Comparative Proteome Analysis of Fractions Enriched for Membrane-Associated Proteins from Francisella tularensis Subsp. tularensis and F. tularensis Subsp. holarctica Strains Ivona Pavkova,*,† Marketa Reichelova,‡ Pa1 r Larsson,§ Martin Hubalek,† Jana Vackova,† Ake Forsberg,§ and Jiri Stulik† Institute of Molecular Pathology, Faculty of Military Health Sciences, University of Defence, Hradec Kralove, Czech Republic, Veterinary Research Institute, Brno, Czech Republic, and Department of NBC-Analysis, Swedish Defence Research Agency, SE-901 82 Umeå, Sweden Received April 24, 2006
The facultative intracellular pathogen Francisella tularensis is the causative agent of the serious infectious disease tularemia. Despite intensive research, the virulence factors and pathogenetic mechanisms remain largely unknown. To identify novel putative virulence factors, we carried out a comparative proteome analysis of fractions enriched for membrane-associated proteins isolated from the highly virulent subspecies tularensis strain SCHU S4 and three representatives of subspecies holarctica of different virulence including the live vaccine strain. We identified six proteins uniquely expressed and four proteins expressed at significantly higher levels by SCHU S4 compared to the ssp. holarctica strains. Four other protein spots represented mass and charge variants and seven spots were charge variants of proteins occurring in the ssp. holarctica strains. The genes encoding proteins of particular interest were examined by sequencing in order to confirm and explain the findings of the proteome analysis. Our studies suggest that the subspecies tularensis-specific proteins represent novel potential virulence factors. Keywords: F. tularensis • comparative proteomics • membrane proteins • virulence factors
Introduction The zoonotic disease tularemia is caused by the Gramnegative, facultative intracellular coccobacillus Francisella tularensis, one of the most infectious pathogens known.1-2 Two subspecies, of four recognized, are commonly associated with human disease; the highly virulent subsp. tularensis and the moderately virulent subsp. holarctica. Symptom severity depends on both route of transmission, e.g., clinical manifestation, and the subspecies of the infective strain. Subsp. holarctica tularemia can be protracted and debilitating, but the outcome is rarely fatal. However, for untreated cases of respiratory subsp. tularensis tularemia, mortality rates as high as 30% have been reported.2 Because F. tularensis also has capacity for aerosol dissemination, concerns have been raised that this pathogen could be used as an agent of bioterrorism.2 Despite the health risks associated with natural or deliberate exposure to F. tularensis, no licensed vaccine exists today. An attenuated live vaccine strain (LVS),1-3 originally derived from a virulent subsp. holarctica strain, is available for inoculation * To whom correspondence should be addressed. Ivona Pavkova, Institute of Molecular Pathology, Faculty of Military Health Science, University of Defence, Trebesska 1575, 500 01 Hradec Kralove, Czech Republic. Tel.: +420 973 251 538; Fax: +420 435 513 018; E-mail:
[email protected]. † University of Defence. ‡ Veterinary Research Institute. § Swedish Defence Research Agency. 10.1021/pr0601887 CCC: $33.50
2006 American Chemical Society
of at-risk personnel, but general clinical use has been discontinued owing to safety concerns, including limited efficacy against respiratory disease.1-3 The recent discovery of the Francisella pathogenicity island (FPI)4 might contribute to unfold key pathogenic mechanisms for F. tularensis. Generally, however, reports on virulence factors have been sparse2,3,5,6 and data is limited regarding what molecular determinants that could serve as targets for attenuation or as protective antigens in development of a new vaccine. To this end, a comparative proteomics approach for strains of different virulence can serve as a useful tool and has also been successfully applied for a number of pathogens.7-9 Previous findings suggest that few genetic differences separate F. tularensis subsp. tularensis and subsp. holarctica,10 and the two types are difficult to distinguish by serology.10 Nonetheless, distinct phenotypic differences have been found using comparative proteomic display of whole-cell extracts.11 By this approach, however, low-abundant membrane-associated proteins, which could play a critical role in pathogenicity, are easily masked by more highly expressed proteins. Therefore, in this work, we compared fractions enriched in membrane-associated proteins. The strains used in the comparative membrane proteome analysis comprised the highly virulent F. tularensis subsp. tularensis strain SCHU S4, the virulent subsp. holarctica strain 130, and the two avirulent subsp. holarctica strains 2062 and LVS. In our study, we have identified a number of Journal of Proteome Research 2006, 5, 3125-3134
3125
Published on Web 10/06/2006
research articles differentially expressed proteins across these strains that can serve as novel targets for vaccine development.
Materials and Methods Bacterial Cultures and Preparation of Fractions Enriched for Membrane-Associated Proteins. Four different strains of F. tularensis were selected for the comparative proteomic analyses: F. tularensis LVS derived from F. tularensis ssp. holarctica (ATCC 29684, American Type Culture Collection, Manassas, VA) and three isolates acquired from the Collection of Animal Pathogenic Microorganisms (CAPM), Veterinary Research Institute in Brno, Czech Republic: F. tularensis ssp. tularensissvirulent strain SCHU S4 (CAPM 5600, human ulcer, Ohio, USA, 1941), F. tularensis ssp. holarcticasvirulent strain 13012 (CAPM 5536, hare, Czech Republic, 1955) and F. tularensis ssp. holarcticasavirulent strain 2062 (CAPM 5535, hare, Czech Republic, 1957). Isolates of F. tularensis virulent strains SCHU S4 and 130 were prepared on Veterinary Research Institute in Brno, Czech Republic. All the F. tularensis strains were cultured on McLeod agar supplemented with bovine hemoglobin and IsoVitaleX (Becton-Dickinson, San Jose, CA). For each experiment, the stock suspensions of F. tularensis microbes at a density of 1010 -1.3 × 1010 organisms/mL (OD600 nm 1.63) was inoculated on five solid McLeod plates, 6 cm in diameter. Microbes were grown at 36.6 °C in 5% CO2 at 95% humidity for 24-48 h, according to the number of colonies. Colonies were then passaged on 15 McLeod plates and grown for 24 h. The fractions enriched for membrane proteins were prepared as described previously.13 The bacteria (1 × 1011) were scraped from the plates into 6 mL ice-cold PBS in polypropylene tubes, vortexed on ice, and washed twice for 30 min at 4000 × g. The washed bacteria were finally resuspended in 50 mM Tris/HCl (pH 8.0). The bacteria were disintegrated using repeated cycles of freeze-thawing in liquid nitrogen (10-15 cycles), and the undisrupted microbes were eliminated by centrifugation (4000 × g for 30 min, 4 °C). Cellular proteins (23 mg) (determined by Bicinchoninic Acid Kit, Sigma-Aldrich, St. Louis, MO) were diluted 1:10 with ice-cold 0.1 M sodium carbonate (pH 11) and stirred for 1 h at 4 °C. The carbonate buffer insoluble material containing membrane proteins was collected by ultracentrifugation in a Beckman Optima MAX ultracentrifuge (Paolo Alto, CA) at 115 000 g for 1 h at 4 °C.13 The pellet was solubilized in 1.5 mL of rehydration buffer containing 7 M urea, 2 M thiourea, 1% (w/v) ASB-14, 1% Triton X-100, 40 mM Tris, 2 mM tributylphosphine (TBP). Two-Dimensional Electrophoresis (2-DE). The protein samples were separated using 18 cm IPG strips with pH gradient 3-10 NL, 6-11 and 4-7 (GE Healthcare Bio-Sciences AB, Uppsala Sweden). Protein (80 µg) was applied for analytical purposes (determined by EZQ Protein Quantification Kit, Molecular Probes, USA). In the case of wide-range pH gradients, the samples were first diluted to a total volume of 350 µL with the above-mentioned rehydration buffer supplemented with 1% v/v Pharmalyte pH 3-10 and 0.5% v/v Pharmalyte pH 8-10.5 and then in-gel rehydration was performed overnight. The basic IPG strips were swollen in rehydration buffer containing 2% v/v IPG buffer pH 6-11 overnight and the samples in the total volume of 150 µL were cup-loaded at the anodic side and covered with paraffin oil. An extra paper strip soaked with DeStreak Reagent (GE Healthcare Bio-Sciences AB, Uppsala Sweden) was placed onto the IPG gel surface near the cathode. Following running conditions were used: 150 V for 1.5 h, 300 V for 1.5 h, from 300 to 3000 V in 3 h, 3000 V for 2 3126
Journal of Proteome Research • Vol. 5, No. 11, 2006
Pavkova et al.
