Combination of Selenomethionine and N-Acetylcysteine Alleviates the

Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Combination of Selenomethionine and N‑Acetylcysteine Alleviates the Joint Toxicities of Aflatoxin B1 and Ochratoxin A by ERK MAPK Signal Pathway in Porcine Alveolar Macrophages Lili Hou,†,‡ Xuan Zhou,†,‡ Fang Gan,†,‡ Zixuan Liu,†,‡ Yajiao Zhou,†,‡ Gang Qian,†,‡ and Kehe Huang*,†,‡ †

College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, Jiangsu Province, China Institute of Nutritional and Metabolic Disorders in Domestic Animals and Fowls, Nanjing Agricultural University, Nanjing 210095, Jiangsu Province, China

‡

ABSTRACT: Our previous studies showed that aflatoxin B1 (AFB1) and ochratoxin A (OTA) could trigger joint immune toxicity. Little is known about the combined effects of selenomethionine (SeMet) and N-acetylcysteine (NAC) on the joint toxicities of the two toxins. In this study, results showed that SeMet or NAC alone or in combination significantly alleviated the downswing of cell viability, glutathione production, and phagorytosis induced by AFB1 and OTA in porcine alveolar macrophages. The uptrend of lactate dehydrogenase activities, apoptosis, reactive oxygen species levels, and the relative mRNA of inflammatory cytokines triggered by the two toxins was decreased. Combination of them was more effective than single application. Knockdown of p38, c-JUN N-terminal kinase (JNK), or extracellular signal-regulated kinase (ERK) via use of the corresponding specific siRNA could alleviate the joint toxicities of AFB1 and OTA. However, the ERK but not p38 or JNK pathway was involved in the protection of SeMet and NAC against the immunotoxicity. In conclusion, combination of SeMet and NAC might be a new therapeutic orientation for preventing the joint toxicities induced by AFB1 and OTA. KEYWORDS: combination, selenomethionine, N-acetylcysteine, aflatoxin B1, ochratoxin A, mitogen-activated protein kinases

■

INTRODUCTION Ochratoxin A (OTA) was identified after the discovery of aflatoxin B1 (AFB1) and is produced by Aspergillus and Penicillium.1,2 Mycotoxin contamination of cereals, grains, and crops is a worldwide issue. Cereals are the main component of animals’ daily diet and are an important component of animal feeds.3 Because there is no complete regulation for all mycotoxins, farm animals have exhibited symptoms of mycotoxicosis when exposed to feed contaminated with several toxins,4,5 resulting in health impairment and economic losses. In addition, it has been reported that the union of AFB1 and OTA exacerbated immune toxicity was related to the NFκB signaling pathway.6 The joint toxicities made cells and tissues more vulnerable to oxidative stress and immunotoxicity. Because porcine alveolus macrophages are immune cells with many functions, they are important objects in the study of cell phagocytosis, cellular immunity, and molecular immunology. Because of this, we selected swine alveolus macrophage cell line 3D4/21 for our investigation. Selenium is well-known as a kind of organic selenium and an essential trace mineral. However, selenomethionine (SeMet) was found to be one of the toxic ingredients of seleniumcontaining plants in 1938.7 It has been reported that average half-lives of selenite and SeMet in humans are 102 and 252 days, respectively.8,9 Therefore, animals supplemented with SeMet remain protected for longer periods than to those supplemented with selenite. Compared with selenite or selenate, supplementation of SeMet enhanced lymphocyte response.10 Selenium supplied in the diet could significantly inhibit renal apoptosis and cell cycle arrest induced by AFB1 in broilers.11 In addition, selenium could protect the liver © XXXX American Chemical Society

against arsenic-induced toxicity through activation of the Nrf2 pathway and effects on endocrine and immune systems, DNA repair, and other mechanisms.12−14 N-Acetylcysteine (NAC) is known as an antioxidant, and it promotes the production of glutathione (GSH) and directly reacts with free radicals.15,16 We have isolated and identified a strain of Saccharomyces cerevisiae (S. cerevisiae) with high yield of GSH.17 This research provides the foundation for the development and application of selenium− glutathione-enriched probiotics. In addition, Jeo and Chen found that clinical positive reactions of NAC and selenium in the therapy of neurodegenerative diseases provided important evidence for the key role of reactive oxygen species (ROS) in pathological procedures of traumatic brain injury.18,19 In addition, NAC and selenium had neuroprotective effects on hippocampal apoptosis and the calcium channel after traumatic brain injury in rats.20 The mitogen-activated protein kinase (MAPK) pathway is a three-member protein kinase cascade, including p38, extracellular signal-regulated kinase (ERK), and stress-activated protein kinase c-JUN N-terminal kinase (JNK). They will be phosphorylated after stimulation. Different MAPK signaling pathways remain to be understood in terms of their specific functions and are yet to be evaluated clinically.21 Previous research showed that expression of cyclin D1 could be positively regulated through ERK1/2 MAPK and negatively Received: Revised: Accepted: Published: A

April 11, 2018 May 25, 2018 May 25, 2018 May 25, 2018 DOI: 10.1021/acs.jafc.8b01858 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

and extracellular mechanisms, and they were affirmed to be involved in the MAPKs pathway.25 Therefore, we hypothesized that the combined protection of SeMet and NAC against joint toxicities induced by AFB1 and OTA may be involved in different MAPKs signal pathways. In our present study, we investigated the protective effects and underlying mechanism on the porcine alveolar macrophages.

