Comparative Proteomic Analysis of Differentially Expressed Proteins

Comparative Proteomic Analysis of Differentially Expressed Proteins in the Earthworm Eisenia fetida during Escherichia coli O157:H7 Stress Xing Wang,#,† Li Chang,#,‡ Zhenjun Sun,*,† and Yufeng Zhang† College of Resources and Environmental Sciences, China Agricultural University, Beijing, P. R. China, and The Anhui Provincial Key Laboratory of the Resource Plant Biology in School of Life Sciences, Huaibei Normal University, Huaibei, Anhui, P. R. China Received July 16, 2010

Escherichia coli O157:H7 is an intestine-inhabiting bacterium associated with many severe disease outbreaks worldwide. It may enter the soil environment with the excreta of infected animals (e.g., horses, cattle, chickens) and humans. Earthworms can protect themselves against invading pathogens because of their efficient innate defense system. Identification of differential proteomic responses to E. coli O157:H7 may provide a better understanding of the survival mechanisms of the earthworm Eisenia fetida that lives in E. coli O157:H7-polluted environments. Whole earthworm extracts, collected at days 7, 14, 21, and 28 after E. coli O157:H7 stress, were analyzed by two-dimensional gel electrophoresis and quantitative image analysis. In total, 124 proteins demonstrated significant regulation at least at one time point, and 52 proteins were identified by matrix-assisted laser desorption/ionization-tandem time-of-flight mass spectrometry and database searching. Compared with control samples, 11 protein spots were up-regulated and 41 were down-regulated for at least one time point. The identified proteins, including heat shock protein 90, fibrinolytic protease 0, gelsolin-like protein, lombricine kinase, coelomic cytolytic factor-1, manganous superoxide dismutase, catalase, triosephosphate isomerase, extracellular globin-4, lysenin, intermediate filament protein, and glyceraldehyde-3-phosphate dehydrogenase, are involved in several processes, including transcription, translation, the tricarboxylic acid cycle, and the glucose metabolic process. Thus, our study provides a functional profile of the E. coli O157:H7responsive proteins in earthworms. We suggest that the variable levels and trends in these spots on the gel may be useful as biomarker profiles to investigate E. coli O157:H7 contamination levels in soils. Keywords: proteomics • invertebrates • Eisenia fetida • Escherichia coli O157:H7

The bacterium Escherichia coli O157:H7 is a foodborne pathogen that has been implicated in many outbreaks of infectious diseases worldwide. It may cause hemorrhagic colitis, hemolytic-uremic syndrome, thrombotic thrombocytopenic purpura, and even death.1 Infected animals typically excrete more than 108 colony forming units (CFU) of E. coli O157:H7 per gram of feces, and virulent E. coli strains can survive for a few months in animal waste.2-4 However, E. coli O157:H7, as a toxin-producing food and waterborne bacterial pathogen, has been linked to large outbreaks of gastrointestinal illnesses for more than two decades in humans.5 Thus, effective and convenient methods to reduce or eliminate pathogens in organic manure are in high demand for the benefit of human health.

Invertebrates have evolved various active defense pathways that efficiently recognize and respond to nonself substances, despite the absence of an adaptive immune system based on antibodies or lymphocytes.6 The innate immune system of invertebrates includes many reactions, with encapsulation being a critical component, which, with phagocytosis and antimicrobial peptides, present effective obstacles to infection.7 In the course of evolution, earthworms have developed efficient defense mechanisms against microbes they ingested during feeding or taken up into the body from the environment after injury.8 Earthworms are considered to be one of the most suitable representatives of soil animals for soil contamination surveys.9 Like many other ecologically important species, proteomics research in earthworms lags far behind that in other model species such as Mus musculus and Caenorhabditis elegans.

* To whom correspondence should be addressed. Dr. Zhenjun Sun, College of Resources and Environmental Sciences, China Agricultural University, No. 2, Yuanmingyuan West Road, Beijing, 100193, P. R. China. Tel.: +86-10-62732942. Fax: +86-10-62732149. E-mail: [email protected]. # These authors contributed equally to this work. † China Agricultural University. ‡ Huaibei Normal University.