h, and 5000 V for 18 h for the pH 3-10 or 4-7 gradient; 150 V for 1 h, 300 V for 2 h, 300-600 V for 2 h, 600-1000 V for 2 h, 1000-3500 V for 3.5 h, and 3500 V until 63 000 Vh for the pH 6-11 gradient. In the second dimension, gradient 9-16% SDSPAGE was used. Electrophoresis was carried out at a constant current of 40 mA/gel for 3.5 h. Proteins were visualized by sensitive ammoniacal silver staining14 for the comparative analysis or by Coomassie G-250 (Colloidal Blue Stain Kit, Invitrogen, San Diego, CA) for MS identifications. Statistical Analysis. The 2-DE image and statistical analysis was performed as previously described.11 Four independent samples were prepared for each strain to confirm reproducibility. Each sample was used for preparation of one gel of wide pH gradient 3-10 and basic pH gradient 6-11. Thus, the final set comprised 16 images for wide pH gradient and 16 images for basic pH gradient. The gels were scanned by a CCD camera (Image Station 2000R, Eastman Kodak, Rochester, NY), and the data were analyzed by Melanie III package. The gels were divided into four sets corresponding to the four different strains (SCHU S4, LVS, 130, 2062). All the gels were first matched automatically against each other within one class to control the reproducibility of the four gels prepared from one strain. Then the four classes of gels were matched automatically to one another to analyze potential differences among the strains. The matching quality was thoroughly checked by visual inspection and, furthermore, the reference 2-D maps of fractions enriched for membrane proteins isolated from F. tularensis LVS13 were used to correct possible pI shifts in spot position. Relative spot volumes (% vol), i.e., digitized staining intensity integrated over the area of the individual spot divided by the sum of integrating staining intensities of all spots and multiplied by 100, were used for spot quantitations. Normalized data for the matched spots were analyzed by Student’s t-test for each combination of the four sets (SCHU S4 vs LVS, SCHU S4 vs 130, SCHU S4 vs 2062, and reverse). Spots with a p-value e 0.01 were accepted as significantly different. All identified spots were again manually corrected for possible mismatches and reanalyzed. In the case the spot was present in all strains, only those groups showing relative spot volume differences more than 2-fold were accepted. In-Gel Digestion and Mass Spectrometry Identifications. For the identification, protein spots visualized by Coomassie staining were excised. The in-gel tryptic digestion and protein identification by peptide mass fingerprinting were performed as previously described.13 Briefly, the excised spots were destained in 200 µL 100 mM Tris-HCl, pH 8.5 in 50% acetonitrile and equilibrated in 50 mM ammonium bicarbonate, pH 7.8, in 5% acetonitrile. The vacuum-dried gel pieces were digested overnight at 37 °C with 0.1 µg of sequencing-grade trypsin (Promega, Madison, WI) in equilibration buffer. The mass spectra were recorded in reflector mode on a MALDI mass spectrometer Voyager-DE STR (Perseptive Biosystems, Framingham, MA) equipped with delayed extraction. For each protein, 0.5 µL of the peptide mixture was spotted onto the target plate, air-dried, and covered with 0.5 µL of matrix solution (2,5-dihydroxybenzoic acid, 50 mg/mL in 33% acetonitrile, 0.3% TFA). Calibration was performed externally with a five-point calibration using peptide standards. Additionally, spectra containing the autolytic tryptic peptide masses were also calibrated internally. The translated F. tularensis open reading frames were identified using the MS-FIT algorithm of Protein-Prospector program (Version 3.4.1., University of California, San Francisco Mass Spectrometry Facility). A mass
research articles
Francisella tularensis Subsp. tularensis and holarctica Table 1. Primer Sequences for PCR Amplification of Genes for Differentially Expressed Proteins locusa
a
gene product
FTT0018
secretion protein
FTT0903
hypothetical protein
FTT1103
conserved hypothetical lipoprotein
FTT1157
type IV pili lipoprotein
FTT1182
VacJ lipoprotein
FTT1260
hypothetical lipoprotein
FTT1591
lipoprotein
FTT1651
conserved hypothetical protein
FTT1666
3-hydroxyisobutyrate dehydrogenase
FTT1676
hypothetical membrane protein
primer name
sequence 5′ to 3′
L0018_F L0018_R L0903_F L0903_R L1103_F L1103_R L1157_F L1157_R L1182_F L1182_R L1260_F L1260_R L1591_F L1591_R L1651_F L1651_R L1666_F L1666_R L1676_F L1676_iF L1676_iR L1676_R
ATTACGCAGATATTGCAGAAATTA CCATTTAAACACCTAAATAAATCGT GGCAAAAATATCGCAGCAAA CCTGCTAAAGTTGCCGTCAT AATCAAAACTAACTCCAGATCAAAT GATAAAAACACTAAGCAGAAAGCAT GATTTTAAAGCGAAATTATCTGGTA CTACCGAGACATCATAACCTAGAAT TTGCTAAGCTTATTTATACACCACA ACGCATTAAAGAAACAAAAATAAAC AATCGTAGTCACCATAAGAGAAAAT CTGGAGATAAACTGACTGCATATAA AATATCAAAGATGAATCTCTAAGAAAA ATTATCTCCATCATTCCATTAATCA TGTGCACAGAACCTAGAAATATAGA AACAAGACAAAAGACGAATACTAGC AAAGTGTTAATCAGTTTTGTGAGGT CCTAGAGTTGATGAGATGGATAGAT TTTTTAGCAGCATTACGCAAA TGCAACTCCAGTTAAGCAGATT CATGGACAGCGTCAATAGTCA TTGCTTAGGTGGGGGAGTAA
Loci correspond to locus tag designations for predicted coding sequences in the SCHU S4 genome sequence.16