Table 1. Primers Used in the Present Study target gene

primer sequence (5′-3′)

β-actin

F: CTGCGGCATCCACGAAACT R: AGGGCCGTGATCTCCTTCTG F: CCAATGACACAGAAGAAG R: CCAGGTTATTTAGCACAG F: GACTCAGATCATCGTCTC R: GGAGTAGATGAGGTACAG F: CCTCTCCGGACAAAACTGAA R: TCTGCCAGTACCTCCTTGCT F: CTGCCTCCCACTTTCTCTTG R: TCAAAGGGGCTCCCTAGTTT F: TCTACCGGCAGGAGCTGAACAA R: GCAGAACACACGGAGCCATAGG F: GGCCTGGCACCCCTCTCACTCT R: GCGGTCATAGCCCTTCCATTCCA F: CAGCCGATTCGGAGCACAACA R: GGTGGTGGAGCTTCAGCTTCAG

IL-1α TNF-α IL-6 IL-10 p38 ERK JNK

■

MATERIALS AND METHODS

Cell Culture. Porcine alveolar macrophages (3D4/21 cell line) were reserved by our own lab. Cells were incubated by the medium of RPMI-1640 (Gibco, Paisley, Scotland, U.K.). In the medium, 10% heat-inactivated fetal bovine serum (FBS, Lonsa, Richmond, VA, United States), 100 U/mL penicillin, and 100 U/mL streptomycin were appended. AFB1, OTA, dimethyl sulfoxide (DMSO), and lipopolysaccharide (LPS) were bought from Sigma-Aldrich (St. Louis, MO, United States). Cells were cultured in a humidified atmosphere containing 5% CO2 incubator at 37 °C (Thermo Scientific, Waltham, MA, United States). Cell Viability Assay. To gauge the cell viability of AFB1, OTA, SeMet and NAC, cells were incubated in 96-well plates. After pretreatment with SeMet and NAC, cells were exposed to the union of AFB1 and OTA for 45 h. Then, colorimetric 3-(4,5-dimethyl-thiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) (Sigma, St. Louis, MO, United States) was added for 3 h. We measured the absorbance at 490 nm with a secondary wavelength of 650 nm using a Microplate Reader

regulated through p38/HOG MAPK.22 Moreover, different aquaporins could be monitored by a different MAPK signal pathway.23 Chlorotyrosine could trigger a transient phosphorylation of ERK1/2, but not of JNK or p38.24 It was also reported that ROS were produced through various intracellular

Figure 1. Effects of SeMet and NAC alone or in combination on the toxins-induced cytotoxicity. The cell viability and LDH activity assays were processed according to the procedures described in Materials and Methods. All results are expressed as means ± SEM (n = 5). Significance compared with the control group (control group without combined toxins, SeMet, or NAC treatment), *P < 0.05; in all combined toxins treated cells, compared with the group without SeMet or NAC, #P < 0.05, indicating a significance; in cells exposed to both toxins in combination with all SeMet and NAC, compared with the group added with SeMet or NAC alone, &P < 0.05, indicating a significant difference. B

DOI: 10.1021/acs.jafc.8b01858 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article


Figure 2. Effects of SeMet and NAC alone or in combination on toxins-induced apoptosis. The total apoptosis rate measured by Annexin V/PI, Hoechst33258 staining, and caspase3 protein expression were processed according to the procedures described in Materials and Methods. All results are expressed as means ± SEM (n = 3). Significance compared with the control group (control group without combined toxins or SeMet or NAC treatment), *P < 0.05; in all combined toxins treated cells, compared with the group without SeMet or NAC, #P < 0.05, indicating a significance; in cells exposed to both toxins in combination with all SeMet and NAC, compared with the group added with SeMet or NAC alone, &P < 0.05, indicating a significant difference. (Bio-Rad, Hercules, CA, United States). Five replicates were executed in every group. The cell viability was calculated. According to the results, the concentration of SeMet and NAC was obtained. Lactate Dehydrogenase Activity. For detecting the release of lactate dehydrogenase (LDH), cells were incubated in 96-well plates. The cell culture medium was gathered into test tubes and centrifuged at 12 000 rpm for 15 min at 4 °C. Supernatants were gathered and stored at −20 °C until analysis. LDH activity was detected by using LDH kits (Jiancheng, Nanjing, Jiangsu, China). Experiments were executed in triplicates. Apoptosis Assay. Cells were cultured in plates with corresponding treatment. After the treatment, the cells were harvested into 1.5 mL tubes. Then cells were stained with Annexin V and propidium iodide (PI). The apoptosis rate was assessed for more than 10 000 cells by flow cytometry (FACS Calibur, BD Biosciences, San Jose, CA, United States). For investigating changes of nuclear chromatin, cells were washed three times with PBS and stained with Hoechst 33258 (1 mg/mL) for 10 min. Lastly, the slides were washed again and scanned with a fluorescence microscope. Cell Phagocytotic Index. To detect the phagocytosis of cells, the medium was removed before 3 h of termination. Cells were washed three times with PBS, and 150 μL of neutral red solution diluted to 0.1% with PBS was supplied into every well. Then, the cells were incubated for 3 h. Then cells were washed with PBS. On the one hand, we detected the phagocytosis of neutral red by light microscopy. On the other hand, we appended lysis buffer 200 μL/well to release the neutral red. We detected the absorbance at 540 nm

using a microplate reader. Five replicates were executed in every group. Determination of Glutathione and Intracellular ROS. For detecting production of GSH, cells were harvested by using 150 μL of PBS and then sonicating the collection (Sonics VCX105). The cell homogenate was centrifuged at 12 000 rpm for 15 min at 4 °C. The supernatant was gathered, and the absorbance was assessed at 405 nm by kits (Jiancheng, Nanjing, Jiangsu, China). To evaluate the intracellular ROS level, cells were cultured on 20 mm round coverslips (WHB, Nanjing, Jiangsu, China) with corresponding treatment in 12-well plates. After the cell culture medium was removed, cells were stained with 2′,7′-dichlorofluorescein diacetate (DCFH-DA; Sigma, St. Louis, MO, United States) for 20 min at 37 °C. Cells were scanned by laser scanning confocal microscopy using a Zeiss LSM 710 META confocal system. Intracellular ROS were marked by green fluorescent light in the microscope. Cytokine mRNA Levels by Real-Time PCR. Cells were incubated in 12-well plates; pretreated with 2 μg/mL lipopolysaccharide (LPS) as a positive control; and were supplemented with toxins, SeMet, and NAC, alone or in combination. Then cells were washed with PBS. Total RNA was extracted to specifications using the RNAiso Plus kit (TaKaRa, Dalian, Liaoning, China). Then, we evaluated the RNA quality by the ratio of OD260/OD280. Expression of genes was evaluated by real-time polymerase chain reaction (PCR) using the ABI Prism Step One Plus detection system (Applied Biosystems, Foster City, CA, United States). A no-template control served as the negative control. The relative mRNA levels of each cytokine were determined using the Δcycle threshold (ΔCt) method, with β-actin serving as the C


