Common Pattern of Gene Expression in Response to Hypoxia or

Mar 9, 2007 - Environmental Science & Technology .... J.M. Pujolar , M. Milan , I.A.M. Marino , F. Capoccioni , E. Ciccotti , C. Belpaire , A. Covaci ...
0 downloads 0 Views 168KB Size
Download PDF
Environ. Sci. Technol. 2007, 41, 3005-3011

Common Pattern of Gene Expression in Response to Hypoxia or Cadmium in the Gills of the European Glass Eel (Anguilla anguilla) FABIEN PIERRON,† M A G A L I E B A U D R I M O N T , * ,† PATRICE GONZALEZ,† JEAN-PAUL BOURDINEAUD,† PIERRE ELIE,‡ AND JEAN-CHARLES MASSABUAU† UMR CNRS 5805 EPOC, team GEMA, Universite´ Bordeaux 1 and CNRS, Place du Dr Peyneau, 33120, Arcachon, France, and Cemagref, Unite´ Ecosyste`mes Estuariens et Poissons Migrateurs Amphihalins, U.R. EPBX, Cemagref, 50 avenue de Verdun, 33612 Cestas, France

European eel (Anguilla anguilla) populations are in decline. Glass eel recruitment has fallen 10-fold since the early 1980s. Estuaries play a fundamental role in the life history of eels because glass eels must pass through them to reach freshwater ecosystems. Unfortunately, because of their geographical position at the upstream basin slopes, estuaries accumulate metals like cadmium and are important sites of hypoxia events. In this context, we studied the effect of the oxygen level on the ventilation of the glass eel. In parallel, glass eels were submitted to different dissolved cadmium concentrations (0, 2, and 10 µg L-1) under two oxygen levels (normoxia Po2 ) 21 kPa and Hypoxia Po2 ) 6 kPa). The expression level of various genes involved in the mitochondrial respiratory chain, in the cellular response to metal and oxidative stresses, was investigated. Our results showed that hypoxia enhances (1) ventilation of the postlarval stage and (2) Cd accumulation in gills only at the lowest metal water concentration tested (2 µg Cd L-1). At the gene level, Cd exposure mimics the effect of hypoxia since we observed a decrease in expression of genes involved in the respiratory chain and in the defense against oxidative stress.

Introduction European eel (Anguilla anguilla) populations are dangerously threatened by extinction (1). Glass eel recruitment is now only one tenth of what it was in the early 1980s throughout the entire European distribution area (2). The glass eel is the postlarval stage of this species and corresponds to the freshwater colonizing stage. The biological cycle of the European eel is complex (3). Reproduction takes place in the Sargasso Sea from where larvae drift back toward the European coasts following oceanic currents. When larvae reach the continental slope, the first metamorphosis occurs, and they become glass eels. The great majority leave the ocean and enter the estuaries. Some of them remain in * Corresponding author phone: +33-0-556-223-927; fax: +330-556-549-383; e-mail: [email protected]. † Universite ´ Bordeaux 1 and CNRS. ‡ Cemagref. 10.1021/es062415b CCC: $37.00 Published on Web 03/09/2007

 2007 American Chemical Society

estuaries; the majority reach freshwater ecosystems like rivers and lakes. Then, glass eels pigment to reach the yellow stage which really corresponds to the growth stage. After a few years, this stage ends with a second metamorphosis (silvering) which prepares fish for their reproductive migration to the Sargasso Sea. So, the estuarine ecosystem plays a fundamental role in the life cycle of the European eel, particularly on glass eel recruitment. Unfortunately, because of their geographical position, estuaries represent a receptacle of pollution from the upstream basin slopes. The Gironde estuary (southwestern France), for example, has been subjected for more than a century to polymetallic contamination and contains particularly high levels of cadmium (Cd) (4-5). It also contains a high concentration of suspended matter like the majority of European estuaries. This strong turbidity involves a decrease in photosynthetic activity and supports a considerable growth of heterotrophic and aerobic bacteria which generate an oxygen deficit in the water (6-7). Glass eels could then be occasionally subjected to hypoxia events of close to 30% saturation (Po2 ) 6 kPa). In this context, we investigated the effect of the oxygenation level on the ventilatory activity of the glass eel. To investigate the effect of hypoxia on cadmium bioaccumulation and their impacts on gene expression, glass eels were subjected in parallel to different dissolved cadmium concentrations ([Cd]w ) 0, 2, and 10 µg L-1) representative of field exposure (8) under two oxygen levels (normoxia Po2 ) 21 kPa and hypoxia Po2 ) 6 kPa). Gills were selected for analysis because they are (1) the main site of gas exchanges in eels, (2) the main site of osmoregulation processes, and (3) the organ at the interface with the contaminated water and are thus the tissue from which the metal loading of the organism will proceed. Hypoxia or Cd impacts were evaluated by studying the expression level of various genes involved in the mitochondrial respiratory chain and in the cellular response to oxidative and metal stresses. Indeed, recent studies have shown that the metabolic response to hypoxia proceeds not only by increasing erythropoietin and angiogenic compounds (9) but also by reducing the activity of the major cellular oxygen consumer, the mitochondria (10). However, the glass eel stage implies a physiological transition from seawater to freshwater osmoregulation process which makes considerable energy demands. Moreover, Cd exposure is likely to trigger detoxification mechanisms which also require energy. Therefore, we investigated the expression levels of various mitochondrial genes involved in the respiratory chain which is the main site of ATP production in cells: NADH dehydrogenase subunit 5 (nd5), cytochrome C oxidase subunit 1 (cox1), ATP synthase subunit 6-8 (atp6-8), and cytochrome C (cytc). Moreover, it is now well-established that exposure to hypoxia as well as Cd involves an increase in reactive oxygen species (ROS) production in cells (11-14). Thus, to evaluate the defense capacity of the postlarval stage against this ROS increase, we also studied the expression levels of two genes involved in the oxidative stress response: the mitochondrial superoxide dismutase (sod2) and the catalase (cat) genes. Finally, the expression level of another gene which is involved in metal sequestration, the metallothionein (mt) gene, was investigated. Although the sequences of genes encoding mitochondrial proteins are known, cDNA sequences of the mitochondrial superoxide dismutase, the catalase, the metallothionein, and the β-actin had to first be cloned and sequenced until their expression levels were analyzed by quantitative real-time PCR. VOL. 41, NO. 8, 2007 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