accuracy of 100 ppm was applied. The successful match required a minimum of four peptides, a MOWSE score > 1000, and MALDI coverage > 25%. For proteins not identified by MALDI-TOF-MS, LC-nanoESI-MS/MS was performed on CapLC Q-TOF Ultima API (Waters, Manchester, UK). Protein digests were removed from gel pieces by sequential extraction with 50 µL 2% TFA, 60% acetonitrile mixed in ratios of 3:2 and 2:3, and finally with 60% acetonitrile itself. The extract was concentrated in a vacuum centrifuge and suitably diluted in buffer A (2% acetonitrile, 98% water and 0.1% formic acid). Data Directed Analysis was recorded for each protein spot digest. Data were processed using the ProteinLynx Global Server 2.1. (smoothed by SavitzkyGolay 2 times, deisotoped, 80% peak height centroided). Database search was performed using the same software platform (PLGS 2.1.) against F. tularensis SCHU S4 genome database. 100% probability of match and a minimum two peptide fragmentation spectra were required (as assigned by software after validation). Bioinformatical Analysis. Several online available databases or programs were used for the further characterization of selected proteins: B-PSORT v. 2.0.4. (http://psort.org) for the prediction of protein localization in bacteria, LipoP 1.0 server (www.cbs.dtu.dk/services/LipoP) for the prediction and distinction of signal sequences in the N-terminal cleaved by signal peptidase II in lipoproteins or by signal peptidase I in secreted proteins, PROSITE database (www.expasy.org/prosite) of protein families and domains, Interproscan (www.ebi.ac.uk/InterProScan), Pfam database (www.sanger.ac.uk/Software/ Pfam), protein-protein BLAST and PSI-BLAST programs in nr database at NCBI to search for protein homologues in other bacterial genomes (www.ncbi.nlm.nih.gov/BLAST). Gene Sequencing. Genomic regions of seven different F. tularensis strains (six from the Swedish defense research agency FSC and one from the Ohio State University OSU) that corresponded to selected differentially expressed proteins (Table 1) were analyzed by DNA sequencing: two subsp. tularensis strains FSC237 - SCHU S4 of subgroup A1 and FSC053 of subgroup A2 (human ulcer, Nevada), one subsp. mediaasiatica strain FSC148 (240, ticks, Central Asia former
USSR, 1982) and four subsp. holarctica strains FSC017 (JapS2, human lymph node, Japan, 1926), FSC458 (LVS), FSC200 (Rem mr 3001, human, Sweden 1998) and OSU18 (beaver, Oklahoma USA, 1976). PCR and sequencing primers were synthesized by MWG-Biotech AG (Ebersberg, Germany). PCR was performed using Dynazyme II DNA polymerase and buffers (Finnzymes, Finland) on a MyCycler Thermal Cycler (Bio-Rad Laboratories, Hercules, CA). Polymerase chain reactions were performed in volumes of 50 µL with an initial denaturation temperature at 94 °C for 5 min, followed by 30 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 60 s. The resulting amplified DNA fragments were purified using Micro-Spin S400HR columns (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). Both strands were sequenced by using the same primers as those used in the initial PCR amplifications using dye terminator chemistry, Quick Start Kit, DTCS, CEQ. Subsequent fragment separations were performed using a CEQ 8800 Genetic Analysis System (Beckman Coulter, Inc, Fullerton, CA). Sequence data was submitted to GenBank under accession numbers DQ451107 - DQ451146.
Results 1. Comparative 2-DE Analysis of Fractions Enriched for Membrane Proteins from Four F. tularensis Strains. Four Francisella tularensis strains exhibiting differences in their virulence properties were examined by comparative proteome analysis of fractions enriched for membrane-associated proteins. For all strains, approximately 880 distinct spots could be observed after separation on pH 3-10 nonlinear gradients and subsequent silver-staining. The basic protein separation (pH 6-11) produced approximately 480 spots, partially overlapping the wide pH range protein spectrum. Figures 1, 2, 3, and 4 depict representative 2-DE maps for the individual strains. Generally, few differences were observed, but the most pronounced were found in comparison between the most virulent F. tularensis ssp. tularensis strain SCHU S4 and the three other ssp. holarctica strains (Table 2) where both quantitative and qualitative differences in expression of specific Journal of Proteome Research • Vol. 5, No. 11, 2006 3127
research articles
Pavkova et al.
Figure 1. Representative silver-stained 2-D map of the fraction enriched in membrane proteins from F. tularensis subsp. tularensis strain SCHU S4: separated on (A) wide pH gradient 3-10 and (B) basic pH gradient 6-11. The proteins are labeled by their FTT numbers that correspond to the FTT numbers in the first column in Table 2. Spots indicated by full arrow and unbroken line designate proteins uniquely expressed in SCHU S4, spots indicated by full arrow and broken line designate proteins at higher abundance in SCHU S4, spots indicated by open arrow and unbroken line designate proteins with specifically presented charge and mass variants in SCHU S4, spots indicated by open arrow and broken line designate proteins with pI shift in SCHU S4 compared to subsp. holarctica strains and spots indicated by half open arrow and broken line designate proteins at lower abundance in SCHU S4.
Figure 2. Representative silver-stained 2-D map of the fraction enriched in membrane proteins from the virulent F. tularensis subsp. holarctica strain 130: separated on (A) wide pH gradient 3-10 and (B) basic pH gradient 6-11. The proteins are labeled by their FTT numbers that correspond to the FTT numbers in the first column in Table 2. Spots indicated by full arrow and broken line designate proteins at higher abundance in SCHU S4, spots indicated by open arrow and unbroken line designate proteins with specifically presented charge and mass variants in SCHU S4, spots indicated by open arrow and broken line designate proteins with pI shift in SCHU S4 compared to subsp. holarctica strains, spots indicated by half open arrow and broken line designate proteins at lower abundance in SCHU S4, and spots indicated by half open arrow and unbroken line designate proteins not found in the SCHU S4.
proteins could be detected. The genes encoding proteins of particular interest were also sequenced in seven different F. 3128
Journal of Proteome Research • Vol. 5, No. 11, 2006
tularensis to determine the presence and distribution of mutations which could explain our findings (Table 3). Com-
Francisella tularensis Subsp. tularensis and holarctica
research articles
Figure 3. Representative silver-stained 2-D map of the fraction enriched in membrane proteins from avirulent F. tularensis subsp. holarctica strain 2062: separated on (A) wide pH gradient 3-10 and (B) basic pH gradient 6-11. Designations as in Figure 2.