Article


Figure 3. Effects of SeMet and NAC alone or in combination on toxins-induced cellular antioxidant capacity. The determination of GSH content (A) and ROS levels (B and C) were processed according to the procedures described in Materials and Methods. All results are expressed as means ± SEM (n = 3). Significance compared with the control group (control group without combined toxins or SeMet or NAC treatment), *P < 0.05; in all combined toxins treated cells, compared with the group without SeMet or NAC, #P < 0.05, indicating a significance; in cells exposed to both toxins in combination with all SeMet and NAC, compared with the group added with SeMet or NAC alone, &P < 0.05, indicating a significant difference. housekeeping gene. Real-time PCR was performed using SYBR Premix Ex TaqII (TaKaRa, Dalian, Liaoning, China) and the ABI 7500 realtime PCR system. The primers used were synthesized by Invitrogen (Paisley, Scotland, UK) (Table 1). Western Blot Analysis. For detecting the expression of proteins, cells were harvested using 60 μL of lysis solution after being washed three times with PBS, and the cell homogenate was sonicated (Sonics VCX105). Then cell homogenate was centrifuged at 12 000 rpm for 15 min at 4 °C. The supernatant was gathered. Concentrations of total protein were assessed by using BCA protein assay kits (Beyotime, Nanjing, Jiangsu, China). Protein (40 μg) was denatured in 5× loading buffer. The polyvinylidene difluoride (PVDF) membranes were incubated at 4 °C overnight and covered with specific primary antibodies (anticleaved-caspase3, anti-p38, anti-p-p38, anti-p-ERK1/2, antiERK1/2, anti-JNK, anti-p-JNK, and anti-β-actin) from Cell Signaling Technology (Danvers, MA, United States). After being washed, the membranes were incubated with horseradish peroxidase-labeled antirabbit secondary antibody. Membranes were visualized and analyzed by a Luminescent Image Analyzer (Fujifilm 171 LAS-4000), and the bands of protein were expressed in percent with respect to the control group. Small Interfering RNA (siRNA) Transfection. The si-p38 (5′-GCAGGAGCUGAACAAGACAtt-3′), si-ERK (5′-CUCCAAAGCUCUGGAUUUAtt-3′), and si-JNK (5′-CCAGUCAGGCAAGAGAUUUtt-3′) were designed by Invitrogen,26 and they were synthesized by Invitrogen. The duplexes were transiently transfected into 3D4/21 cells via liposomes using X-tremeGENE transfection reagent (Roche, Basel, Switzerland). In brief, cells were cultured in 1640 with 10% FBS without antibiotics overnight at 37 °C. Then, siRNAs were introduced according to the manufacturer’s protocol after 30−50% confluence of cells. Cells were incubated in 1640 with 4% FBS for corresponding treatments. Statistical Analysis. The data analyses were performed statistically by using GraphPad Prism (version 5.0, Graph Pad Software Inc.,

San Diego, CA). All statistical analyses were performed with SPSS 17.0. Each experiment was performed at least three times, and the values are presented as mean ± standard error and assessed by using one-way ANOVA. Results were considered to be significant at P < 0.05.

■

RESULTS Cytotoxic Effects of AFB1 and OTA on 3D4/21 Cells. According to Figure 1A, 0.32 μg/mL AFB1 and 1 μg/mL significantly decreased the viability of 3D4/21 cells (P < 0.05). The measured IC50 of AFB1 was 0.8 μg/mL, and the measured IC50 of OTA was 2 μg/mL. In Figure 1B, the percentage of cell viability was down-regulated in a dose-dependent manner. The combination of AFB1 and OTA at 20% concentrations of respective IC50 (the concentration of AFB1 was 0.16 mg/mL and the concentration OTA was 0.4 mg/mL) significantly decreased the cell viability (P < 0.05), and it was chosen for subsequent research. Cytotoxic Effects of SeMet or NAC Alone on 3D4/21 cells. To detect the cytotoxic effects of SeMet or NAC alone on 3D4/21 cells, the cells were incubated with 0, 1, 2, 4, 8, 16, or 32 μM SeMet for 72 h or with 0, 1, 2, 4, 8, 16, or 32 μM NAC for 12 h, supplemented with or without 0.16 μg/mL AFB1 and 0.4 μg/mL OTA in combination for 48 h. Then cell viability and LDH activity were measured. As shown in Figure 1, in the absence of toxin treatment, 4 μM SeMet or 4 μM NAC significantly increased the viability of 3D4/21 cells (P < 0.05). Besides, to determine the cell viability of each combination, cells were coincubated with SeMet and NAC. As shown in Figure 1G,H, we found that the combination of 4 μM SeMet and 4 μM NAC significantly increased cell viability (P < 0.05) and it extremely decreased LDH activity (P < 0.01). In the D


Article


Figure 4. Effects of SeMet and NAC alone or in combination on toxins-induced cellular immunotoxicity. Real-time PCR was used to determine the mRNA expression levels of pro-inflammatory cytokines IL-1a and TNF-a (A) and IL-6 and IL-10 (B). Neutral red phagocytosis assay was used to determine phagocytic function of porcine alveolar macrophages (C and D). All results are expressed as means ± SEM (n = 3). Significance compared with the control group (control group without combined toxins or SeMet or NAC treatment), *P < 0.05; in all combined toxins treated cells, compared with the group without SeMet or NAC, #P < 0.05, indicating a significance; in cells exposed to both toxins in combination with all SeMet and NAC, compared with the group added with SeMet or NAC alone, &P < 0.05 indicating a significant difference.