It is common in invertebrates systems to sequester smaller pathogens and eliminate them by other innate immune mechanisms, such as antimicrobial peptides and/or phagocytosis.7 Numerous studies on the humoral and cellular properties of earthworm immune systems have been published.10 Kumar

1. Introduction

10.1021/pr1007398

 2010 American Chemical Society

Journal of Proteome Research 2010, 9, 6547–6560 6547 Published on Web 09/23/2010

research articles and Sekaran (2005) indicated that enteric pathogens are completely eliminated after passage through the guts of earthworms.11 However, the exact mechanism of this selective elimination remains unknown. Currently, little information about protein profiling of earthworms in response to E. coli O157:H7 stress exists. In the present study, to better understand the events that occur in E. fetida cells during E. coli O157:H7 stress, a proteomic approach was used to identify sets of up- or down-regulated proteins. Two-dimensional gel electrophoresis (2-DE) was used to separate proteins isolated from whole E. fetida at days 7, 14, 21, and 28 after treatment with E. coli O157:H7. All experiments were performed on E. fetida, an easily bred and handled laboratory animal, which is recommended by the Organization for Economic Cooperation and Development (OECD) as a toxicity test organism.12 To our knowledge, the present study is the first reported proteomic analysis of the earthworm during E. coli O157:H7 stress and provides information on earthworm proteomics that may be useful in understanding the development of earthworms, which has been rarely studied despite their importance in terrestrial ecotoxicology.

2. Materials and Methods 2.1. The Experimental Organism and Preparation of an Artificial Soil. The experiments were carried out with earthworm species E. fetida, an easy to breed and handle laboratory model, which is recommended by OECD as a test organism (1984).12 Adult E. fetida (weighing between 300 and 400 mg) were kept in test substrates for a week before the experiment. Artificial substrates were prepared as described in the OECD guidelines.12 Briefly, the substrate was composed (percentages refer to dry weight) of 10% sphagnum, 20% kaolinite clay, and 70% quartz sand. The pH was adjusted to 6.0 ( 0.5 with CaCO3. Food was first provided with 0.5% of air-dried cow manure and provided every 14 days for the longest stress periods; 107 CFU g-1 soil (colony forming units per gram of dry matter) of E. coli O157:H7 was added to the soil within half an hour of introducing the worms, which is the reported concentration of E. coli O157:H7 for E. fetida in OECD artificial soil.13 Stress times were 7, 14, 21, and 28 days. After earthworms had been exposed to E. coli O157:H7 for 7, 14, 21, and 28 days respectively, the earthworms were transferred onto filter paper soaked with isotonic Lumbricus balanced salt solution (LBSS) to void the gut for two days.14 Whole E. fetida were stored at -80 °C for later RNA and protein extraction. Enterohemorrhagic Escherichia coli O157:H7 was the international reference strain EDL933 purchased from Institute of Epidemiology and Microbiology, Chinese Academy of Preventive Medicine. E. coli O157:H7 is a foodborne pathogen. Infection routes of pathogenic E. coli O157:H7 are food and water into the intestine. We wore masks and medical latex gloves in the experiment. After each experiment, all objects which contacted the virulent E. coli O157:H7 were cleaned with the antiseptic solution benzalkonium bromide, and then all experimental products were sterilized at 121 °C for 20 min. 2.2. Growth Rate Measurement. After 7, 14, 21, and 28 days of stress, earthworms of five replicates per treatment were removed from the OECD guidelines, washed in distilled water, and dried on filter paper. The weights of the earthworms in each treatment group and control group were then used to compute the relative growth rates using the equation of Martin (1986),15 where W0 is the average weight at the beginning of 6548

Journal of Proteome Research • Vol. 9, No. 12, 2010

Wang et al. incubation and Wt is the average weight of the earthworms after t days of stress.

relative growth rate )