Figure 4. Representative silver-stained 2-D map of the fraction enriched in membrane proteins from F. tularensis subsp. holarctica, live vaccine strain (LVS): separated on (A) wide pH gradient 3-10 and (B) basic pH gradient 6-11. Designations as in Figure 2.
parisons between the three ssp. holarctica strains revealed only small differences in protein spectra - only 4 proteins in the pH range 6-11 were found less abundant (spot %vol 2-3 folddown) in strain 130 (Table 4). Two unique spots were detected for the LVS that correspond to a homolog of the protein FTT0919 (Figure 5). As reported by Twine et al.,15 this LVS protein is a hybrid protein which has resulted from a deletion that fused the N- and C- terminal regions of ancestral genes corresponding to FTT0918 and FTT0919 respectively. Thus, as expected, spots corresponding to FTT0918 were not observed for the LVS but could be detected in the strains SCHU S4, 130, and 2062.
Based on the bioinformatical analysis, several proteins listed in the Table 2 were predicted as cytosolic proteins. These finding indicate, that we did not obtain a pure membrane fraction but only a fraction enriched in membrane proteins. However, as it has been already shown in our previous publication,13 dealing with the construction of reference 2-D maps of fractions enriched for membrane proteins of F. tularensis LVS, most of the proteins could not be found on 2-D gels from whole-cell extracts and the abundance of detected cytosolic proteins was significantly decreased.13 2. Differences in Protein Expression of the ssp. tularensis Strain SCHU S4 Compared to the ssp. holarctica Strains. Journal of Proteome Research • Vol. 5, No. 11, 2006 3129
research articles
Pavkova et al.
Table 2. Differentially Expressed Proteins in F. tularensis Subspecies tularensis in Comparison with the Subspecies holarctica Strains 130, 2062, and LVS locusa
1260 1666 0018 1651 0903 1157 1346, 1701 0380 1043
1103 1676 1591 0365 1484 1483 0209 0245 1354, 1712 0503 0373 1359, 1714 0087 0077 1539 0726 1441 1572 1747 0634 0142 1355, 1710 1794 0120 0276 0558 1250 0166
protein name, accession numberb
pH (IPG)c
theoretical Mr/pI
MS analysisd
bioinformatical analysise/ gene analysisf
A. Proteins uniquely present in the SCHU S4 strain (full-arrow and unbroken line designation in Figures 1A and B) hypothetical lipoprotein, YP_170218 3-10 16042/5.79 MS/MS lipoprotein/functional genes in ssp. holarctica 3-hydroxyisobutyrate 3-10 33478/6.59 PMF biotinyl/lipoyl carrier protein, dehydrogenase, YP_170573 protein kinases pattern/nonfunctional genes in ssp. holarctica secretion protein, YP_169094 6-11 40039/9.18 PMF, MS/MS sp-I/nonfunctional genes in ssp. holarctica conserved hypothetical protein, YP_170559 6-11 23098/9.35 PMF lipoprotein, SOUL-heme-binding proteins family/nonfunctional genes in ssp. holarctica (except Jap-S2) hypothetical protein, YP_169900 6-11 19351/9.40 PMF lipoprotein/functional genes in ssp. holarctica type IV pili lipoprotein, YP_170124 6-11 23007/9.58 PMF sp-I, PilP protein/functional genes in ssp. holarctica B. Proteins at higher abundance - 2 - 6 fold-up (full-arrow and broken line designation in Figures 1-4) hypothetical protein, YP_170298 3-10 14503/8.41 PMF lipoprotein NAD-specific glutamate 3-10 49108/6.49 PMF cyt dehydrogenase, YP_169425 6-11 FKBP-type peptidyl-prolyl 6-11 29327/8.94 PMF lipoprotein, OMP cis-trans isomerase family protein, YP_170026 C. Specifically presented charge and mass variants (open arrow and unbroken line designation in Figures 1-4) conserved hypothetical 3-10 38720/5.23 PMF lipoprotein, DSBA-like lipoprotein, YP_170079 thioredoxin domain/ in-frame deletion in SCHUS4 hypothetical membrane 3-10 37469/6.56 PMF, MS/MS lipoprotein/functional genes in both subspecies protein, YP_170582 lipoprotein, YP_170509 3-10 41624/4.58 PMF lipoprotein, VacJ protein family/ 4 base pair deletion in ssp. holarctica (except Jap-S2) phenol hydroxylase, YP_169412 3-10 27712/5.63 PMF cyt pyruvate dehydrogenase, 3-10 67252/4.77 PMF CMP E2 component, YP_170419 D. Proteins with pI shift (open arrow and broken line designation in Figures 1-4) dihydrolipoamide 3-10 50485/5.62 PMF cyt dehydrogenase, YP_170418 periplasmic solute binding 3-10 33766/5.46 PMF sp-I amily protein, YP_169268 universal stress protein, YP_169298 3-10 30187/5.52 PMF cyt intracellular growth locus, 3-10 22433/5.94 PMF ? subunit C, IglC, YP_170306 succinyl-CoA synthetase, 3-10 30095/6.10 PMF ? subunit R, YP_169538 nucleoside diphosphate kinase, YP_169420 3-10 15527/5.94 MS/MS cyt intracellular growth locus, 6-11 22419/8.84 PMF cyt subunit A, IglA, YP_170311 E. Proteins at lower abundance - 2-16 fold-down (half-open arrow and broken line designation in Figures 1-4) aconitate hydratase, YP_169161 3-10 102615/5.44 MS/MS cyt dihydrolipoamide