presence of 0.16 μg/mL AFB1 and 0.4 μg/mL OTA in combination, the viability of cells was significantly reduced and the LDH activity was significantly increased in 3D4/21 cells. These effects of the two toxins were reversed by SeMet and NAC. However, there is a reduction of cell viability with treatment of 8−32 μM SeMet or 8−32 μM NAC in 3D4/21 cells. Therefore, 4 μM SeMet and 4 μM NAC were used in subsequent experiments. Effects of SeMet and NAC Alone or in Combination against Toxins-Induced Cytotoxity. To assess the protective effects of SeMet and NAC alone or in combination against toxins-induced cytotoxity, the cells were cultured with 4 μM SeMet or 4 μM NAC alone and in combination for 12 h and then incubated with or without the joint toxins and SeMet for a further 48 h. As shown in Figure 1, the joint toxins significantly cut down the cell viability (Figure 1I) and triggered the release of LDH (Figure 1J). Compared with the toxins treatment group, SeMet and NAC obviously reversed the toxins-induced changes (P < 0.05). Furthermore, combination of SeMet and NAC exhibited better protection than exclusive usage of SeMet or NAC (P < 0.05). Results indicated that SeMet and NAC

significantly protected cells against toxins-induced cytotoxicity and that the combination of them was better. Effects of SeMet and NAC Alone or in Combination against Toxins-Induced Apoptosis. In addition to cytotoxicity, the protective effects of apoptosis SeMet and NAC alone or in combination against toxins-induced apoptosis were assessed with three methods: Annexin V/PI and Hoechst33258 staining and expression of cleaved caspase 3 by Western blotting. After the corresponding treatment, compared to the control group, the joint toxins group markedly increased apoptosis rate and the expression of cleaved caspase 3 in Figure 2 (P < 0.001). In the control group, the nuclear chromatin was intact while the chromatin of the joint toxins group was marginalized, concentrated, and fractured (Figure 2C). Treatment with SeMet or NAC significantly decreased both apoptotic cell numbers and the expression of cleaved caspase 3. At the same time, the combination of SeMet and NAC was more effective than exclusive usage of them (P < 0.05). These results indicated that SeMet and NAC afforded significant protection against toxins-induced apoptosis and that the combination of them was better. E


Article


Figure 5. Effects of knockdown of p38, ERK, and JNK on toxins-induced toxicities. After the corresponding treatment, real-time PCR, Western blotting, MTT, LDH activities, apoptosis rate, and GSH content were measured. All results are expressed as means ± SEM (n = 3). Significance compared with the control group, * P < 0.05; compared with the group of AFB1 and OTA, #P < 0.05.

Effects of SeMet and NAC Alone or in Combination on Antioxidant Capacity. To detect the protective effects of SeMet and NAC alone or in combination on antioxidant capacity, the production of GSH and ROS in 3D4/21 cells was measured. As indicated in Figure 3, the joint toxins group significantly attenuated the production of GSH and increased ROS levels (P < 0.05). In contrast, supplementing with SeMet or NAC prevented these changes (P < 0.001). At equimolar treatment, the combination of SeMet and NAC was more effective than the separate usage of SeMet or NAC at preserving the levels of GSH and NAC (P < 0.05). The results indicated that supplement of SeMet or NAC enhanced the cellular antioxidant capacity and that the combination of them was more effective. Effects of SeMet and NAC Alone or in Combination against Toxins-Induced Immunotoxicity. In a previous study, we investigated the immunotoxicity of AFB1 and OTA. In order to assess the protective effects of SeMet and NAC alone or in combination against toxins-induced immunotoxicity, the phagocytotic index and the relative inflammatory cytokines’ mRNA levels were measured as demonstrated by engulfing of neutral red solution and real-time PCR. The joint toxins group significantly augmented the release of TNF-α, IL-1α, IL-6, and IL-10 in Figure 4A,B (P < 0.01). Compared to it, SeMet or NAC obviously alleviated the changes induced by the toxins (P < 0.05). At the same time, SeMet or NAC significantly released more IL-10 than that in the joint toxins group in Figure 4B (P < 0.01). As shown in Figure 4C,D, the phagocytotic index was distinctly decreased by the treatment of AFB1 and OTA (P < 0.001). Consistent with the previous results, SeMet or NAC significantly augmented the phagocytosis of 3D4/21 cells compared to the toxins treatment controls. The combination of SeMet and NAC provided more effective protection than each of them (Figure 4). These results indicated that SeMet and

NAC afforded significant protection against toxins-induced immunotoxicity and that the combination of them was better. Effects of Knockdown of p38, ERK, and JNK on Toxins-Induced Toxicities. After the corresponding processing in our study, the results of real-time PCR suggested that knockdown efficiency of p38 was 60%, knockdown efficiency of ERK1/2 was 69%, and knockdown efficiency of JNK was 78%. The results of Western blotting are shown in Figure 5B,C. As shown in Figure 5D−G, ERK-specific siRNA reversed the conditions of cell viability significantly (LDH activity, apoptosis, and oxidative stress induced by AFB1 and OTA in 3D4/21 cells). However, p38-specific siRNA and JNK-specific siRNA had no significant effect on these parameters. It was suggested that it was ERK not p38 or JNK that played a key role in the joint toxicities induced by AFB1 and OTA in 3D4/21 cells. Effects of SeMet and NAC on the Phosphorylations of Different MAPK Pathways. To determine whether the protective effects of SeMet and NAC alone or in combination against toxins-induced cytotoxity were related to the phosphorylations of different MAPK pathways, we investigated the effects of them alone or in combination through Western blotting. After treatment with AFB1 and OTA, activation of p-38, ERK1/2, and JNK was confirmed by a significant increase in phosphoMAPK levels in Figure 6B−D (P < 0.01). Supplement with SeMet or NAC prevented the toxins-induced activation of p-38 and ERK1/2 but up-regulated the phosphorylation of JNK. As shown in Figure 6B−D, the combination of SeMet and NAC was more effective on the phosphorylation of ERK1/2 (P < 0.05). Effects of Anisomycin and Honokiol on the Protection of SeMet and NAC from Toxins-Induced Oxidative Stress and Immunotoxicity. To determine whether p-38, ERK1/2, or JNK played a key role in the protective effects of SeMet and NAC, the 3D4/21 cells were pretreated with F