3005

FIGURE 1. Experimental setup for ventilatory analysis by video. One glass eel was put in a miniaquarium. It was crossed by an infrared beam. Using a camera equipped with a zoom and connected to a monitor, opercular movements were observed in real time. On the screen, activity was measured with a photosensitive cell connected to an instantaneous frequency meter (see text for more details).

Materials and Methods Animals. During these experiments, around 200 European glass eels (6.2 ( 0.2 cm in length and 0.24 ( 0.03 g in weight, mean ( SE, n ) 10) were caught at Moliets by professional fishermen (Aquitaine region, France). Before the experiments, they were kept in large tanks (volume: 200 L) filled with aerated brackish water (salinity 0.2 ‰). At this stage of development, glass eels do not eat. So, over the one week maintenance period allowing acclimation and during the experiment, the glass eels were not fed. Ventilatory Analysis by Video. Glass eel ventilatory activity was analyzed under various steady water Po2 conditions at 13 °C by visual inspection (Figure 1) (15). A small aquarium (volume 50 mL), containing only one glass eel, was assembled on an antivibrating bench to isolate the animal from sources of vibrations which can erratically modify their ventilatory activity (16). For the same reason, the experimental device was covered with an opaque plastic film and the aquarium was submitted to a subdued light of constant intensity. The miniaquarium was placed in a 1-L closed recirculatory system with constant entry and exit levels. Temperature was maintained at 13 ( 0.1 °C. During the experiments, Po2 varied from 4 to 21 kPa. Hypoxia was obtained by bubbling a N2/O2/CO2 gas mixture via mass flow controllers (Tylan General, model FC-260; San Diego, CA). The CO2 partial pressure was maintained at 0.1 kPa, a typical value of water Pco2 in air-equilibrated environments. Data acquisition, namely, the frequency of opercular movements, was based on the transparency of the glass eel. The aquarium was crossed by an infrared beam and a camera (Watec, model Wat-902H; Tokyo, Japan) equipped with a zoom (Computar, model MLH-10X; Tokyo, Japan) and was connected to a Sony TV monitor (HR Trinitron PVM 1453MD; Tokyo, Japan) which enabled us to observe opercular movements in real time. On the screen, a photosensitive cell connected to a laboratoryconstructed instantaneous frequency meter made it possible to acquire the frequency instantaneously. After one night of adaptation to the experimental conditions in normoxia, each animal was exposed to four plateau levels of different water Po2 presented in the following order: 21, 10, 6, and 4 kPa. The exposure duration was 2 h per oxygen level. Ventilatory frequency (Hz) was measured during the 3006

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 41, NO. 8, 2007

last 30 min of exposure. Under each experimental condition, measurements were performed on five individuals. Cadmium Accumulation under Various Oxygen Levels and Water Cadmium Concentrations. This experiment was performed on acclimated glass eels placed in a flow-through system consisting of six separate 9-L experimental units (EUs). Tanks were put on antivibrating benches and were subjected to light of constant intensity, fixed at 13 h light per day. Each tank was supplied with artificial brackish water (salinity 0.2 ‰) from a 300-L reservoir at a rate of 500 mL h-1 by six water flowmeters. This water was prepared from a stock solution mimicking seawater as described by Ringer: NaCl 400.9 mM; KCl 9.79 mM; CaCl2, 2H2O 10.12 mM; MgCl2, 6H2O 52.63 mM; Na2SO4 27.83 mM; NaHCO3 2.5 mM; and NaBr, 2H2O 0.58 mM with a resulting salinity S ) 33.6‰ (17). With these physicochemical conditions, Cd was mainly under the form of the free Cd2+ ion. Each EU contained 30 glass eels, and six experimental conditions were applied, combining two oxygen levels (normoxia Po2 ) 21 kPa and hypoxia Po2 ) 6 kPa) and three cadmium concentrations (0, 2, and 10 µg L-1 corresponding to 0, 17, and 86 nM, respectively). Metal exposure was initiated by adding CdCl2 from two stock solutions of 40 and 200 µg L-1 for Cd exposure at 2 and 10 µg L-1, respectively. To maintain Cd contamination over time, each tank was equipped with a peristaltic pump (Gilson Miniplus2; Villier-le-Bel, France) which added Cd at the desired concentration at a rate of 25 mL h-1. During the experiment, the water column was permanently controlled for temperature (12.5 ( 0.5 °C), pH (8.25 ( 0.11), and oxygenation levels (normoxia Po2 ) 21 kPa and hypoxia Po2 ) 6 kPa; [O2] ≈ 10.5 and 3 mg L-1, respectively, at 13 °C). Water samples were collected daily and were checked for Cd concentration. Flows were adjusted if necessary. The average concentrations were 0.02 ( 0.01 µg L-1, 2.07 ( 0.27 µg L-1, and 9.69 ( 0.83 µg L-1 (mean ( SE, n ) 28). After 14 days of exposure, the glass eels were removed and were immediately stored at -80 °C until they were dissected on ice under binocular microscope for Cd determination and genetic analyses. Metal Determination. After dissection, five gill samples per experimental condition were dried (48 h at 45 °C) and then were treated with 200 µL of pure nitric acid (Fluka; Buchs, Switzerland) in Teflon tubes at 100 °C for 3 h. After a 6-fold dilution of the digestates with ultrapure water (MilliQ, Bedford; MA), Cd concentrations were determined by electrothermic atomic absorption spectrophotometry with Zeeman correction, using a graphite furnace tube (EAAS Thermoptec M6Solaar). Samples of 20 µL were mixed before atomization with 4 µg of Pd (analyte modifier) and 3 µg of Mg(NO3)2 (matrix modifier). The detection limit was 0.1 µg L-1 Cd. All metal concentrations were expressed as ng g-1 of dry weight tissue (dw). The validity of the method was checked periodically by measurements of certified biological reference materials (Tort-2, lobster hepatopancreas, and Dolt-2, dogfish liver, from NRCCC-CNRC; Ottawa, Canada). Values were consistently within the certified ranges (data not shown). For Cd determination in experimental units, water samples were diluted, were acidified at 2% HNO3, and were mixed with Pd and Mg(NO3)2. Cloning and Sequencing of β-Actin, Metallothionein, Catalase, and Mitochondrial Superoxyde Dismutase cDNA. Total RNAs were extracted from 40 mg of fresh liver (wild organism from unpolluted site) using the Absolutely Total RNA Miniprep kit (Stratagene, Netherlands) according to the manufacturer’s instructions. RNAs’ quality was evaluated by electrophoresis on a 1% agarose gel and their concentrations were determined by spectrophotometry. First-strand cDNA was synthesized from 5 µg of total RNA using the Stratascript First-Strand Synthesis System (Stratagene, Netherlands)