W t - W0 × 100% W0

2.3. Protein Extraction. Proteins were extracted according to the TCA-A procedure described previously.16 Briefly, for each of the three biologically independent experiments, three fresh whole E. fetida worms were collected and pulverized together to a homogeneous powder in liquid nitrogen with a mortar and pestle. A 2 g sample was taken from each homogeneous preparation and resuspended separately with -20 °C 10 mL protein extraction buffer (acetone/20% TCA/0.1% DTT) before precipitation overnight at -20 °C. The protein pellets above were washed with ice-cold methanol followed by multiple icecold acetone washes, dried in a vacuum freeze-drying machine, and redissolved in IEF buffer (7 M urea, 2 M thiourea, 2% CHAPS, 65 mM DTT, 0.5% w/v carrier ampholytes (nolinear pH 3-10, Amersham Biosciences, GE Healthcare Life Science, USA)). Protein concentrations were quantified using the 2DQuant kit protein assay (GE Healthcare Biosciences). The supernatants were stored in aliquots at -80 °C or directly loaded for isoelectric focusing. Proteins were extracted from each treatment on three independent occasions. 2.4. IEF and SDS-PAGE. IPG strips (24 cm, nolinear pH 3-10, GE Healthcare Biosciences Immobiline DryStrips) were rehydrated overnight with 450 µL of IEF buffer containing an estimated 500 µg of protein and focused using a Ettan IPGphor Multiphor III (GE Healthcare Biosciences) at 20 °C, applying the following program: 30 V for 6 h, 60 V for 6 h, 100 V for 1 h, 200 V for 1 h, 500 V gradient for 1 h, 1000 V gradient for 30 min, 5000 gradient for 2 h, 10 000 V for 1 h, and 10 000 V for 60 000 V h. After focusing, proteins were reduced in equilibration buffer (6 M urea, 29.3% w/v glycerol, 2% SDS, and 1.5 M Tris-HCl, pH 8.8) containing 1% w/v DTT for 15 min followed by alkylation in a separate incubation for an additional 15 min in equilibration buffer containing 2.5% w/v IAA replacing DTT. The strips were then transferred to 12.5% SDS-PAGE gels for 2-DE using Amersham’s Ettan DALTsix gel system with SDS electrophoresis buffer [250 mM Tris (pH 8.3), 1.92 M glycine, and 1% w/v SDS)] and a 2 W/gel for 20 min and a 16.7 W/gel for 5 h. At least three gels were run for each sample. 2.5. Image Analysis. Protein spots were detected by Coomassie Blue G-250 staining.17 After the 2-DE run, gel cassettes were opened and the gels were carefully removed and placed in fixing solution (10% v/v acetic acid, 40% ethanol) for 1.5 h. Gels were then stained using Coomassie solution (0.1% w/v CBB G-250, 1.6% w/v o-phosphoric acid, 10% (NH4)2SO4, and 20% ethanol) overnight. The gels were then washed with deionized water until the gel background was clear. Stained gels were scanned and calibrated using labscan 5 software (Amersham Biosciences). Image analysis was performed using ImageMaster 2D Platinum 7 (GE Healthcare Amersham Biosciences). Detection and matching of the protein spots was facilitated with the use of software and re-evaluated by visual inspection, focusing on spots with altered expression. Four biological replications were used for the analysis, and three well separated gels of each sample were used to create “replicate groups”. Statistic (analysis sets using one-way ANOVA analysis, P < 0.05), quantitative (individual spot volumes were normalized against total spot volumes for a given gel), and qualitative

research articles

Proteomic Analysis of Proteins in Eisenia fetida a

Table 1. The List of Primers Used for qRT-PCR gene

spot no.

gene symbol

sense primer (5-3)

antisense primer (5-3)

lysenin lombricine kinase intermediate filament protein coelomic cytolytic factor 1 gelsolin lumbrokinase antimicrobial peptide lumbricin-1 fibrinolytic protease β-actin

311/84 342/134 477/224 133/449 463/181 38 445 24

D85846 AB008013 X83734 AF030028 AJ504727 EU167736 AF060552 DQ836917 reference gene

TGGGCTGTGCTACGATGATG CCTCTGTCCATCTTCAACTCCAC AGAAAAGCGCAAAAGGTCCG TCTTCGACGCCAGAGGAAACT TCTTCATCCTTGACCTTGGCC TTGGATCCTGCAACGGTGATA CATACTCGGAACGCAAGAACC AAACTGTGCCACCTGTGTCCT CGCCTCTTCATCGTCCCTC

ACCAACCACTTCCAAAATCCAC CTCCGCCAGTTCCTCTCTTCT CCTTTCTTCCGGTGTTTTCCA TTGCGCTTGTAGACTCGGATG GCAGATACTGCATCGCCTTGA CCCCATGAAGTAACACCAGCA TTTGATGACCTTCTGCGGTG CGACAGCAGCGAAACCAA GAACATGGTCGTGCCTCCG

a The eight genes identified as a defense response to bacterium, innate immune response, or thrombolytic genes. Changes in gene expression at the mRNA level of eight genes are shown in Figure 5.

