, 1002−1009. (11) Polo, D.; Schaeffer, J.; Fournet, N.; Le Saux, J.-C.; Parnaudeau, S.; McLeod, C.; Le Guyader, F. S. Digital PCR for quantifying norovirus in oysters implicated in outbreaks, France. Emerging Infect. Dis. 2016, 22, 2189. (12) de Bruin, E.; Duizer, E.; Vennema, H.; Koopmans, M. P. Diagnosis of Norovirus outbreaks by commercial ELISA or RT-PCR. J. Virol. Methods 2006, 137, 259−264. (13) Park, Y.; Cho, Y.-H.; Jee, Y.; Ko, G. Immunomagnetic separation combined with real-time reverse transcriptase PCR assays for detection of norovirus in contaminated food. Appl. Environ. Microbiol. 2008, 74, 4226−4230. (14) Khamrin, P.; Nguyen, T. A.; Phan, T. G.; Satou, K.; Masuoka, Y.; Okitsu, S.; Maneekarn, N.; Nishio, O.; Ushijima, H. Evaluation of immunochromatography and commercial enzyme-linked immunosorbent assay for rapid detection of norovirus antigen in stool samples. J. Virol. Methods 2008, 147, 360−363. (15) Fischer, A. E.; Wu, S. K.; Proescher, J. B.; Rotem, A.; Chang, C. B.; Zhang, H.; Tao, Y.; Mehoke, T. S.; Thielen, P. M.; Kolawole, A. O.; Smith, T. J.; Wobus, C. E.; Weitz, D. A.; Lin, J. S.; Feldman, A. B.; Wolfe, J. T. A high-throughput drop microfluidic system for virus culture and analysis. J. Virol. Methods 2015, 213, 111−117. (16) Fukuda, S.; Takao, S.; Kuwayama, M.; Shimazu, Y.; Miyazaki, K. Rapid detection of norovirus from fecal specimens by real-time reverse transcription-loop-mediated isothermal amplification assay. J. Clin. Microbiol. 2006, 44, 1376−1381. (17) Giamberardino, A.; Labib, M.; Hassan, E. M.; Tetro, J. A.; Springthorpe, S.; Sattar, S. A.; Berezovski, M. V.; DeRosa, M. C. Ultrasensitive norovirus detection using DNA aptasensor technology. PLoS One 2013, 8, e79087. (18) DiCaprio, E.; Ma, Y.; Hughes, J.; Li, J. Epidemiology, prevention, and control of the number one foodborne illness. Infect. Dis. Clin. 2013, 27, 651−674. (19) Tuan, Z. C.; Hidayah, M.; Chai, L.; Tunung, R.; Ghazali, F. M.; Son, R. The scenario of norovirus contamination in food and food handlers. J. Microbiol. Biotechnol. 2010, 20, 229−237. (20) Liu, G.; Lin, L.; Wang, M.; Liu, X. Development and evaluation of a loop-mediated isothermal amplification assay for the detection of channel catfish virus. J. Fish Dis. 2015, 38, 1073−1076. (21) Nemoto, M.; Morita, Y.; Niwa, H.; Bannai, H.; Tsujimura, K.; Yamanaka, T.; Kondo, T. Rapid detection of equine coronavirus by reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 2015, 215−216, 13−16. (22) Kageyama, T.; Kojima, S.; Shinohara, M.; Uchida, K.; Fukushi, S.; Hoshino, F. B.; Takeda, N.; Katayama, K. Broadly reactive and highly sensitive assay for norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J. Clin. Microbiol. 2003, 41, 1548−1557. (23) Jiang, C.; Yan, C.; Jiang, J.; Yu, R. Colorimetric assay for T4 polynucleotide kinase activity based on the horseradish peroxidasemimicking DNAzyme combined with λ exonuclease cleavage. Anal. Chim. Acta 2013, 766, 88−93. (24) Zhou, Z.; Peng, L.; Wang, X.; Xiang, Y.; Tong, A. A new colorimetric strategy for monitoring caspase 3 activity by HRPmimicking DNAzyme−peptide conjugates. Analyst 2014, 139, 1178− 1183. (25) Kim, S. U.; Batule, B. S.; Mun, H.; Byun, J. Y.; Shim, W.-B.; Kim, M. G. Colorimetric molecular diagnosis of HIV gag gene using DNAzyme and a complementary DNA-extended primer. Analyst 2018, 143, 695−699. (26) Seok, Y.; Byun, J. Y.; Mun, H.; Kim, M. G. Colorimetric detection of PCR products of DNA from pathogenic bacterial targets

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.7b05289. Optimization of colorimetric detection of noroviruses: (a) primer concentration and (b) protector sequence length (Figure S1), specificity of the proposed strategy toward HuNoVs GI and GII: (1) HuNoVs, (2) E. coli O157:H7, (3) L. monocytogenes, (4) V. parahemolyticus, (5) S. typhimurium, and (6) B. cereus, with the concentrations of HuNoVs GI, HuNoVs GII, and all bacteria being 103, 103, and 104 cfu mL−1, respectively, and error bars representing the standard deviations from three representative experiments (n = 3) (Figure S2) and comparison of the proposed strategy with other reported methods for the detection of HuNoV (Table S1) (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Telephone: +82-62-715-3330. Fax: +82-62-715-3419. E-mail: [email protected]. ORCID