TABLE 1. Sequence of Primer Pairs Used to Clone β-Actin, Metallothionein, Catalase, and Mitochondrial Superoxyde Dismutase cDNA gene name

unspecific primers (5′-3′) CCCTGGAGAAGAGCTACGAGCTGC GCCAGGATGGAGCCTCCGATCCb CAGCCAGAGGCGCACTTGCTGa CCAAGACTGGAGCTTGCAACTGb ATCCCAGAGAGAGTGGTGCATGa AGTCTTGTAGTGGAACTTGCAGb GCCATTAAGCGTGACTTTGGCTCa GTCCGGTCTAACATTCTTGTACTGb

β-actin

mt cat sod2

specific primers (5′-3′) for race Ca CAGCCAGAGGCGCACTTGCTGCAGGc CGTCTGCAAAGGCAAAACCTGCGd TAGACAGGGTGGCCCTCAGCGTTGACCc GGAGAGGAATAAGACCTGTGGTTc AGAAGCTGAGGGAGAAGATGTCCATGGd

a Forward primer. b Reverse primer. c Primer used for 5′ race with the supplied adapter specific primer. d Primer used for 3′ race with the supplied adapter specific primer.

TABLE 2. Accession Number and Specific Primer Pairs for the Eight Genes from A. anguilla Used in Quantitative PCR Analysis gene name

accession number

specific primers (5′-3′)

β-actin DQ493907 CAGCCTTCCTTCCTGGGTa AGTATTTGCGCTCGGGTGb mt DQ493910 TGCACTACGTGTAAGAAAAGCTGa ACACATACAATAAACCCAACACAAATGAb cat DQ493908 AGCAACCGATCAAATGAAATTATGGa CAGCTCCCTTGGCGTGb sod2 DQ493909 AGAAGCTGAGGGAGAAGATGTa GGAGAGGAATAAGACCTGTGGTTb cox1 NC006531 TAGAGGCCGGAGCTGGa GGGGAGTTTGGTACTGTGTAATb atp6-8 NC006531 GCAGTCCCACTATGACTAGCCa GGCCTGCTGTCAGGTTTGb cytc NC006531 GTTGCTGGAGCCACAATACTa CCAAGCAGGTTCGGGTAGAb nd5 NC006531 CCTCTGTTCAGGCTCCATa GGGCTCAGGCGTTAAGGTAb a

Forward primer.

b

Reverse primer.

according to the manufacturer’s instructions. To obtain a partial coding sequence of β-actin, metallothionein, catalase, and mitochondrial superoxyde dismutase, oligonucleotide primers (Table 1) were deduced from alignment (using Clustalw software, Infobiogen) of corresponding sequences available in libraries from different fish species and were used in PCR experiments (50 amplification cycles at 95 °C for 1 min, 48 °C for 1 min, and 72 °C for 1 min). Amplified products of expected size were then cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, A1360, Madison, United States) and were sequenced (Millegen Biotechnologies, France). On the basis of the resulting sequence information, the 5′ and 3′ ends of mt and sod2 cDNAs and the 5′ end of cat cDNA were amplified using BD Smart Race cDNA amplification Kit (Clontech, CA). RT-PCR was carried out on purified Poly (A+) RNA using gene-specific primer for each sequence (Table 1) and with the supplied adapter specific primers as detailed by the manufacturer’s instructions. The amplified products were cloned and sequenced as previously described. Quantitative RT-PCR. Twenty-four individuals were dissected per experimental condition and eight pairs of gills were pooled to obtain a sufficient amount of RNAs and three independent replicates (n ) 3 pools × 8 individuals/pool ) 24 individuals). For each gene, specific primers were determined (Table 2) using the Light-Cycler probe design software (version 1.0, Roche). After extraction and reverse transcription (see above), amplification of cDNA was monitored using the DNA intercalating dye SyberGreen I. Real-time PCR reactions were performed in a Light-Cycler (Roche, Switzerland) following the manufacturer’s instructions (one cycle at 95 °C