succinyltransferase 3-10 52748/5.13 PMF cyt component of 2-oxoglutarate dehydrogenase complex, YP_169152 hypothetical protein, YP_170467 3-10 52056/5.83 PMF sp-I glycerophosphoryl diester 3-10 39043/5.39 PMF sp-I, OMP phosphodiesterase family protein, YP_169739 hypothetical protein, YP_170378 3-10 18507/5.34 PMF cyt, bacterioferritin outer membrane protein OmpH, YP_170494 3-10 18765/7.70 PMF sp-I outer membrane protein, YP_170641 3-10 20945/5.32 PMF sp-I, OmpH SPFH domain, band 7 family 6-11 34545/9.35 PMF ? protein, YP_169655 50S ribosomal protein L10, YP_169208 6-11 18719/8.66 PMF ? F. Proteins not found in the SCHU S4 strain (half-open arrow and unbroken line diamond designation in Figures 2-4) hypothetical protein, YP_170307 3-10 22101/6.82 PMF sp-I heat shock protein, YP_170678 3-10 16712/5.58 PMF cyt signal recognition particle 6-11 37641/7.09 PMF cyt (CM associated) receptor FtsY, YP_169190 cyclohexadienyl dehydratase 6-11 27694/9.29 PMF sp-I, PP precursor, pseudogene hypothetical protein, YP_169584 6-11 21705/6.33 PMF NDA-dependent epimerase/dehydratase hypothetical protein, YP_170208 6-11 27162/9.21 PMF, MS/MS sp-I conserved hypothetical 6-11 24497/9.45 PMF ? membrane protein, YP_169232
a Loci correspond to locus tag designations for predicted coding sequences in the SCHU S4 genome sequence.16 b Name of the protein and accession number according to the NCBInr database. c pH range of IPG strip where protein was identified; if there are two strips enclosed in record, the protein was found as overlapping on both 2-DE maps. d Mass spectrometry identification: the proteins were identified either by peptide mass fingerprinting (PMF) using the MALDI-TOF instrument or LC-nanoESI-MS/MS (MS/MS). The criteria for a successful identification are named in the section Materials and Methods. e Data obtained from bioinformatical analysis using the programs and databases: B-PSORT, LipoP, PROSITE, Interproscan, Pfam, NCBInr. Sp-I - signal peptide cleaved by signal peptidase I detected (LipoP), OM - outer membrane localization (B-PSORT), CM - cytoplasmic membrane localization (B-PSORT), cyt cytoplasmic localization (B-PSORT), ? - unknown localization (B-PSORT), PP-periplasmic localization (B-PSORT). f The principal results from sequencing of genes encoding selected proteins (in sections A. and C.) in F. tularensis subsp. tularensis (SCHU S4) and subsp. holarctica strains.
3130
Journal of Proteome Research • Vol. 5, No. 11, 2006
research articles
Francisella tularensis Subsp. tularensis and holarctica
Table 3. The Functionality of Genes Encoding Selected Proteins in Seven Representative F. tularensis Strains Analyzed by Gene Sequencing for the Presence and Distribution of Mutation (+ Indicates a Functional Gene, - Indicates a Nonfunctional Gene) sp. tularensis (type A) Clade A.I
Clade A.II
locusa
SCHUS4
FSC053
FTT0018 FTT0903 FTT1103 FTT1157 FTT1182 FTT1260 FTT1591 FTT1651 FTT1666 FTT1676
+ + +b + + + + + +
+ + + + + + + + +b
a
sp. mediasiatica
sp. holarctica (type B) Japanese
American
Russian
Swedish
FSC148
FSC017
OSU18
FSC458
FSC200
+ + + + + + + + +
+ + + + + + +
+ + + + + +
+ + + + + +
+ + + + + +
Corresponds to locus identifiers in the for the SCHU S4 genome sequence.16
b
Contains in-frame deletion.
Table 4. Proteins at Lower Abundance (2-3 Fold-Down) in F. tularensis Subspecies holarctica Strain 130 in Comparison with Strains 2062 and LVSa pH of IPG stripd
locusb
protein name and accession numberc
0380 0033 0166 0757
NAD-specific glutamate dehydrogenase, YP_169425 NADH dehydrogenase I, YP_169109 conserved hypothetical membrane protein, YP_169232 UTP-glucose-1-phosphate uridylyltransferase, YP_169768
6-11 6-11 6-11 6-11
theoretical Mr/pI
49108/6.49 25155/9.45 24497/9.45 32148/6.55
MS analysise
PMF PMF PMF PMF
a The spots detected for all these proteins were at lower abundance and belong to the category of significantly different at the p-level e 0.01 and minimally 2-fold different in value of normalized volume. b FTT Loci correspond to locus tag designations for predicted coding sequences in the SCHU S4 genome sequence.16 c Name of the protein. d pH range of IPG strip where protein was identified; if there are two strips enclosed in record, the protein was found as overlapping on both 2-DE maps. e Mass spectrometry identification: the proteins were successfully identified either by peptide mass fingerprinting (PMF) using the MALDI-TOF instrument or LC-nanoESI-MS/MS (MS/MS).
Figure 5. The presence/absence of hypothetical protein FTT0918 and fusion protein FTT0918/0919 in F. tularensis. The regions of 2-DE gels of the fractions enriched in membrane proteins from (A) F. tularensis subsp. tularensis strain SCHU S4, (B) F. tularensis subsp. holarctica strain 130, (C) strain 2062, and (D) F. tularensis LVS separated on pH gradient 4-7.