Article


Figure 6. Effects of SeMet and NAC on phosphorylation of MAPK pathway proteins. After the corresponding treatment, Western blotting was used to determine the expression levels of different proteins in the MAPK signaling pathway. All results are expressed as means ± SEM (n = 3). Significance compared with the control group (control group without combined toxins or SeMet or NAC treatment), *P < 0.05; in all combined toxins treated cells, compared with the group without SeMet or NAC, #P < 0.05, indicating a significance; in cells exposed to both toxins in combination with all SeMet and NAC, compared with the group added with SeMet or NAC alone, &P < 0.05, indicating a significant difference.

induced by traumatic brain injury.33,34 A novel seleniumglutathione-enriched probiotics has been developed, and it can effectively inhibit hepatic oxidative stress, ER stress, inflammation, and activation of the MAPK signaling pathway.35 However, the effects of SeMet and NAC alone or in combination on toxicities induced by combination of AFB1 and OTA have not been reported until now. In addition, 3D4/21 cells (porcine alveolus macrophages) are innate immune cells, and they can excrete cykines. Besides, their changes of immune function can reflect the anti-inflammatory effect of SeMet and NAC. Consequently, we investigated the protective effects of SeMet and NAC against joint toxicities. Our results showed that the joint toxins could induce apoptosis, oxidative stress, and immunotoxicity. SeMet and NAC alone or in combination protected cells against the toxins-induced apoptosis, oxidative stress, and immunotoxicity. Furthermore, SeMet and NAC protected the 3D4/21 cells from that through augmenting the phosphorylations of ERK1/2. Because the co-contamination of AFB1 and OTA has been found to be a worldwide issue, the combination of SeMet and NAC may be an effective therapy to prevent co-contamination of mycotoxins from humans and animals.

anisomycin (an activator of JNK and p-38) and honokiol (an activator of ERK1/2). The usage concentrations of anisomycin and honokiol were cited from reports,27,28 and the use was safe for 3D4/21 cells. After the corresponding treatment, honokiol significantly abated the combinated protective effects of SeMet and NAC in Figure 7 (P < 0.05). However, anisomycin had no significant effect on cell viabilities, LDH activities, GSH contents, and the relative mRNA levels. Compared to the combination of SeMet and NAC, supplement with honokiol up-regulated the activation of ERK1/2 (P < 0.05) in Figure 7. In summary, these results suggested that the combined protective effects of SeMet and NAC were associated with the phosphorylation of ERK1/2 MAPK.

■

DISCUSSION It has been pointed out that FB1, AFB1, and OTA could induce cytotoxicity, oxidative stress, and immunotoxicity.29−32 It has been also known that SeMet as a kind of organic selenium source could alleviate the immunotoxicity induced by malathion in chicks and that NAC as a theoretical basis for the production and application of a strain of S. cerevisiae with high-yield intracellular GSH could protect rats from apoptosis G


Article


Figure 7. Effects of adding MAPK pathway protein activators on the protection of SeMet and NAC. After the corresponding treatment, the cell viability (A), LDH activity (B), GSH content (C), and mRNA expression level of pro-inflammatory cytokines (D−G) after addition of the activators were examined. All results are expressed as means ± SEM (n = 3). Significance compared with the control group (control group without combined toxins or SeMet or NAC treatment), *P < 0.05; in all combined toxins treated cells, compared with the group without SeMet or NAC, #P < 0.05, indicating a significance.

In the present study, it was observed that combination of AFB1 and OTA could induce cytotoxicity, apoptosis, oxidative stress, and immunotoxicity. This was consistent with previous studies.36−38 When Vero cells were exposed to AFB 1 and OTA alone or in combination, cytotoxicity and genetic toxicity were observed.39 It has been proved that the safe concentration of organic selenium was wider than that of inorganic selenium.40

Therefore, we used SeMet and NAC in the present study. Supplement with SeMet and NAC had no toxicity to 3D4/21 cells at the current concentration. Our results showed that SeMet and NAC protected the 3D4/21 cells by increasing the cell viability and decreasing the releasing of LDH. These results suggested that SeMet and NAC afforded significant protection against toxins-induced cytotoxicity. Apoptosis or necrosis could H


Article


OTA-induced immune toxicity in porcine primary splenocytes.54 Nevertheless, it is not clear whether p-38, ERK1/2, or JNK played key roles in the protective effects of SeMet and NAC in the 3D4/21 cells. Our present results investigated whethter AFB1 and OTA induced oxidative stress and immunotoxicity; the combination of SeMet and NAC significantly alleviated them by the phosphorylation of ERK1/2 MAPK not p38 or JNK. This was consistent with previous study that OTA could weakly activate ERK and had no effect on p38 in the human kidney cell line.55 In conclusion, our study suggested that ERK instead of p38 and JNK worked in the protective effects of SeMet and NAC in the 3D4/21 cells. This may be due to the different functions of different MAPK signaling. In summary, our present study suggested that the combination of AFB1 and OTA could induce oxidative stress and immunotoxicity. Moreover, combination of SeMet and NAC mitigated the joint oxidative stress and immunotoxicity of the two toxins by ERK1/2 not p38 or JNK signaling pathway in porcine alveolar macrophages. Our work indicates the combination of SeMet and NAC would be a more effective therapy for AFB1- and OTA-induced oxidative stress and immunotoxicity, and it provided a basis for the application of the novel selenium−glutathione-enriched probiotics.