(a spot present in only one of two distinct samples) “analysis sets” were performed using ImageMaster 2D Platinum 7 (GE Healthcare Amersham Biosciences). Spots showing at least a 1.75-fold increase or 0.7-fold decrease over those from E. coli O157:H7 treatment samples at one or more time points and statistically different at a significance level of P < 0.05 based on one-way ANOVA analysis (assuming equal variance) were selected for further analysis. 2.6. Protein Identification and Database Search. Protein spots of significance were manually excised from the 2-D gels. The gel plugs were washed three times with ultrapure water, destained twice with 100 mM NH4HCO3 in 50% acetonitrile, reduced with 10 mM DTT in 100 mM NH4HCO3 for 1 h at 56 °C and incubated with 40 mM IAA in 100 mM NH4HCO3 for 45 min, dried twice with 100% acetonitrile, and digested overnight at 37 °C with 0.1 mg/mL trypsin (Promega, Madison, WI, USA) for 1:40 (w/w) (trypsin/protein) according to the manufacturer’s instructions. The resulting peptides were subjected to sequential extraction (3 times at 37 °C) with 8 µL each of 5% trifluoroacetic acid (TFA) for 1 h, 2.5% TFA in 50% ACN for 1 h, and 100% ACN for 1 h. Extracted peptides were dried in a vacuum centrifugation and stored at -80 °C. The digests were mixed with a saturation solution of R-cyano-4-hydroxycinnamic acid in 50% acetonitrile/0.1% trifluoroacetic acid and spotted on the MALDI target plate. Peptide masses were measured using a MALDI-TOF/TOF ultraflex mass spectrometer on a 4800 MALDI-TOF/TOF Proteomics analyzer (Applied Biosystems, Foster City, CA) with 355-nm neodymium-doped yttrium aluminum garnet (Nd: YAG) laser and 20-kV accelerated voltage. After MS, 20 parent mass peaks with 700-3200 Da of mass range and maximum signal/noise values were selected for MS/MS analysis. For MS spectra, the peaks were calibrated by trypsin autodigestion peaks and smoothed. The signal-to-noise criterion was set to 25 or greater. The monoisotopic masses were processed for identification. For MS/MS spectra, the peaks were calibrated by default and smoothed. All peaks were deisotoped. Protein identification was achieved through MS/MS data searches using GPS Explorer Workstation (Applied Biosystems, Foster City, CA) with the in-house searching engine MASCOT and the searching taxonomy of Metazoa against the NCBInr database. The database was set to NCBInr (released on August 1, 2009; 9 363 125 sequences; 3 207 829 265 residues). Search parameters included: (1) MS/MS ion search, as the type of search; (2) trypsin, as the enzyme of protein digestion; (3) carbamidomethyl (C) and oxidation (M), as variable modifications; (4) MONOISOTOPIC, as mass value; (5) unrestricted, as protein mass; (6) ( 50 ppm, as peptide mass tolerance; (7) 0.25 Da, as fragment mass tolerance; (8) 1, as max missed cleavages; and

(9) MALDI-TOF/TOF, as instrument type. The identification was considered with MASCOT score, total ion C.I. % and additional experimental confirmation of Mr and pI of the protein based on the 2-DE studies. The minimum MASCOT score was 45, the minimum total ion C.I. % for positive identification was 95%, and the minimum number of unique peptides was 1. The experimental Mr of the protein spots was calculated using ladder. The experimental pI of the protein spots was calculated from their position on the IEF strips as mentioned by the manufacturer’s specification (GE Healthcare). Function characterization of the identified proteins was determined by the Gene Ontology Tool (http://www.uniprot. org). Because of probably the lack of resolution sometimes associated with 2-DE, the MASCOT searches for some protein spots occasionally gave several confident identifications.18 Only the top scoring proteins identified within each sample are reported in the Results section. 2.7. RNA Extraction and Quantitative Real-Time PCR Analysis. Total RNAs from whole earthworm (normal and stressed) were extracted from 50 mg of whole earthworm tissue using the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). Analysis of differential gene expression was performed by SYBR Green I quantitative Real-Time PCR (SYBR qRT-PCR). The extraction was repeated three times for each sample (three biological replicates). The samples were treated with Rnasefree DNase I (TaKaRa Biotechnology, Dalian, China) to remove any contamination from DNA. After this step, we checked the purity and integrity of RNA by electrophoresis on 1% agarose gels stained with ethidium bromide. We then checked the purity of RNA by PCR without retrotranscription using β-actin gene-specific primers. Two microliters of each RNA sample was used for constructing cDNA using the PrimeScript RT reagent kit (Perfect Real Time; TaKaRa Biotechnology). Primer pairs were designed using Primer Express 3.0 software (Table 1). Gene expression was assayed using the ABI PRISM 7900HT Fast. Quantitative Polymerase chain reactions (qPCRs) were performed using SYBR Premix Ex TaqII (Perfect Real Time; TaKaRa Biotechnology) with a two-step reaction. Reaction conditions (25 µL volumes) were optimized by changing the primer concentration and annealing temperature to minimize primer-dimer formation and to increase PCR efficiency. qPCR reactions were always carried out in triplicate wells, the following PCR profile: 2 min at 95 °C, 30 s at 95 °C, (5 s at 95 °C, 30 s at 60 °C) × 40, and 15 s at 95 °C, 1 min at 60 °C, and 15 s at 95 °C for recording of a melting curve. The lack of primer-dimer or nonspecific product accumulation was checked by melt-curve analysis. Each run included standard dilutions and negative reaction controls. The mRNA expression level of each gene of interest Journal of Proteome Research • Vol. 9, No. 12, 2010 6549