Proteins Uniquely Expressed by the SCHU S4 Strain. Six proteins were observed uniquely for the SCHU S4 strain (Table 2A). Four of these proteins were found on basic 2-D gels (pH 6-11). This observation is not very surprising because more membrane proteins were detected on basic 2-D gels with respect to the proportional spot distribution in the pH 3-10 and pH 6-11 ranges in our previous study.13 This is also in accordance with the finding that membrane proteins are generally alkaline and they are less visible on standard 2-D gels analyzing acidic to weakly basic proteins.16 The genes for these proteins were also sequenced in order to determine their functionality (Table 3). No function could be assigned for another predicted lipoprotein encoded by FTT 1651. Interestingly, this protein was found to be a homologe to the SOUL protein family that represents a group of putative heme-binding proteins, present in all domains of life. The cause for the deficiency in expression was found to be due to a frame-shift mutation, present in all subsp. holarctica strains, except the Japanese strain that has a deeper phylogenetic origin. The secretion protein FTT0018 is homologous to the membrane fusion proteins that function as a component in efflux pumps. The similarity of this protein to other protein family members suggests that this protein might contribute to export of substances which are toxic to the bacterium. The gene se-
quences for the tested strains indicate that this protein is nonfunctional across all subsp. holarctica strains. The protein encoded by FTT1666 was found to show weak homology to 3-hydroxyisobutyrate dehydrogenase, but might exhibit a related beta-hydroxyacid dehydrogenase activity. A hybrid motif typical for biotinyl/lipoyl carrier proteins was detected, and also a pattern typical for protein kinases that is highly unusual for bacterial proteins. All subsp. holarctica genes for this protein displayed a nonsense mutation at position 318. The two predicted lipoproteins FTT1260 and FTT0903 did not reveal any clear homology to proteins in organisms that have been genome sequenced to date, and their functions are unknown. The encoding genes for FTT1260 were found intact across all tested strains. For FTT0903, a nonsense mutation was found for the subsp. mediasciatica strain FSC0148. The genes which encode the FTT1157 type IV pili lipoprotein appeared functional in all the tested strains, as well. This lipoprotein homologous to PilP proteins is believed to function as chaperone in the assembly of the outer membrane secretin, a component necessary for type IV pili biogenesis.17 No protein spots for these three proteins (FTT1260, FTT0903, FTT1157) could be found on the 2-D gels of all the tested subsp. holarctica strains, not even in other position due to pI shift. Their absence seemed to be due to decreased level of correJournal of Proteome Research • Vol. 5, No. 11, 2006 3131
research articles sponding genes, so that we were not able to detect them by the approach used in this study. Proteins Present at Higher Abundance in the SCHU S4 Strain. Three proteins were identified that were significantly more abundant in the SCHU S4 strain (Table 2B), while still detectable in the other strains. The %vol of the corresponding protein spots was 2 - 6 fold up in the SCHU S4 strain compared to the subsp. holarctica strains. A predicted lipoprotein is encoded by the two identical genes FTT1346 and FTT1701 localized in the 33.9-kb duplicated Francisella pathogenicity island (FPI).18 The FKBP-type peptidyl-prolyl cis-trans isomerase family protein FTT1043, predicted as an outer membrane lipoprotein, formed three distinct charge variants on the 2-DE gel images for all studied strains. One variant was significantly more abundant in the SCHU S4 strain. A homolog of this protein is the macrophage infectivity potentiator, which is a virulence factor for several pathogens, including Legionella pneumophila.19 Similarly, two charge variants of NAD-specific glutamate dehydrogenase (FTT0380), of at least four identified, exhibited significantly higher levels in the SCHU S4 strain. Charge and Mass Heterogeneity of Proteins. Several proteins were found to have different mass and charge variants on the 2-DE gel images. Among these, five proteins (Table 2C) showed different charge and mass or only charge variants in the SCHU S4 strain compared to the subsp. holarctica strains. The genes encoding some of these proteins were analyzed by gene sequencing to find a potential explanation for our observation (Table 3). The conserved lipoprotein, FTT1103, belongs to the DSBA subfamily of the thioredoxin family. In the SCHU S4, this protein is truncated by eight amino acid residues due to a deletion close to the N-terminal and the surrounding genes appear non-functional in both the LVS strain and the SCHU S4. This in-frame deletion corresponds with the pI and Mw shift very well (44 kDa/pI 4.5 in SCHU S4 vs 48 kDa/pI 4.3 in subsp. holarctica strains). The membrane protein FTT1676 was found to contain a deletion of 16 amino acids, however, only in the subsp. tularensis FSC053 strain compared to the other tested strains. The shifts in this protein in the SCHU S4 might be therefore due to a post-translation modification; however, further experimental studies are needed to confirm this hypothesis. The lipoprotein FTT1591 belongs to the VacJ protein family and contained a four base pair deletion in the tested subsp. holarctica genes, (except in the Japanese strain) which again corresponds with the Mw/pI shift (43 kDa/pI 4.5 in SCHU S4 vs 39 kDa/pI 4.6 in subsp. holarctica strains. On the other hand another gene encoding VacJ lipoprotein FTT1182 was found to be inactivated in both subsp. tularensis strains and in the Japanese strain whereas it is functional in other subsp. holarctica strains. The spots for this protein failed to be detected on the 2-DE gels. Seven additional proteins showed only an acidic or basic shift on the SCHU S4 2-DE gels (Table 2D). The periplasmic solute binding family protein FTT0209 belongs to a family of proteins that interact with ATP-binding cassette transport systems and plays a role in the transport of various substances across the cytoplasmic membrane of the bacterium. Similar pI shifts in the five proteins IglC (FTT1357, FTT1712), FTT0245, FTT0503, FTT0373, and IglA (FTT1359, FTT1714) were observed in the previous comparative analysis of whole-cell lysates as well.11 Proteins at Lower Abundance or Not Found in the SCHU S4 Strain. The expression of 9 identified proteins was significantly lower (spot %vol 2-16 fold-down) in the SCHU S4 strain compared to the ssp. holarctica strains (Table 2E). These 3132
Journal of Proteome Research • Vol. 5, No. 11, 2006
Pavkova et al.
included the Krebs cycle enzyme aconitate hydratase (FTT0087), the OmpH homologs (FTT1572 and FTT1747), the outer membrane glycerophosphoryl diester phosphodiesterase family protein (FTT0726), the hypothetically exported protein FTT1539 and bacterioferritin homolog FTT1441. The spots for six other proteins could be found only in subsp. holarctica strains, absent in SCHU S4 (Table 2F), among which the encoding gene for the protein FTT0276 was designated as a pseudogene for the SCHU S4 strain.