FIGURE 2. Change in ventilatory frequency (mean ( SE, n ) 5) of European glass eel as function of oxygen level (Po2 ) 21, 10, 6, and 4 kPa). Means designated with different letters (a, b, c, d) are significantly different (Kruskal-Wallis ANOVA, P < 0.05). for 10 min and 50 amplification cycles at 95 °C for 5 s, 60 °C for 5 s, and 72 °C for 20 s). The reaction specificity was determined for each reaction from the dissociation curve of the PCR product. It was obtained by following the SyberGreen fluorescence level during a gradual heating of the PCR products from 60 to 95 °C. The relative quantification of each gene expression level was normalized according to the β-actin gene expression. In this way, for each gene expression level, the mean value and the associated standard deviation (n ) 3) were determined. From this comparison, fold-change factors were obtained for each gene by comparing each mean value observed in the contaminated or hypoxic water with that of the corresponding control water. To study the effect of hypoxia, gene expressions in hypoxic animals were compared to those of normoxic animals. In the same way, Cd effect under normoxia was obtained by comparing contaminated normoxic animals to untreated normoxic animals. The Cd effect under hypoxia was obtained by comparing contaminated hypoxic animals to untreated hypoxic animals. Data Treatment. The data were analyzed by nonparametric Kruskal-Wallis ANOVA and U Mann-Whitney test with the Statistica 5.0 programs. For all the statistical results, a probability of P < 0.05 was considered significant.

Results Ventilatory Analysis by Video. An oxygen deficit in the water triggered a significant increase in ventilatory frequency even at a Po2 value of 10 kPa (oxygen saturation ) 47.6%) (Figure 2). Ventilatory frequency increased from 0.46 Hz under normoxia to 1.11 Hz at 6 kPa. To explore the potential effect of Cd on the ventilatory activity of the glass eels, some individuals (n ) 5) were exposed to increasing Cd concentrations ([Cd]w ) 0, 2, and 10 µg‚L-1) in normoxic (Po2 ) 21 kPa) and hypoxic (Po2 ) 6 kPa) conditions. No significant differences were observed compared with uncontaminated conditions after 2 h of exposure (data not shown). Because VOL. 41, NO. 8, 2007 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

3007

TABLE 3. Basal Expression (Mean ( SE, n ) 3) as Compared to β-Actin in Gills from Normoxic and Hypoxic Control Glass Eels function mitochondrial metabolism

oxidative stress detoxication process

FIGURE 3. Cadmium concentrations (mean ( SE, n ) 5) in gills of exposed ([Cd]w ) 2 and 10 µg‚L-1) and nonexposed glass eels A. anguilla under two oxygen levels (normoxia Po2 ) 21 kPa and hypoxia Po2 ) 6 kPa) after 14 days of exposure. Means designated with different letters (a, b, c, d) are significantly different (KruskalWallis ANOVA, P < 0.05). glass eel is a quick transition phase between larva and elver which can be captured only once a year, it was not possible to study this potential effect for a two-week period. Our results do not therefore allow us to rule out any effect of Cd on glass eel ventilation for a much longer exposure time. Cadmium Bioaccumulation under Two Oxygen Levels and Three Water Cadmium Concentrations. Cadmium concentrations in the gills of glass eels exposed to different oxygen (Po2 ) 21 and 6 kPa) and cadmium ([Cd]w ) 0, 2, and 10 µg L-1) levels for 14 days are reported in Figure 3. Cd concentrations in the uncontaminated individuals showed no differences according to oxygen level. Results highlighted a significant effect of hypoxia on Cd bioaccumulation only for a water Cd concentration of 2 µg L-1. At this exposure level, Cd concentration in hypoxia was 39% higher than the concentration measured in normoxic conditions. Cloning and Sequencing of β-Actin, Metallothionein, Catalase, and Mitochondrial Superoxide Dismutase cDNA. A partial β-actin cDNA of 290 bp was amplified and sequenced. The resulting partial protein (96 amino acids (aa)) sequence was compared with the Genebank database using BLASTX program, and the most significant alignments were found to correspond to β-actin protein from fish (Cyprinus carpio and Danio rerio: 100% identity, 100% similarity). For metallothionein, the entire cDNA was obtained (449 bp), coding for a 59 aa-long protein. This sequence showed extensive identities with corresponding proteins from fish (Thermarces cerberus: 84% identity, 89% homology; Oreochromis mossambicus: 81% identity, 86% homology). In the case of catalase, a partial cDNA containing the 5′-cDNA ends was amplified and sequenced (779 bp, 229 aa). As detailed for β-actin, the most significant alignments correspond to catalase protein from fish (Danio rerio: 90% identity, 95% homology; Oplegnathus fasciatus: 92% identity, 96% homology). The entire cDNA of the mitochondrial superoxide dismutase (1078 bp) encodes for a 220 aa-long protein. This protein sequence presents the highest identity score with mitochondrial superoxide dismutase from fish (Epinephelus coioides and Danio rerio: 85% identity, 92% similarity). Gene Expressions under Two Oxygen Levels and Three Water Cadmium Concentrations. The results obtained by quantitative real-time PCR in gills of glass eels after two weeks of Cd exposure under two oxygen levels are presented in Tables 3-5. 3008

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 41, NO. 8, 2007

genes

normoxic

hypoxic

cox1

77 ( 18

14 ( 0.7

114 ( 26 94 ( 33 92 ( 29 0.008 ( 0.004 8(5 0.01 ( 0.005

10 ( 3 5(1 0.8 ( 0.1 0.0008 ( 0.0002 0.014 ( 0.0002 0.02 ( 0.008

atp6-8 cytc nd5 sod2 cat mt

TABLE 4. Significant Variations in Gene Expression as Compared to Normoxic Control in Gills of Glass Eels after 14 Days of Hypoxia (Po2 ) 6 kPa) or Dissolved Cd Exposure (2 µg L-1 and 10 µg L-1)a Cd effect under normoxia hypoxia genes effect

2 µg L-1

10 µg L-1

-5.2

-3.5

-5.6

atp6-8 -11.9 cytc -18.3 nd5 -110.7 oxidative stress sod2 -9.4 cat -287.4 detoxication process mt +2

-4.6 -7.4 -34 -5.1 -24.9 +3.8

-4.5 -10.1 -31.9 -3 -99.9 +2.4

function mitochondrial metabolism

cox1

a Significant fold-change factors, i.e., induction or repression factors (U Mann-Whitney, P < 0.05) are indicated by positive (+) and negative (-) values, respectively. /: not statistically significant.