research articles

Figure 1. Growth rates (%) of Eisenia fetida exposed to Escherichia coli O157:H7. Results are expressed as mean ( standard error. Statistical significance levels (compared to the control group): *p < 0.05, **p < 0.01. CK: Eisenia fetida unexposed to Escherichia coli O157:H7; O157: Eisenia fetida exposed to Escherichia coli O157:H7.

and of the E. fetida β-actin mRNA, chosen as a housekeeping gene, was determined in parallel for each sample. Results were expressed as the normalized ratio of mRNA level of each gene of interest to housekeeping gene using the difference between threshold cycle values or ∆∆Ct method of Livak and Schmittgen (2001).19 Ct values for individual target genes were calculated, and the ∆Ct average for the housekeeping gene (β-actin mRNA) was treated as an arbitrary constant and used to calculate ∆∆Ct values for all samples. The induction fold, resulting in three independent pools for each target gene, was averaged and the SEM was calculated. 2.8. Quantitative Data Analysis. For all data (protein amounts, 2-DE volumes, and transcript accumulation), means were compared using ANOVA (P < 0.05) using SPSS 13.0 (SPSS Inc., Chicago, IL, USA). For image analysis quantification, homogeneity of the variance was tested. Analysis of the protein temporal expression pattern was performed using the Gene Cluster 3.0 and JavaTreeview software.20 Centered correlation was used as a measure of the distance between the different proteins, while clustering was performed using the average linkage method. The relationship among the objects (protein spots) was visualized using JavaTreeview software.

3. Results 3.1. Growth Rate of the Earthworms. Throughout the entire test period, all of the earthworms survived. From day 7 to 14, the relative growth rate demonstrated a significant difference among individual earthworms in each group (Figure 2; p < 0.05). The average growth rate of the groups increased significantly to about 6.8% on day 7 (p < 0.05), and decreased significantly to about 0.5% on day 14 (p < 0.05). On days 21 and 28, the average growth rate of the groups decreased significantly to about -1.5% and -6.4%, respectively, compared with the control group (p < 0.01). 3.2. Identification of Earthworm Proteins Related to E. coli O157:H7 Exposure. Representative 2-DE gels of protein spots from untreated earthworms and from earthworms after E. coli O157:H7 (107 CFU g-1) treatment at days 7, 14, 21, and 28 are shown in Figure 2. In total, 1500 protein spots detectable on the 2-DE gel are shown in Figure 2. The pattern revealed a broad distribution of spots between a pI range of 3-10 with apparent molecular mass between 14 and 120 kDa. Examina6550