cause the structure destruction of the cell membrane, which leads to the enzymes of cell plasma being released into the culture, including lactate dehydrogenase. LDH is a good marker of the impairment of the cell membrane. By testing LDH activity which is released from the cell plasma membrane ruptured cell into the culture, we can realize the quantitative analysis of cell toxicity. Therefore, LDH release is to be seen as an important index of the cell membrane integrity and is widely used in cell toxicity tests. It was consistent with previous studies showing that co-incubation with SeMet was effective in reducing methylmercury (MeHg)-induced cytotoxicity in C6-glioma and B35-neuronal cell lines41 and that NAC had protective effects against diquat-induced cytotoxicity in isolated hepatocytes.42 Besides, the combination of them was better in our present study. Annexin V/PI staining was used to evaluate the stage of cell death.43 Caspase3 activation is earlier than cell membrane reverse and DNA fragmentation in the condition of apoptosis which was induced by X-ray in MOLT-4 cells.44 In the present study, nuclear morphology was demonstrated by Hoechst33258 staining, the annexin V/PI staining, and the expression of cleaved caspase3. Our results suggested that SeMet and NAC alone or in combination clearly alleviated the toxins-induced apoptosis in 3D4/21 cells. The potential protective effect of N-acetylcysteine and SeMet on oxidative stress induced by hyperoxia and paraquat in primary cultures of porcine aortic endothelial cells has been reported.45 N-Acetylcysteine and selenium could protect liver and kidney tissue from mercuric chloride-induced oxidative stress in rats.46 In the present study, SeMet and NAC supplemented alone or in combination markedly increased the production of GSH and abated the ROS levels after the treatment with AFB1 and OTA. This was in agreement with the report that SeMet protected the MDCK cells from oxidative stress induced by AFB1 via increasing intracellular GSH level in a dose-dependent manner47 and that NAC could reduce ROS levels induced by HEMA in human primary gingival fibroblasts.48 Our results showed that treatment with SeMet and NAC alone could reverse the releases of IL-1α, TNF-α, and IL-6 induced by the two toxins. In addition, SeMet- and NAC-only treatment obviously enhanced the release of IL-10. The combination of SeMet and NAC was more effective. IL-6, IL-1α, and TNF-α are effective cytokines of inflammation and endothelial functions. In previous studies, SeMet and NAC had a protective effect on the inflammatory process in piglets and male rats.49,50 Phagocytosis of macrophages can be expected to result in internalization and destruction of pathogens in macrophage-mediated host defense. In our study, AFB1 and OTA decreased the phagocytosis of 3D4/21 cells, then supplement with SeMet and NAC significantly reversed the phenomenon. This indicated that immune toxicity induced by a unity of AFB1 and OTA could be protected by SeMet and NAC and that the combination of them was better. Those results showed that joint toxins could induce oxidative stress and immunotoxicity, and the combination of SeMet and NAC alleviated it. However, the mechanism was unclear. The MAPKs play an important role in connecting cellular surface receptors with changes in transcriptional processes. It plays a key role in maintaining of the quiescence of hematopoietic stem cells and in human gastric epithelium cells.51−53 Our previous study indicated that it was p38 taking effect on OTA-induced nephrotoxicity in PK15 cells and ERK taking effect on

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +86-25-84395507. Fax: +86-25-84398669. E-mail: [email protected]. ORCID

Kehe Huang: 0000-0003-4132-3052 Funding

This work was funded by the National Natural Science Foundation of China (31772811, 31602123, 31472253), Natural Science Foundation of Jiangsu Province (BK20160736), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (Jiangsu, China). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED OTA, ochratoxin A; AFB1, aflatoxin B1; SeMet, selenomethionine; NAC, N-acetylcysteine; MTT, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide; LDH, lactate dehydrogenase; GSH, glutathione; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, stress-activated protein kinase c-JUN N-terminal kinase; ROS, reactive oxygen species; IL-1α, interleukin 1α; TNF-α, tumor necrosis factor α; IL-6, interleukin 6; IL-10, interleukin 10; siRNA, small interfering RNA; ANOVA, one-way analysis of variance; SEM, standard error mean

■

REFERENCES

(1) Creppy, E. E. Human Ochratoxicosis. J. Toxicol., Toxin Rev. 1999, 18 (3−4), 277−293. (2) Pitt, J. I. Penicillium viridicatum, Penicillium verrucosum, and production of ochratoxin A. Appl. Environ. Microbiol. 1987, 53 (2), 266−269. (3) Pinotti, L.; Ottoboni, M.; Giromini, C.; et al. Mycotoxin Contamination in the EU Feed Supply Chain: A Focus on Cereal Byproducts. Toxins 2016, 8 (2), 45. (4) Vila-Donat, P.; Marín, S.; Sanchis, V.; et al. A review of the mycotoxin adsorbing agents, with an emphasis on their multi-binding