TABLE 5. Significant Variations in Gene Expression as Compared to Hypoxic Control in Gills of Glass Eels after 14 Days of Hypoxia (Po2 ) 6 kPa) and Dissolved Cd Exposure (2 µg L-1 and 10 µg L-1)a Cd effect under hypoxia function

genes

2 µg L-1

10 µg L-1

mitochondrial metabolism

cox1 atp6-8 cytc nd5 sod2 cat mt

/ +2.2 / / / / +2

/ +2.9 / / / / +2.2

oxidative stress detoxication process

a Significant induction factors (U Mann-Whitney, P < 0.05) are indicated by positive (+) values. /: not statistically significant.

Hypoxia triggered a decrease in expression of all genes implicated in the respiratory chain with the most significant effect for the NADH dehydrogenase subunit 5 whose product is implicated in the first complex of the respiratory chain. Exposure to hypoxia also triggered a decrease in expression of genes implicated in oxidative stress defenses with the most important effect on catalase gene expression. Finally, hypoxia triggered an induction of the gene encoding the metallothionein (2-fold increase). The same trend was observed after exposure to Cd in normoxia. Indeed, the metal triggered a decrease in expression of all genes involved in the respiratory chain. Once again, the most important effect concerned the expression of the NADH dehydrogenase subunit 5. Moreover, it is significant to note that the effect on the NADH dehydrogenase expression was independent of metal water concentrations. Indeed, the repression factor reached 34 and 32 for 2 and 10 µg L-1,

respectively. As observed for hypoxic conditions, exposure to Cd under normoxia also triggered a repression of genes involved in the oxidative stress defenses with again the most important effect on the catalase gene expression level. Finally, like hypoxia, Cd exposure under normoxia triggered an induction of the metallothionein gene. The effect of Cd under hypoxia appeared to be less than that observed under normoxic conditions. Only two genes were upregulated because of hypoxic Cd exposure: the ATP synthase and the metallothionein, with low induction factors. Once again, we observed no effect of the Cd concentration although hypoxia was associated with a greater Cd bioaccumulation at the lowest metal water concentration tested (2 µg L-1).

Discussion Few studies have investigated the effect of hypoxia on metal bioaccumulation (18-21) while numerous studies of respiratory physiology have demonstrated the major role of O2 as a ventilatory drive in aquatic animals (22-23). Indeed, it is now well-known that ventilation in fish, crustaceans, and molluscs is strongly stimulated by low oxygen levels resulting in a higher water flow on the gill epithelium. In the case of Cd, it has been shown that hypoxia triggered a greater Cd bioaccumulation in the bivalve Corbicula fluminea (20), but such a relation was not observed in the case of the fish Cyprinus carpio (21). The relationship is not clear and present results show that hypoxia increases Cd bioaccumulation capacity in the gills only at the lowest tested concentration ([Cd]w ) 2 µg L-1). With regard to the study undertaken in carp, fish were exposed to a nominal Cd concentration of 0.75 µg L-1 at a Po2 of 5.25 kPa. The increase in the ventilatory frequency of carp when Po2 decreases from 21 to 5.25 kPa reaches 48% whereas it increased by 142% in glass eel when Po2 decreased from 21 to 6 kPa. The hyperventilation generated by hypoxia appears to be lower in the common carp compared with the glass eel. This could be explained by a ventilation rate that is already higher in carp than in glass eels under normoxic conditions, at 144 and 29 opercular movements per minute, respectively. Three main factors can explain this difference: (1) temperatures retained for the experiments: 13 °C in our experiments and 24-26 °C for carp, (2) the weight of the animals: 2.5 ( 0.5 g for carp and 0.24 ( 0.03 g for glass eels, and (3) in the case of glass eels, individuals were not fed during experiments whereas the carp were fed every day at a rate of 2% of their weight. It suggests that carp have a greater metabolism and O2 consumption under normoxia. The lowest amplification of ventilation under hypoxia could account for the absence of hypoxia effect on Cd bioaccumulation in the common carp at low dissolved metal concentrations. Another interesting point of our results is the absence of hypoxia effect on Cd accumulation at the highest Cd water concentration tested ([Cd]w ) 10 µg L-1). It could be hypothesized that high Cd concentration in water outdoes the hypoxia effect on metal accumulation by increasing the occurrence of interactions between Cd and conveyors located in the gill epithelium. An alternative explanation could be that the maximum of Cd gill accumulation was reached after two weeks of exposure to the highest metal concentration. Consequently, the hypoxia effect must not be observed. At the gene level, our results show that hypoxia involved a repression of mitochondrial genes implicated in the respiratory chain. Those results are in agreement with metabolic investigations available in the literature. In fact, Papandreou et al. (10) suggest that metabolic response to hypoxia proceeds not only by increasing erythropoietin and angiogenic compounds (9) but also by reducing the activity of the major cellular consumer of oxygen, the mitochondria. This assumption was based on experiments using wild-type