Changsun Choi: 0000-0001-7730-8538 Min-Gon Kim: 0000-0002-3525-0048 Funding

This research was supported by a grant from the World Institute of Kimchi funded by the Ministry of Science, Information and Communications Technology (ICT) and Future Planning (KE1701-5), Republic of Korea. This research was supported by the Gwangju Institute of Science and Technololgy (GIST), Republic of Korea, under the Practical Research and Development support program supervised by the GIST Technology Institute (GTI), Republic of Korea. Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Ahmed, S. M.; Hall, A. J.; Robinson, A. E.; Verhoef, L.; Premkumar, P.; Parashar, U. D.; Koopmans, M.; Lopman, B. A. Global prevalence of norovirus in cases of gastroenteritis: A systematic review and meta-analysis. Lancet Infect. Dis. 2014, 14, 725−730. (2) Fankhauser, R. L.; Monroe, S. S.; Noel, J. S.; Humphrey, C. D.; Bresee, J. S.; Parashar, U. D.; Ando, T.; Glass, R. I. Epidemiologic and molecular trends of “Norwalk-like viruses” associated with outbreaks of gastroenteritis in the United States. J. Infect. Dis. 2002, 186, 1−7. (3) Friedman, M. Chemistry, antimicrobial mechanisms, and antibiotic activities of cinnamaldehyde against pathogenic bacteria in animal feeds and human foods. J. Agric. Food Chem. 2017, 65, 10406− 10423. (4) Friedman, M. Antibiotic-resistant bacteria: Prevalence in food and inactivation by food-compatible compounds and plant extracts. J. Agric. Food Chem. 2015, 63, 3805−3822. (5) Koopmans, M.; Duizer, E. Foodborne viruses: An emerging problem. Int. J. Food Microbiol. 2004, 90, 23−41. (6) Li, S. X.; Chen, L. H.; Zheng, F. Y.; Huang, X. G. Influence of eutrophication on metal bioaccumulation and oral bioavailability in oysters, Crassostrea angulata. J. Agric. Food Chem. 2014, 62, 7050− 7056. (7) Mesquita, J. R.; Barclay, L.; Nascimento, M. S. J.; Vinjé, J. Novel norovirus in dogs with diarrhea. Emerging Infect. Dis. 2010, 16, 980. (8) Jee, Y. Norovirus food poisoning and laboratory surveillance for viral gastroenteritis in Korea. Health and Welfare Policy Forum 2006, 26−34. 3007

DOI: 10.1021/acs.jafc.7b05289 J. Agric. Food Chem. 2018, 66, 3003−3008

Article

Journal of Agricultural and Food Chemistry based on a simultaneously amplified DNAzyme. Microchim. Acta 2014, 181, 1965−1971. (27) Mei, Z.; Chu, H.; Chen, W.; Xue, F.; Liu, J.; Xu, H.; Zhang, R.; Zheng, L. Ultrasensitive one-step rapid visual detection of bisphenol A in water samples by label-free aptasensor. Biosens. Bioelectron. 2013, 39, 26−30. (28) Kim, S. U.; Batule, B. S.; Mun, H.; Shim, W. B.; Kim, M. G. Ultrasensitive colorimetric detection of salmonella enterica Typhimurium on lettuce leaves by HRPzyme-integrated polymerase chain reaction. Food Control 2018, 84, 522−528. (29) Cheng, K.; Pan, D.; Teng, J.; Yao, L.; Ye, Y.; Xue, F.; Xia, F.; Chen, W. Colorimetric integrated pCR protocol for rapid detection of Vibrio parahaemolyticus. Sensors 2016, 16, 1600. (30) Cheglakov, Z.; Weizmann, Y.; Beissenhirtz, M. K.; Willner, I. Ultrasensitive detection of DNA by the PCR-Induced generation of DNAzymes: The DNAzyme primer approach. Chem. Chem. Commun. 2006, 3205−3207. (31) Yu, X.; Zhang, Z. L.; Zheng, S. Y. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization. Biosens. Bioelectron. 2015, 66, 520−526. (32) DePaola, A.; Jones, J. L.; Woods, J.; Burkhardt, W.; Calci, K. R.; Krantz, J. A.; Bowers, J. C.; Kasturi, K.; Byars, R. H.; Jacobs, E.; Williams-Hill, D.; Nabe, K. Bacterial and viral pathogens in live oysters: 2007 United States market survey. Appl. Environ. Microbiol. 2010, 76, 2754−2768. (33) Batule, B. S.; Park, K. S.; Kim, M. I.; Park, H. G.; An, S. S. Ultrafast sonochemical synthesis of protein-inorganic nanoflowers. Int. J. Nanomed. 2015, 10, 137. (34) Qin, Y.; Zhang, L.; Ye, G.; Zhao, S. Homogeneous label-free colorimetric strategy for convenient bleomycin detection based on bleomycin enhanced Fe(II)−H2O2−ABTS reaction. Anal. Methods 2014, 6, 7973−7977. (35) Shu, J.; Qiu, Z.; Wei, Q.; Zhuang, J.; Tang, D. Cobalt-porphyrinplatinum-functionalized reduced graphene oxide hybrid nanostructures: A novel peroxidase mimetic system for improved electrochemical immunoassay. Sci. Rep. 2015, 5, 15113. (36) Valekar, A. H.; Batule, B. S.; Kim, M. I.; Cho, K.-H.; Hong, D. Y.; Lee, U. H.; Chang, J. S.; Park, H. G.; Hwang, Y. K. Novel aminefunctionalized iron trimesates with enhanced peroxidase-like activity and their applications for the fluorescent assay of choline and acetylcholine. Biosens. Bioelectron. 2018, 100, 161−168.

3008

DOI: 10.1021/acs.jafc.7b05289 J. Agric. Food Chem. 2018, 66, 3003−3008