I


Article

Journal of Agricultural and Food Chemistry capacity, for animal feed decontamination. Food Chem. Toxicol. 2018, 114, 246−259. (5) Wielogórska, E.; Macdonald, S.; Elliott, C. T. A review of the efficacy of mycotoxin detoxifying agents used in feed in light of changing global environment and legislation. World Mycotoxin J. 2016, 9 (3), 419−433. (6) Hou, L.; Gan, F.; Zhou, X.; et al. Immunotoxicity of ochratoxin A and aflatoxin B1 in combination is associated with the nuclear factor kappa B signaling pathway in 3D4/21 cells. Chemosphere 2018, 199, 718−727. (7) Franke, K. W.; Painter, E. P. A study of the toxicity and selenium content of seleniferous diets, with stat-istical consideration. Cereal Chem. 1938, 15, 1−24. (8) Patterson, B. H.; Levander, O. A.; Helzlsouer, K.; et al. Human selenite metabolism: a kinetic model. Am. J. Physiol. 1989, 257 (2), 556−567. (9) Swanson, C. A.; Patterson, B. H.; Levander, O. A.; et al. Human [74Se]selenomethionine metabolism: a kinetic model. Am. J. Clin. Nutr. 1991, 54 (5), 917−926. (10) Peretz, A.; Nève, J.; Desmedt, J.; et al. Lymphocyte response is enhanced by supplementation of elderly subjects with seleniumenriched yeast. Am. J. Clin. Nutr. 1991, 53 (5), 1323−8. (11) Yu, Z.; Wang, F.; Liang, N.; et al. Effect of Selenium Supplementation on Apoptosis and Cell Cycle Blockage of Renal Cells in Broilers Fed a Diet Containing Aflatoxin B 1. Biol. Trace Elem. Res. 2015, 168 (1), 242−251. (12) Shafik, N. M.; Batsh, M M E. Protective Effects of Combined Selenium and Punica granatum, Treatment on Some Inflammatory and Oxidative Stress Markers in Arsenic-Induced Hepatotoxicity in Rats. Biol. Trace Elem. Res. 2016, 169 (1), 121−128. (13) Abul-Hassan, K. S.; Lehnert, B. E.; Guant, L.; et al. Abnormal DNA repair in selenium-treated human cells. Mutat. Res., Genet. Toxicol. Environ. Mutagen. 2004, 565 (1), 45−51. (14) Li, J. L.; Gao, R.; Li, S.; et al. Testicular toxicity induced by dietary cadmium in cocks and ameliorative effect by selenium. BioMetals 2010, 23 (4), 695−705. (15) Ö zgül, C.; Nazıroğlu, M. TRPM2 channel protective properties of N-acetylcysteine on cytosolic glutathione depletion dependent oxidative stress and Ca2+ influx in rat dorsal root ganglion. Physiol. Behav. 2012, 106 (2), 122−128. (16) Nazıroğlu, M.; Ciğ, B.; Ozgül, C. Neuroprotection induced by N-acetylcysteine against cytosolic glutathione depletion-induced Ca2+ influx in dorsal root ganglion neurons of mice: role of TRPV1 channels. Neuroscience 2013, 242 (6), 151−160. (17) Lai, J. T.; Hsieh, W. T.; Fang, H. L.; et al. The protective effects of a fermented substance from Saccharomyces cerevisiae on carbon tetrachloride-induced liver damage in rats. Clin. Nutr. 2009, 28 (3), 338−345. (18) Yeo, J. E.; Kang, S. K. Selenium effectively inhibits ROSmediated apoptotic neural precursor cell death in vitro and in vivo in traumatic brain injury. Biochim. Biophys. Acta, Mol. Basis Dis. 2007, 1772 (11−12), 1199−1210. (19) Chen, G.; Shi, J.; Hu, Z.; et al. Inhibitory Effect on Cerebral Inflammatory Response, following Traumatic Brain Injury in Rats:, A Potential Neuroprotective Mechanism of N-Acetylcysteine. Mediators Inflammation 2008, 2008 (2008), 716458. (20) Nazıroğlu, M.; Senol, N.; Ghazizadeh, V.; et al. Neuroprotection induced by N-acetylcysteine and selenium against traumatic brain injury-induced apoptosis and calcium entry in hippocampus of rat. Cell. Mol. Neurobiol. 2014, 34 (6), 895−903. (21) Geest, C. R.; Coffer, P. J. MAPK signaling pathways in the regulation of hematopoiesis. J. Leukocyte Biol. 2009, 86 (2), 237−50. (22) Lavoie, J. N.; L’Allemain, G.; Brunet, A.; et al. Cyclin D1 Expression Is Regulated Positively by the p42/p44MAPK and Negatively by the p38/HOGMAPK Pathway. J. Biol. Chem. 1996, 271 (34), 20608−20616. (23) Yang, M.; Gao, F.; Liu, H.; et al. Hyperosmotic induction of aquaporin expression in rat astrocytes through a different MAPK pathway. J. Cell. Biochem. 2013, 114 (1), 111−9.

(24) Mu, H.; Wang, X.; Lin, P. H.; et al. Chlorotyrosine promotes human aortic smooth muscle cell migration through increasing superoxide anion production and ERK1/2 activation. Atherosclerosis 2008, 201 (1), 67−75. (25) Parinandi, N. L.; Kleinberg, M. A.; Usatyuk, P. V.; et al. Hyperoxia-induced NAD(P)H oxidase activation and regulation by MAP kinases in human lung endothelial cells. Am. J. Physiol Lung Cell Mol. Physiol 2003, 284 (1), 26−38. (26) Gan, F.; Zhou, Y.; Hou, L.; et al. Ochratoxin A induces nephrotoxicity and immunotoxicity through different MAPK signaling pathways in PK15 cells and porcine primary splenocytes. Chemosphere 2017, 182, 630−637. (27) Monaghan, D.; O’Connell, E.; Cruickshank, F. L.; et al. Inhibition of protein synthesis and JNK activation are not required for cell death induced by anisomycin and anisomycin analogues. Biochem. Biophys. Res. Commun. 2014, 443 (2), 761−767. (28) Zhai, H.; Nakade, K.; Oda, M.; et al. Honokiol-induced neurite outgrowth promotion depends on activation of extracellular signalregulated kinases (ERK1/2). Eur. J. Pharmacol. 2005, 516 (2), 112− 117. (29) Klarić, MŠ; Rumora, L.; Ljubanović, D.; Pepeljnjak, S. Cytotoxicity and apoptosis induced by fumonisin B1, beauvericin and ochratoxin A in porcine kidney PK15 cells: effects of individual and combined treatment. Arch. Toxicol. 2008, 82, 247−255. (30) Costa, S.; Utan, A.; Speroni, E.; Cervellati, R.; Piva, G.; Prandini, A.; et al. Oxidative stress induced by ochratoxin A in LLC-PK1 cell line and the chemoprotective effects of carnosic acid. World Mycotoxin J. 2008, 1, 469−474. (31) Xu, H.; Hao, S.; Gan, F.; et al. In vitro immune toxicity of ochratoxin A in porcine alveolar macrophages: A role for the ROSrelative TLR4/MyD88 signaling pathway. Chem.-Biol. Interact. 2017, 272, 107. (32) Hao, S.; Hu, J. F.; Song, S.; et al. Selenium alleviates Aflatoxin B1-induced Immune toxicity through improving Glutathione Peroxidase 1 and Selenoprotein S Expression in Primary Porcine Splenocytes. J. Agric. Food Chem. 2016, 64 (6), 1385. (33) Sodhi, S.; Sharma, A.; Brar, R. S. A Protective Effect of Vitamin E and Selenium in Ameliorating the Immunotoxicity of Malathion in Chicks. Vet. Res. Commun. 2006, 30 (8), 935−942. (34) Nazıroğlu, M.; Şenol, N.; Ghazizadeh, V.; et al. Neuroprotection Induced by N -acetylcysteine and Selenium Against Traumatic Brain Injury-Induced Apoptosis and Calcium Entry in Hippocampus of Rat. Cell. Mol. Neurobiol. 2014, 34 (6), 895−903. (35) Liu, Y.; Liu, Q.; Hesketh, J.; et al. Protective effects of seleniumglutathione-enriched probiotics on CCl 4 -induced liver fibrosis. J. Nutr. Biochem. 2018, DOI: 10.1016/j.jnutbio.2018.04.011. (36) Liu, B. H.; Yu, F. Y.; Chan, M. H.; et al. The effects of mycotoxins, fumonisin B1 and aflatoxin B1, on primary swine alveolar macrophages. Toxicol. Appl. Pharmacol. 2002, 180 (3), 197−204. (37) Wang, H W; Wang, J Q; Zheng, B Q Cytotoxicity induced by ochratoxin A, zearalenone, and α-zearalenol: effects of individual and combined treatment. Food Chem. Toxicol. 2014, 71, 217−224. (38) Khatoon, A.; Zargham, K. M.; Khan, A.; et al. Amelioration of Ochratoxin A-induced immunotoxic effects by silymarin and Vitamin E in White Leghorn cockerels. J. Immunotoxicol. 2013, 10 (1), 25−31. (39) Gollibennour, E. E.; Kouidhi, B.; Bouslimi, A.; et al. Cytotoxicity and genotoxicity induced by aflatoxin B1, ochratoxin A, and their combination in cultured Vero cells. J. Biochem. Mol. Toxicol. 2010, 24 (1), 42−50. (40) Chen, X.; Ren, F.; Hesketh, J.; Shi, X.; Li, J.; Gan, F.; et al. Selenium blocks porcine circovirus type 2 replication promotion induced by oxidative stress by improving GPx1 expression. Free Radical Biol. Med. 2012, 53, 395−405. (41) Kaur, P.; Evje, L.; Aschner, M.; et al. The in vitro effects of selenomethionine on methylmercury-induced neurotoxicity. Toxicol. In Vitro 2009, 23 (3), 378−385. (42) Cotgreave, I. A.; Sandy, M. S.; Berggren, M.; et al. Nacetylcysteine and glutathione-dependent protective effect of PZ51 J