murine fibroblast. Results showed that hypoxia actively represses mitochondrial function and consequently oxygen consumption. Interestingly, we also observed a decrease in the expression of genes encoding proteins involved in defense against oxidative stress: the mitochondrial superoxide dismutase (sod2) and the cytoplasmic catalase (cat). SOD2 is responsible, in the mitochondria, for the breakdown of radical anion superoxide into hydrogen peroxide (H2O2). CAT converts hydrogen peroxide into O2 and water. We can add that the downregulation of these two genes was unequal with a repression factor of 9 for sod2 against 287 in the case of cat. It is now well-established that expression of these genes are controlled by the oxidative state of the cell, as their expression levels increase when reactive oxygen species (ROS) production increases (24). So, our results tend to show that ROS production in eels decreases under hypoxia. Several authors, on the contrary, have described an increase in ROS generation in cells under hypoxic conditions (11, 12, 14). However, the molecular basis by which low oxygen concentration involves an increase in ROS production is still unknown. ROS generation under hypoxic conditions stabilizes the transcriptional factor HIF-1R: hypoxia-inducible factor 1R (25). HIF-1R is the major regulator of cellular response to hypoxia. While HIF-1R is accumulated in cells under hypoxia, it is degraded under normoxia (26). Brunelle et al. (27), using human lung epithelial A549 cells placed in hypoxia and individually infected with an adenovirus containing cytosolic sod, mitochondrial sod, glutathione peroxidase 1, and cat, demonstrated that HIF-1R stabilization requires H2O2 and not the superoxide anion. These observations tend to show that ROS production under hypoxia plays an active part in the adaptive response to low oxygen pressure. The repression of sod2 and especially cat that we observed could contribute to the increase in ROS production, especially H2O2, in cells under hypoxia. However, these repressions cannot alone explain the potential increase in ROS since changes in levels of a particular protein in fish usually occur in the time scale of several days, whereas increased ROS generation occurs within seconds of onset of hypoxia. Moreover, our results have shown that hypoxia triggered an induction of the gene encoding the metallothionein (MT). This result is consistent with a previous report showing that at the transcriptional level hypoxia activates the major isoforms of the human and mouse MTs (hMT-IIA and mMTI, respectively). This induction is partly dependent on the activation of the metal transcription factor 1 and proceeds through metal response elements (MREs) located in the proximal regions of MT genes (28). Another interesting point of our results is the fact that exposure to cadmium under normoxia mimics the effect of hypoxia. In fact, as in hypoxia, exposure to Cd led to a repression of genes encoding for proteins involved in the respiratory chain and in the defense against oxidative stress. By comparison, the same Cd exposure conditions ([Cd]w ) 2 and 10 µg L-1) have no effect or, on the contrary, stimulate the expression of sod2, cox1, and cytc in the gills of the zebrafish Danio rerio after 7 and 14 days of contamination (29). For example, after 7 days of exposure, sod2 expression was not affected at [Cd]w ) 2 µg L-1 but increased 4-fold at [Cd]w ) 10 µg L-1. At the same time, cox1 increased 4- and 32-fold and cytc increased 2- and 64-fold for [Cd]w ) 2 and 10 µg L-1, respectively. Gene regulation by Cd appears to be very different between the two species. Interestingly, when Danio rerio is exposed to 24 h of hypoxia (Po2 ) 5 kPa), sod2 expression in gills, as in our experiments, is downregulated (13-fold less expressed, unpublished data from an experiment carried out at the laboratory). It reinforces the fact that Cd mimics the effect of low oxygen concentration in gills of glass eels. Moreover, the repression of sod2 and cat in glass eel gills exposed to Cd is not intuitive because it is wellVOL. 41, NO. 8, 2007 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

3009

established that (1) Cd induces oxidative stress in cells (13) and that (2) their expression is upregulated by ROS (24). The question is, how can cadmium mimic hypoxia cell response? In the literature, several authors have already demonstrated the capacity of some metal ions such as As(III), Cu(II), Zn(II), V(V), Co(II), Mn(II), and Ni(II) to mimic a hypoxia cell response in mammalian cells under normal oxygen tension (30-35). The mechanism for the significant stabilization and elevation of HIF-1R involves a loss of cellular Fe as well as inhibition of HIF-1R dependent prolyl hydroxylase. Prolyl hydroxylase enzymes use oxygen as a substrate and iron as a cofactor. They catalyze the hydroxylation of HIF-1R involving its degradation by the proteosome. Thus, hypoxia diminishes the catalytic activity of prolyl hydroxylases, resulting in HIF1-R protein accumulation and subsequent activation of target genes. However, in the case of Cd, it was found that this metal not only failed to disturb cellular Fe homoeostasis but also failed to stabilize HIF1-R in human lung carcinoma A549 cells (35). It would be interesting to investigate the capacity of Cd to induce iron depletion in the gills of the glass eel or to poison prolyl hydroxylases by replacing iron. Nevertheless, a further assumption could be brought by histological investigations. Gony et al. (36) have shown that exposure to dissolved Cd at 5 µg L-1 over 34 days induces a vacuolization of primary epithelium cells, surface deposits, and necrosis in gills of yellow eels. These observations tend to show that Cd exposure leads to an increase in the gill epithelium thickness which might impede gas exchange leading to tissue hypoxia. Van Heerden et al. (37) found an increase in mean arithmetic distance between water and blood in the gills of rainbow trout when exposed to 1.65 µM of waterborne copper. Lappivaara et al. (38) found a decrease in the relative diffusion capacity and arterial oxygen tension of Oncorhynchus. mykiss when exposed to 4 mg L-1 of zinc. So, the mechanism by which Cd can mimic hypoxia in the gills of glass eels could have several origins and needs further investigations. Final consideration is with regard to the effect of the coexposure to hypoxia and Cd. Our results tend to show that these two factors do not have a synergistic effect on gene expression levels. Only atp6-8 and mt were slightly upregulated by Cd notably because MTs are not only induced by hypoxia but also by Cd notably via the activation of the metal transcription factor 1 (39). These results suggest that Cd and hypoxia involve a similar cell response. Cd strongly mimics the effect of hypoxia. The fact that Cd mimics the effect of hypoxia could have several consequences for glass eels. Response to Cd induces a repression of genes encoding for proteins involved in defense against ROS although it is well-known that Cd generates oxidative stress in cells. Except for mt, gene regulation by Cd does not seem to involve an efficient response to fight against metal stress. In this context, hypoxia appears to be an aggravating factor. In fact, hypoxia induces a stronger decrease in antioxidant enzymes expression than Cd. Moreover, coexposure to Cd and hypoxia does not trigger a significant upregulation of theses genes. Thus, coexposure to Cd and hypoxia could lead to severe impairments in gill functions.