Wang et al. tion of the 2-DE gels with the ImageMaster 2D Platinum 7 software revealed 124 protein spots with significant intensity changes, >1.75-fold, between E. coli O157:H7-stress and control samples at least one time point (p < 0.05). Of them, 52 spots, corresponding to 42 different proteins, were successfully identified by matrix-assisted laser desorption/ionizationtandem time-of-flight mass spectrometry (MALDI-TOF/TOFMS; Table 3). As an example, the results of spot 342 are shown in Supporting Information Figure 1. In total, 11 up-regulated spots and 41 down-regulated spots (Table 2) were identified. Some of the identified proteins were annotated either as unknown and hypothetical proteins or as proteins without a specific function in the database. To gain functional information about these proteins, we evaluated their functional characterization using the gene ontology tool available at http://www.uniprot.org and their accession numbers. 3.3. Cluster Analysis. The groups of proteins that responded to E. coli O157:H7 stress and the global protein changes occurring during E. coli O157:H7 stress were further compared using a tree-clustering method (Figure 3). For this purpose, quantitative variations in protein abundance between treatments were represented by log2 ratios of normalized volume obtained by the ImageMaster 2D Platinum 7 analysis. The expression profiles of the protein spots were further analyzed using the Gene Cluster 3.0 and Java Treeview software. This clustering method revealed two protein expression groups that were defined by taking groups of closely related expression patterns (correlation coefficient > 0.8), labeled I and II in Figure 3. Group I comprised all the protein spots that displayed an increased accumulation in E. fetida after E. coli O157:H7 stress, while group II contained all the protein spots that displayed a decreased accumulation after E. coli O157:H7 stress. 3.4. Changes in Protein Content during E. coli O157:H7 Stress. To reliably determine quantitative changes in protein expression, and thus, overcome errors due to technical and biological variations, proteins were identified as regulated if they were found to have an average expression level >1.75× those of control samples for at least one time point at a statistical significance level of p < 0.05. We found that 124 proteins met these criteria and manually excised their spots from a prepared 2-DE gel for further analysis by MALDI-TOF/ TOF-MS. All the tandem mass spectrometry (MS/MS) spectra were analyzed using the MASCOT software against the NCBInr database. In total, 20 spots with sequence coverage between 1% and 49% were identified by matching against a protein sequence from earthworm species. Because the earthworm genome is not yet fully sequenced, the other spots were identified by comparison with sequences from different organisms (Supporting Information Table 2). The identified proteins were classified into seven major groups, according to their biological function as shown in Figure 5. (i) Metabolism (41%), 22 spots: three associated with oxidation reduction/gonad development/regulation of GTPase activity, three involved in catalytic activity, eight associated with sugar binding/calcium ion binding/ATP binding/nucleic acid binding/actin binding, two associated with proteolysis, one associated with kinase activity, five associated with tricarboxylic acid cycle/lombricine kinase activity/glycolysis/glucose metabolic process, and one associated with aldehyde dehydrogenase (NAD) activity. (ii) Stress response (12%), six spots: one associated with the superoxide metabolic process, two associated with oxidation/ reduction, two associated with oxygen transport, one associated

Proteomic Analysis of Proteins in Eisenia fetida

research articles

Figure 2. Coomassie 2-DE profiles of total E. fetida proteins; 500 µg of proteins were separated onto first-dimensional pH 3-10 nonlinear IPG strips and second dimensional 12.5% vertical slab gels. MW, BioRad 2-DE molecular weight standards. 2-DE maps of earthworm proteins extracted from 7, 14, 21, and 28 days of both control and Escherichia coli O157:H7 treatment in whole earthworm. Arrows represent significant (p < 0.05) increased and decreased protein abundance reproducibly quantified in two independent biological experiments compared to nonexposed control earthworm, respectively. The arrows on the control gels show spot positions of down-regulated proteins and the O157:H7 gels show spot positions of up-regulated proteins for each day. Journal of Proteome Research • Vol. 9, No. 12, 2010 6551

research articles

Wang et al.

Table 2. Number of Changed Protein Spots from Whole Earthworm E. fetida after 7, 14, 21, and 28 Days Treatment with 107 CFU g-1 Soil of Escherichia coli O157:H7 in the Artificial Soila treatment time (day)

up-regulated (spot no.)

down-regulated (spot no.)

7 14 21 28

4 (591, 250, 425, 125) 5 (187, 245, 46, 181, 466) 0 2 (33, 155)

9 (598, 28, 40, 39, 41, 249, 156, 311, 342) 12 (406, 186, 133, 453, 97, 439, 254, 257, 263, 213, 234, 135) 10 (276, 219, 189, 38, 23, 4, 16, 122, 510, 144) 10 (224, 449, 445, 438, 115, 451, 24, 48, 423, 26)

a For details, see Section 2. Proteins (spot no. in parentheses) were changed by a factor of at least a 1.75-fold increase or 0.7-fold decrease over those from E. coli O157:H7 treatment samples at one or more time points and statistically different at a significance level of P < 0.05 based on one-way ANOVA analysis (assuming equal variance). For further details of single spots, see Table 3 and Supporting information Table 2.