Discussion Membrane-associated proteins often play an important role in bacterial pathogenicity, as these proteins can mediate hostpathogen interactions. Despite their presumptive importance, few studies have focused on membrane proteins in F. tularensis. Gilmore and co-workers (2004)20 used TnphoA mutagenesis to identify cell membrane-associated proteins and reported 11 genes encoding proteins that are exported from the cytoplasm.20 To date, the 17 kDa protein LpnA (FTT0901), and the outer membrane associated protein encoded by fopA (FTT0583) are the only membrane proteins that have been investigated in depth for their potential role in the immunity against F. tularensis infections.21,22 The only comprehensive proteomic analysis focusing on membrane proteins in F. tularensis was reported last year, in which previously undetected proteins were found to be expressed13 (2-DE reference maps publicly available at www.mpiib-berlin.mpg.de/2D-PAGE). In earlier proteomic work using whole-cell lysates,11 these proteins had been masked by highly abundant cytosolic proteins. In this study, proteomic analysis was performed using fractions enriched specifically for membrane-associated proteins. The preparations were made from each of four F. tularensis strains of graded virulence, envisaging that proteins found to be differentially expressed between virulent strains and less virulent or avirulent strains might play an important role. Expectedly, the most pronounced differences were found by comparison of the highly virulent subsp. tularensis strain SCHU S4 and the three included subsp. holarctica strains 130, 2062 and the live vaccine strain (LVS), whereas few differences were detected between the subsp. holarctica strains. These findings were in agreement with previous results,10,11 confirming a close genetic relatedness among subsp. holarctica strains. The only detected protein that was absent in LVS, compared to the virulent strains SCHU S4 and 130, was the fusion protein FTT0918/0919,15 which seems to attenuate the LVS strain for virulence, at least to some degree. Moreover, the mutation of the FTT0918 homolog was previously shown to decrease the virulence of the subsp. tularensis strain SCHU S4.15 The detection of the FTT0918 protein in the avirulent strain 2062 indicates that this strain is attenuated by some other mechanism. With the analysis method used in our study, we were able to detect several proteins that seem to be uniquely expressed in the SCHU S4 strain. These proteins might be responsible for the graduated virulence of the SCHU S4 strain and might provide novel targets for vaccine development and antigens that could be used for subspecies-specific diagnosis. Among these proteins, only the type IV pili lipoprotein PilP (FTT1157) evidently belongs to a protein family known to be directly linked to virulence, e.g., in Pseudomonas aeruginosa and Neisseria gonorrheae and other pathogens.23 The significance of the pilus apparatus has also been investigated in F. tularensis where mutation of pilin building block proteins was shown to
research articles
Francisella tularensis Subsp. tularensis and holarctica
impair the ability of a subsp. holarctica strain to disseminate the infection to the spleen in mice.24 The pilP genes were found to be intact across all tested strains, and a possibility exists that the level of expression of this protein could control the level of virulence. The function and significance of other uniquely expressed protein - the 3-hydroxyisobutyrate dehydrogenase homolog (FTT1666) in the SCHU S4 strain is uncertain, although the unexpected signature common for serine/threonine and tyrosine protein kinases could indicate a role in a signaling pathway for this protein.25 In the holarctica subspecies, this putative mechanism might be disrupted since the corresponding genes in all tested strains of this subspecies were nonfunctional. Until now, only few studies of phosphorylation cascades involving serine, threonine, or tyrosine have been reported in bacteria. However, accumulating evidence suggests that a significant number of proteins in prokaryotes are also phosphorylated on these residues.26 The role of these phosphoproteins is generally poorly understood in bacteria. It is supposed that they might play a key role in the control of cellular activities, as in eukaryotes.27 The possible functions of the other proteins uniquely present in the SCHU S4 strain could only be inferred from weak similarities to other proteins or the presence of a known protein domain. For example, the protein FTT1651 is a candidate for further study as it could be involved in the iron uptake. The process by which the F. tularensis bacterium acquires ferric iron, believed to be important for survival in a host organism, is obscure since the genome sequence failed to reveal previously known systems for this function.17 Proteins that exhibited charge and mass variants that differed between the SCHU S4 strain and subsp. holarctica strains could also contribute to graded virulence, as the existence of proteins differing in electrophoretic mobility was previously reported in comparative proteomic analyses of virulent and attenuated Mycobacterium tuberculosis strains28 and invasive and cytotoxic strains of Pseudomonas aeruginosa.8 Such heterogeneity can result from differential post-translational protein modifications or amino acid substitutions like in the proteins FTT1103 and FTT1591. Several F. tularensis proteins were related to virulence factors in other pathogens: The lipoprotein FTT1103 has a domain common for disulfide oxidoreductase DsbA family, which includes known virulence factors in several gramnegative bacteria, e.g., Pseudomonas aeruginosa,29 Salmonella enterica,30 Shigella flexneri.31 We deleted this gene in F. tularensis LVS and our results from in vivo sublethal infection of mice indicate strong attenuation of this mutant (Pavkova et al., unpublished data). The lipoprotein FTT1591 is similar to the VacJ lipoproteins, essential for virulence in Shigella flexneri.32 Some proteins that exhibited only different charge variants in the SCHU S4 strain are also known virulence factors in other bacteria. For example, the E2 component of pyruvate dehydrogenase was found to play an important role in intracellular growth of the intracytosolic pathogen Listeria monocytogenes33 and the flavoprotein dihydrolipoamide dehydrogenase is known to be essential for survival of Streptococcus pneumoniae in a host organism.34 The two proteins IglA and IglC also differed, which are encoded in the duplicated Francisella pathogenicity island.17 Both proteins are required for the intramacrophage microbial multiplication that is prerequisite for induction of the programmed host cell death.4,35
Many of the absent or lowly expressed proteins were previously found to be immunoreactive: The proteins FTT1441, FTT1539, and OmpH homologs FTT1572 and FTT1747 provided characteristic reactions either with sera from patients with tularemia or from experimentally infected mice.36-37 Additionally, the dihydrolipoamide succinyl transferase (FTT0077) ortholog in Bartonella ssp. has been shown to be immunogenic.38 Heat-shock proteins are often expressed at high levels by bacterial pathogens during adaptation to the intracellular environment39 and overexpression of chaperones was found to reduce survival of M. tuberculosis in a mouse model.40 Thus, a decreased or inhibited expression of heat shock proteins and other immunoreactive proteins might delay activation of the humoral host immune system and promote a more rapid progression of the disease. In conclusion, the methods used in the presented comparative proteome analysis enabled us to detect several differentially expressed proteins in fractions enriched for membrane-associated proteins from the highly virulent F. tularensis subsp. tularensis strain SCHU S4 and the subsp. holarctica virulent strain 130 and the avirulent 2062 and live vaccine strains. The importance of investigating F. tularensis membrane-associated proteins lies in the fact that many virulence factors known from other species belong to this class of proteins, whereas few have been reported for this pathogen.4,6,11,41 Most of the differentially expressed proteins had not been previously detected in analyses of whole-cell lysates, which also underlines the importance of sample prefractionation to visualize less abundant proteins. Among the differentially expressed proteins, many could be involved in Francisella virulence, including proteins which have homologues associated with virulence in other species, and proteins that potentially have been down-regulated to hide the bacterium from the immune system. Construction of gene knock-out mutants for selected lipoproteins is underway to further elucidate their potential role.
Acknowledgment. This study was supported by the Czech Science Foundation GACR 310/06/P266. We thank Jana Michalickova and Alena Firychova for their excellent technical assistance. References (1) Ellis, I.; Oyston, P. C. F.; Green, M.; Titball, R. W. Clin. Microbiol. Rev. 2002, 15, 631-646. (2) Oyston, P. C. F., Sjo¨stedts, A., Titball, R. W. Nat. Rev. Microbiol. 2004, 2, 967-978. (3) Conlan, J. W. Vaccines 2004, 3, 89-96. (4) Nano, F. E.; Zhang, N.; Cowley, S. C.; Klose, K. E.; Cheung, K. K.; Roberts, M. J.; Ludu, J. S.; Letendre, G. W.; Meierovics, A. I.; Stephens, G.; Elkins, K. L. J. Bacteriol. 2004, 186, 6430-6436. (5) Sjo¨stedt, A. Curr. Opin. Microbiol. 2003, 6, 66-71. (6) Titball, R. W.; Johansson, A.; Forsman, M. Trends Microbiol. 2003, 118, 118-123. (7) Mattow, J.; Schaible, U. E.; Schmidt, F.; Hagens, K.; Siejak, F.; Brestrich, G.; Haeselbarth, G.; Muller, E. C.; Jungblut, P. R.; Kaufmann, S. H. Electrophoresis 2003, 24, 3405-20. (8) Nouwens, A. S.; Willcox, M. D. P.; Walsh, B. J.; Cordwell, S. J. Proteomics 2002, 1, 1325-1346. (9) Trost, M.; Wehmhoner, D.; Karst, U.; Guido, D.; Wehland, J.; Jansch, L. Proteomics 2005, 5, 1544-1557. (10) Broekhuijsen, M.; Larsson, P.; Johansson, A.; Bystrom, M.; Eriksson, U.; Larsson, E.; Prior, R. G.; Sjo¨stedt, A.; Titball, R. W.; Forsman, M. J. Clin. Microbiol. 2003, 41, 2924-31. (11) Huba´lek, M.; Hernychova, L.; Havlasova´, J.; Kasalova´, I.; Neubauerova´, V.; Stulik, J.; Macela, A.; Jundqvist, M.; Larsson, P. J. Chromatogr. B. 2003, 787, 149-177. (12) Lukas, B. Cs Epidem Mikrobiol Imunol. 1967, 16, 40-51.