Acknowledgments We wish to thank Dr. R. Maury-Brachet and B. Etcheberria for their help and technical assistance in all aspects of this study. Pr. A. Boudou is thanked for commenting upon experimental protocols. Fabien Pierron was supported by a grant from the French Ministry of Research.

Literature Cited (1) Moriarty, C.; Dekker, W. Management of the European eel. Fish. Bull. 1997, 15, 109 p. 3010

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 41, NO. 8, 2007

(2) Castelnaud, G.; Guerault, D.; Desaunay, Y.; Elie, P. Production et abondance de la civelle en France au de´but des anne´es 90. Bull. Fr. Peˆche Pisci. 1994, 335, 263-287. (3) Tesch, F. W. The eel, 5th ed.; Blackwell Publishing: Oxford, UK, 2003. (4) Baudrimont, M.; Scha¨efer, J.; Marie, V.; Maury-Brachet, R.; Bossy, C.; Boudou, A.; Blanc, G. Geochemical survey and metal bioaccumulation of three bivalve species (Crassostrea gigas, Cerastoderma edule and Ruditapes philippinarum) in the Nord Me´doc salt marshes (Gironde estuary, France). Sci. Total Environ. 2005, 337, 265-280. (5) Audry, S.; Blanc, G.; Scha¨fer, J. Cadmium transport in the LotGaronne River system (France) - temporal variability and a model for flux estimation. Sci. Total Environ. 2004, 319, 197213. (6) Abril, G.; Etcheber, H.; Le Hir, P.; Bassoulet, P.; Boutier, B.; Franquignoule, M. Oxic/anoxic organic carbon mineralisation in an estuarine maximum turbidity zone (the Gironde, France). Limnol. Oceanogr. 1999, 44, 1304-1305. (7) Irigoien, X.; Post, J.; Castel, J.; Pfeiffer, K. F.; Hellmann, B. Nycthemeral variations of the dissolved oxygen concentration in the turbidity maximum of three European estuaries: biological vs. physical processes. J. Mar. Syst. 1999, 22, 173-177. (8) Andre`s, S.; Ribeyre, F.; Tourencq, J.-N.; Boudou, A. Interspecific comparison of cadmium and zinc contamination in the organs of four fish species along a polymetallic gradient (Lot River, France). Sci. Total Environ. 2000, 248, 11-25. (9) Ratcliffe, P.; O’Rourke, J.; Maxwell, P.; Pugh, C. Oxygen sensing, hypoxia-inducible factor-1 and the regulation of mammalian gene expression. J. Exp. Biol. 1998, 201, 1153-1162. (10) Papandreou, I.; Cairns, R. A.; Fontana, L.; Lim, A. L.; Denko, N. C. HIF-1 mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption. Cell. Metab. 2006, 3, 187-197. (11) Duranteau, J.; Chandel, N. S.; Kulisz, A.; Shao, Z.; Schumacker, P. T. Intracellular Signaling by reactive oxygen species during hypoxia in cardiomyocytes. J. Biol. Chem. 1998, 273, 1161911624. (12) Killilea, D. W.; Hester, R.; Balczon, R.; Babal, P.; Gillespie, M. N. Free radical production in hypoxic pulmonary artery smooth muscle cells. Am. J. Physiol. Lung. Cell. Mol. Physiol. 2000, 279, L408-412. (13) Wang, Y.; Fang, J.; Leonard, S. S.; Krishna Rao, K. M. Cadmium inhibits the electron transfer chain and induces reactive oxygen species. Free Radical Biol. Med. 2004, 36, 1434-1443. (14) Guzy, R. D.; Hoyos, B.; Robin, E.; Chen, H.; Liu, L.; Mansfield, K. D.; Simon, M. C.; Hammerling, U.; Schumacker, P. T. Mitochondrial complex III is required for hypoxia-induced ROS production and cellular oxygen sensing. Cell. Metab. 2005, 1, 401-408. (15) Corbari, L.; Carbonel, P.; Massabuau, J.-C. The early life history of tissue oxygenation in crustaceans: the strategy of the myodocopid ostracod Cylindroleberis mariae. J. Exp. Biol. 2005, 208, 661-670. (16) Massabuau, J.-C. From low arterial- to low tissue-oxygenation strategy. An evolutionary theory. Respir. Physiol. 2001, 128, 249261. (17) Schmidt-Nielsen, K. Water and osmotic regulation. In Animal physiology: adaptation and environment, 2nd ed.; Cambridge University Press: New York, 1980; pp 285-288. (18) Eriksson, S. P.; Weeks, J. M. Effects of copper and hypoxia on two populations of the benthic amphipod Corophium volutator (Pallas). Aquat. Toxicol. 1994, 29, 73-81. (19) Baden, S. P.; Eriksson, S. P.; Weeks, J. M. Uptake, accumulation and regulation of manganese during experimental hypoxia and normoxia by the decapod Nephrops norvegicus (L.). Mar. Pollut. Bull. 1995, 31, 93-102. (20) Tran, D.; Boudou, A.; Massabuau, J. C. How oxygen level influences cadmium accumulation pattern in the asiatic clam Corbicula Fluminea: a laboratory and field study. Environ. Toxicol. Chem. 2001, 20, 2073-2080. (21) Hattink, J.; Boeck, G. D.; Blust, R. The toxicokinetics of cadmium in carp under normoxic and hypoxic conditions. Aquat. Toxicol. 2005, 75, 1-15. (22) Naylor, E.; James, R. Ventilation at various oxygen and carbon dioxide levels. In Biology handbook: Respiration and Circulation; American Society of Experimental Biology: Bethesda, MD, 1971; pp 533-538. (23) Dejours, P. Principles of Respiratory Physiology, 2nd ed; Elsevier: New York, 1981.