with response to stress, one associated with actin binding, and one associated with the response to oxidative stress. (iii) Innate immunity (12%), six spots: three associated with lysenin which functions as a innate immunity response to bacterium, two associated with coelomic cytolytic factor-1 (CCF-1), which functions as a innate immunity response to microbial stimulation, and one associated with antimicrobial peptide lumbricin 1, which has an antimicrobial function. (iv) Transcription (6%), two spots: one associated with regulation of transcription and one spot being associated with transcription. (v) Regulation of translation (2%), one spot. (vi) Predicted and hypothetical proteins (17%), nine spots: representing predicted and hypothetical proteins: one spot associated with proteolysis, one spot associated with glycolysis, and seven spots could not be identified unambiguously. (vii) Other functions (10%), five spots: one associated with structural molecule activity, one associated with intermediate filament, one associated with cytoskeleton, and two spots could not be identified unambiguously. At 7 days after E. coli O157:H7 exposure, four proteins were up-regulated whereas nine decreased (Table 2 and histograms in Table 3). This effect was less pronounced after 14, 21, and 28 days of treatment. In total, E. coli O157:H7 stress caused a 1.75- to 2.3-fold up-regulation of 11 protein spots. The protein identification, abundance, and details are summarized in Table 3. No other protein changed by a factor >1.75. 3.5. Correlation between mRNA and Protein. To correlate the protein level with the corresponding mRNA level of the E. coli O157:H7-stress genes, we performed quantitative real-time polymerase chain reaction of three independent biological replicates. The list of genes and the sequences of the forward and reverse primers are summarized in Table 1. We analyzed the expression of eight genes, which were identified as innate immunity response to bacterium, innate immune response, or thrombolytic genes.13,21,22 In this comparison, we observed a low correlation between the changes in gene and protein expression levels under normal and stress conditions, except for lombricine kinase (AB008013); the remaining seven changed independently (Figure 4).

4. Discussion During evolution, earthworms have developed effective innate immunity mechanisms against pathogen infections. The concentration of naturally occurring bacteria is usually about 6 × 105 CFU/mL of coelomic fluid or 0.9 × 105 CFU per worm of average size.23 Infected earthworms typically excrete 102-105 CFU or even sometimes >108 CFU of E. coli O157:H7 per gram of feces.2,3,24 In the present experiment, E. coli O157:H7 was applied to the artificial soil at a concentration of approximately 107 CFU/g.2 In many studies about the effects of pathogens on 6552


earthworms, the growth rate is widely used as an index in environmental monitoring and risk assessment.25 Such experimental settings make the present study relevant in addressing microorganism pollution of the soil as an increasing environmental threat to human health. We found that antioxidant systems and antimicrobial immune function may play important roles in the defense of the earthworm E. fetida against E. coli O157:H7.13 Recently, several proteomic studies regarding invertebrates as models for the investigation of the effects of toxins have been described.26,27 However, no reported data are available on ecotoxicoproteomics analysis in earthworms. The pattern of protein expression in the earthworm E. fetida exposed to E. coli was evaluated by 2-DE and Coomassie staining methods. We visualized and quantified approximately 1500 protein spots from control and E. coli O157:H7-stressed organisms at days 7, 14, 21, and 28. We found that the expression levels of most of the proteins were unaltered. One hundred and twenty-four protein spots with an absolute variation of at least 1.75-fold (P < 0.05) during at least one time point between the control and E. coli O157:H7-stressed samples were further identified using MALDI-TOF/TOF-MS analysis. We found that these spots could be classified into seven major categories according to their putative biological role (Figure 5): metabolism, stress, innate immunity, transcription, translation, predicted and hypothetical roles, and other roles. Several proteins produced multiple spots, most likely caused by posttranslational modifications (PTMs). In most cases, the shifts in position were horizontal, suggesting that the modifications only affected the pI, without changes in molecular mass.28 Their functional significance is discussed below. 4.1. Metabolism. Not surprisingly, 41% of the regulated proteins identified as being responsive to E. coli O157:H7 stress were involved in metabolism. Fibrinolytic proteases (spot 24), enzymes involved in proteolysis, dissolve blood fibrin clots and are important chemotherapeutic agents.29 Down-regulation of fibrinolytic protease 0 suggests a role in dissolving blood fibrin clots in innate immunity responses. Fibrinolytic enzymes, also collectively named lumbrokinases (LKs), are heat-stable and show a broad range of optimal pHs. LKs are fibrin-specific proteases that show high activity in the presence or absence of plasminogen and have been reported to possess therapeutic benefits for the treatment of thromboembolic symptoms, because of their potent activity and stability.30,31 Downregulation of triosephosphate isomerase (TIM; spot 26), an enzyme involved in glycolysis, may help to produce less energy in various innate immunity processes. Lombricine kinase (spots 342 and 135), which plays key roles in the coupling of energy production and use in animals was down-regulated during E. coli O157:H7 stress.32 The down-regulation of lombricine kinase suggests an energy decrease during E. coli O157:H7 stress. Spot (250), corresponding to glyceraldehyde 3-phosphate dehydro-