Journal of Proteome Research • Vol. 5, No. 11, 2006 3133
research articles (13) Pavkova, I.; Hubalek, M.; Zechovska, J.; Lenco, J.; Stulik, J. Proteomics 2005, 5, 2460-2467. (14) Hochstrasser, D. F., Merril, C. R. Appl. Theoret. Electrophor. 1988, 1, 35-40. (15) Twine, S.; Bystro¨m M.; Chen W.; Forsman M., Golovliov, I.; Johansson, A.; Kelly, J.; Lindgren, H.; Svensson, K.; Zingmark, C.; Conlan, W.; Sjo¨stedt, A. Infect. Immun. 2005, 73, 8345-8352. (16) Santoni, V.; Molloy, M.; Rabilloud, T. Electrophoresis 2000, 21, 1054-1070. (17) Drake, S. L.; Sandstedt, S. A.; Koomey, M. Mol. Microbiol. 1997, 23, 657-668. (18) Larsson, P.; Oyston, P. C.; Chain, P.; Chu, M. C.; Duffield, M.; Fuxelius, H. H.; Garcia, E.; Halltorp, G.; Johansson, D.; Isherwood, K. E.; Karp, P. D.; Larsson, E.; Liu, Y.; Michell, S.; Prior, J.; Prior, R.; Malfatti, S.; Sjo¨stedt, S.; Svensson, K.; Thompson, N.; Vergez, L.; Wagg, J. K.; Wren, B. W.; Lindler, L. E.; Andersson, S. G.; Forsman, M.; Titball, R. W. Nat. Genet. 2005, 3, 153-159. (19) Cianciotto, P; Fields, B. S. Proc. Natl. Acad. Sci. U.S.A. 1992, 89, 5188-5191. (20) Gilmore, R. D.; Bacon, R. M.; Sviat, S. L.; Petersen, J. M.; Bearden, S. W. Microb. Pathogen. 2004, 37, 205-213. (21) Fulop, M.; Manchee, R.; Titball, R. Vaccine 1995, 13, 1220-1225. (22) Sjo¨stedt, A.; Sandstro¨m, G.; Ta¨rnvik, A. Infect. Immun. 1992, 13, 2855-2866. (23) Soto, G. E.; Hultgren, S. J. J. Bacteriol. 1999, 181, 1059-1071. (24) Forslund, A.-L.; Kuoppa, K.; Svensson, K.; Salomonsson, E.; Johansson, A.; Bystro¨m, M.; Oyston, P. C.; Michell, S. L.; Titball, R. W.; Noppa, L.; Frithz-Lindsten, E.; Forsman, M.; Forsberg, A. Mol. Microbiol. 2006, 59, 1818-1830. (25) Wilson, M., McNab, R.; Henderson, B. Bacterial Disease Mechanisms: An Introduction to Cellular Microbiology; Cambrigde University Press: Cambridge, UK, 2002. (26) Levin, A.; Vannier, F.; Absalon, C.; Kuhn, L.; Jackson, P.; Scrivener, E.; Labas, V.; Vinh, J.; Courtney, P.; Garin, J.; Se´ror, S. J. Proteomics 2006, 6, 2157-2173.
3134
Journal of Proteome Research • Vol. 5, No. 11, 2006
Pavkova et al. (27) Cozzone, A. Biochimie 1998, 80, 43-48. (28) Mattow, J.; Jungblut, P. R.; Schaible, U. E.; Mollenkopf, H. J.; Lamer, S.; Zimny-Arndt, U.; Hagens, K.; Muller, E. C.; Kaufmann, S. H. Electrophoresis 2001, 61, 367-390. (29) Ha, U. H.; Wang, Y.; Jin, S. Infect. Immun., 2003, 71, 1590-1595. (30) Miki, T.; Okada, N.; Danbara, H. J. Biol. Chem. 2004, 279, 3463134642. (31) Yu, J. Infect. Immun. 1998, 66, 3909-3917. (32) Suzuki, T.; Murai, T.; Fukuda, I.; Tobe, T.; Yoshikawa, M.; Sasakawa, C. Mol. Microbiol. 1994, 11, 31-41. (33) O’Riordan, M.; Moors, M. A.; Portnoy, D. A. Science 2003, 17, 462464. (34) Smith, A. W.; Roche, H.; Trombe, M. C.; Briles, D. E.; Hakansson, A. Mol. Microbiol. 2002, 44, 431-448. (35) Lai, X. H.; Golovliov, I.; Sjostedt, A. Infect. Immun. 2001, 69, 46914694. (36) Havlasova, J.; Hernychova, L.; Brychta, M.; Hubalek, M.; Larsson, P.; Lundqvist, M.; Forsman, M.; Lenco, J.; Stulik, J.; Macela, A. Proteomics 2005, 5, 2090-2103. (37) Havlasova, J.; Hernychova, L.; Halada, P.; Pellantova, V.; Krejsek, J.; Stulik, J.; Macela, A.; Jungblut, P. R.; Larsson, P.; Forsman, M. Proteomics 2002, 2, 857-867. (38) Gilmore, R. D.; Carpio, A. M.; Kosoy, M. Y.; Gage, K. L. Infect. Immun. 2003, 71, 18-22. (39) Stewart, G. R.; Young, D. B. Curr. Opin. Immunol. 2004, 16, 506510. (40) Stewart, G. R.; Wernish, L.; Stabler, R.; Mangan, J. A.; Hinds, J.; Laing, K. G.; Young, D. B.; Butcher, P. D. Microbiol. 2002, 148, 3129-3138. (41) Huba´lek, M.; Hernychova´, L.; Brychta, M.; Lenco, J.; Zechovska´, J.; Stulik, J. Proteomics 2004, 10, 3048-3060.
PR0601887