(24) Scandalios, J. G. Oxidative stress: molecular perception and transduction of signals triggering antioxidant genes defenses. Braz. J. Med. Biol. Res. 2005, 38, 995-1014. (25) Chandel, N. S.; McClintock, D. S.; Feliciano, C. E.; Wood, T. M.; Melendez, J. A.; Rodriguez, A. M.; Schumacker, P. T. Reactive oxygen species generated at mitochondrial complex III stabilize hypoxia-inducible factor-1R during hypoxia. A mechanism of O2 sensing. J. Biol. Chem. 2000, 275, 25130-25138. (26) Bell, E. L.; Emerling, B. M.; Chandel, N. S. Mitochondrial regulation of oxygen sensing. Mitochondrion 2005, 5, 322-332. (27) Brunelle, J. K.; Bell, E. L.; Quesada, N. M.; Vercauteren, K.; Tiranti, V.; Zeviani, M.; Scarpulla, R. C.; Chandel, N. S. Oxygen sensing requires mitochondrial ROS but not oxidative phosphorylation. Cell. Metab. 2005, 1, 409-414. (28) Murphy, B. J.; Andrews, G. K.; Bittel, D.; Discher, D. J.; McCue, J.; Green, C. J.; Yanovsky, M.; Giaccia, A.; Sutherland, R. M.; Laderoute, K. R.; Webster, K. A. Activation of metallothionein gene expression by hypoxia involves metal response elements and metal transcription factor-1. Cancer Res. 1999, 59, 13151322. (29) Gonzalez, P.; Baudrimont, M.; Boudou, A.; Bourdineaud, J.-P. Comparative effects of direct cadmium contamination on gene expression in gills, liver, skeletal muscle and brain of the zebra fish (Danio rerio). Biometals 2006, 19, 225-235. (30) Chun, Y.-S.; Choi, E.; Kim, G.-T.; Lee, M.-J.; Lee, M.-J.; Lee, S.-E.; Kim, M.-S.; Park, J.-W. Zinc induces the accumulation of hypoxia-inducible factor (HIF)-1R, but inhibits the nuclear translocation of HIF-1β, causing HIF-1. Inactivation. Biochem. Biophys. Res. Commun. 2000, 268, 652-656. (31) Salnikow, K.; Su, W.; Blagosklonny, M. V.; Costa, M. Carcinogenic metals induce hypoxia-inducible factor-stimulated transcription by reactive oxygen species-independent mechanism. Cancer Res. 2000, 60, 3375-3378. (32) Gao, N.; Ding, M.; Zheng, J. Z.; Zhang, Z.; Leonard, S. S.; Liu, K. J.; Shi, X.; Jiang, B.-H. Vanadate-induced expression of hypoxia-inducible factor 1R and vascular endothelial growth

(33)

(34)

(35)

(36)

(37)

(38)

(39)

factor through phosphatidylinositol 3-kinase/Akt pathway and reactive oxygen species. J. Biol. Chem. 2002, 277, 31963-31971. Gao, N.; Jiang, B.-H.; Leonard, S. S.; Corum, L.; Zhang, Z.; Roberts, J. R.; Antonini, J.; Zheng, J. Z.; Flynn, D. C.; Castranova, V.; Shi, X. p38 signaling-mediated hypoxia-inducible factor 1R and vascular endothelial growth factor induction by Cr(VI) in DU145 human prostate carcinoma cells. J. Biol. Chem. 2002, 277, 4504145048. Skinner, H. D.; Zhong, X.-S.; Gao, N.; Shi, X.; Jiang, B.-H. Arsenite induces p70S6K1 activation and HIF-1R expression in prostate cancer cells. Mol. Cell. Biochem. 2004, 255, 19-23. Li, Q.; Chen, H.; Huang, X.; Costa, M. Effects of 12 metal ions on iron regulatory protein 1 (IRP-1) and hypoxia-inducible factor-1 alpha (HIF-1R) and HIF-regulated genes. Toxicol. Appl. Pharmacol. 2006, 212, (3), 245-255. Gony, S.; Lecomte-Finiger, R.; Faguet, D.; Biagenti, S.; Brusle´, J. Etude expe´rimentale de l’action du cadmium sur les juve´niles d’anguilles: biologie du de´veloppement et cytopathologie. Oce´anis 1988, 14, 141-148. Van Heerden, D.; Vosloo, A.; Nikinmaa, M. Effects of short-term copper exposure on gill structure, metallothionein and hypoxiainducible factor-1R (HIF-1R) levels in rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 2004, 69, 271-280. Lappivaara, J.; Nikinmaa, M.; Tuurala, H. Arterial oxygen tension and the structure of the secondary lamellae of the gills in rainbow trout (Oncorhynchus mykiss) after acute exposure to zinc and during recovery. Aquat. Toxicol. 1995, 32, 321-331. Uenishi, R.; Gong, P.; Suzuki, K.; Koizumi, S. Cross talk of heat shock and heavy metal regulatory pathways. Biochem. Biophys. Res. Commun. 2006, 341, 1072-1077.

Received for review October 9, 2006. Revised manuscript received January 16, 2007. Accepted January 29, 2007. ES062415B

VOL. 41, NO. 8, 2007 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

3011