Article

Journal of Agricultural and Food Chemistry (Ebselen) against diquat-induced cytotoxicity in isolated hepatocytes. Biochem. Pharmacol. 1987, 36 (18), 2899−2904. (43) Hengartner, M. O. The biochemistry of apoptosis. Nature 2000, 407 (6805), 770. (44) Feng, Y. D.; Tao, D. D.; Xie, D. X.; et al. Comparison of Caspase 3 activity, subG1 and Annexin V/PI in detecting apoptosis by flow cytometry. Chin. J. Lab. Med. 2004, 27 (9), 582−585. (45) Junod, A. F.; Jornot, L.; Grichting, G. Comparative study on the selenium- and N-acetylcysteine-related effects on the toxic action of hyperoxia, paraquat and the enzyme reaction hypoxanthine-xanthine oxidase in cultured endothelial cells. Agents Actions 1987, 22 (1−2), 176−183. (46) Joshi, D.; Mittal, D. K.; Shukla, S.; et al. N-acetyl cysteine and selenium protects mercuric chloride-induced oxidative stress and antioxidant defense system in liver and kidney of rats: a histopathological approach. J. Trace Elem. Med. Biol. 2014, 28 (2), 218−226. (47) Parveen, F.; Nizamani, Z. A.; Gan, F.; et al. Protective effect of selenomethionine on aflatoxin B1-induced oxidative stress in MDCK cells. Biol. Trace Elem. Res. 2014, 157 (3), 266−274. (48) Spagnuolo, G.; D’Antò, V.; Cosentino, C.; et al. Effect of Nacetyl-L-cysteine on ROS production and cell death caused by HEMA in human primary gingival fibroblasts. Biomaterials 2006, 27 (9), 1803−1809. (49) Hou, Y.; Wang, L.; Yi, D.; et al. N-acetylcysteine reduces inflammation in the small intestine by regulating redox, EGF and TLR4 signaling. Amino Acids 2013, 45 (3), 513−522. (50) Ansar, S. Effect of Selenium on the Levels of Cytokines and Trace Elements in Toxin-Mediated Oxidative Stress in Male Rats. Biol. Trace Elem. Res. 2016, 169 (1), 129−133. (51) Ito, K.; Hirao, A.; Arai, F.; et al. Reactive oxygen species act through p38 MAPK to limit the lifespan of hematopoietic stem cells. Nat. Med. 2006, 12 (4), 446−451. (52) Jang, Y. Y.; Sharkis, S. J. A low level of reactive oxygen species selects for primitive hematopoietic stem cells that may reside in the low-oxygenic niche. Blood 2007, 110 (8), 3056−3063. (53) Wang, Y.; Liu, J.; Cui, J.; Xing, L.; Wang, J.; Yan, X.; Zhang, X. 2012. ERK and p38 MAPK signaling pathways are involved in ochratoxin A-induced G2 phase arrest in human gastric epithelium cells. Toxicol. Lett. 2012, 209, 186−192. (54) Gan, F.; Zhou, Y.; Hou, L.; et al. Ochratoxin A induces nephrotoxicity and immunotoxicity through different MAPK signaling pathways in PK15 cells and porcine primary splenocytes. Chemosphere 2017, 182, 630−637. (55) Horvath, A.; Upham, B. L.; Ganev, V.; et al. Determination of the epigenetic effects of ochratoxin in a human kidney and a rat liver epithelial cell line. Toxicon 2002, 40 (3), 273−282.

K


Combination of Selenomethionine and N-Acetylcysteine Alleviates the

Recommend Documents