research articles

Proteomic Analysis of Proteins in Eisenia fetida Table 3. Identification of Differentially Displayed Proteins on 2-DE Gels match ID

40 24 38 26 257

234 342 135 250

28 156 186 466 97

46 23

189

219

425 187 115

451

NCBI acc. no.

protein name and (species)

XP_001991352 GH12605 (Drosophila grimshawi) ABG68022 fibrinolytic protease 0 (Eisenia fetida) ABW04905 Lumbrokinase (Eisenia fetida) P00941 triosephosphate isomerase (TIM) (Latimeria chalumnae) NP_776603 succinate dehydrogenase complex, subunit A, flavoprotein (Bos taurus) NP_082408 phosphoglucomutase 2 (Mus musculus) O15991 lombricine kinase (Eisenia fetida) O15991 Lombricine kinase (Eisenia fetida) NP_496192 GPD (glyceraldehyde 3-phosphate dehydrogenase) family member (gpd-1) (Caenorhabditis elegans) CAD29317 SCBP3 protein (Lumbricus terrestris) XP_001991352 GH12605 (Drosophila grimshawi) NP_733183 CG31075 (Drosophila melanogaster) NP_001025898 dihydrolipoamide dehydrogenase (Gallus gallus) NP_496237 GPD (glyceraldehyde 3-phosphate dehydrogenase) family member (gpd-1) (Caenorhabditis elegans) BAA36395 29-kDa galactose-binding lectin (Lumbricus terrestris) P80164 myosin regulatory light chain, striated muscle, 25 kDa isoform (Lumbricus terrestris) NP_001041043 GDI (RabGDP dissociation Inhibitor) family member (gdi-1) (Caenorhabditis elegans) NP_498081 aldehyde dehydrogenase family member (alh-1) (Caenorhabditis elegans) AAY63974 aldehyde dehydrogenase isoform A (Lysiphlebus testaceipes) AAY63974 aldehyde dehydrogenase isoform A (Lysiphlebus testaceipes) CAA83537 ewam (actin-modulator of the earthworm) (Lumbricus terrestris) CAA83537 EWAM (actin-modulator of the earthworm) (Lumbricus terrestris)

423

AAC60522

39

P13579

41

P13579

manganous superoxide dismutase; MnSOD (Bos taurus) extracellular globin-4 (globin IV) (erythrocruorin) (globin A) (Lumbricus terrestris) extracellular globin-4 (globin IV) (erythrocruorin) (globin A) (Lumbricus terrestris)

theor. Mw/pI

Metabolism 50.1/8.9

exp. Mw/pI

MASCOT SCa maximum score (%) fold change

-1.8 Day 7 -1.9 Day 28 -1.7 Day 21 -1.7 Day 28 -1.7

20/5.7

94

3

23.6/5.3

24/5.5

222

11

24.6/4.7

24/5.2

195

10

26.6/6.2

28/6.6

212

8

73.2/7.3

73/7.2

159

3

61.5/6.3

61/6.3

77

3

41.8/7.7

45/6.9

1020

35

42/7.7

45/8.7

236

5

36.6/7.7

39/7.7

204

6

19.7/4.8

19/4.9

72

5

50.1/8.9

30/5.7

94

3

52.9/6.2

57/6.2

99

3

54.6/8.2

55/8.0

94

2

36.5/7.7

39/8.2

237

8

29.2/6.7

30/8.8

73

2

21.9/4.9

21/5.3

227

15

Day 28 +1.9 Day 14 -1.9

50.4/5.4

53/5.4

201

8

Day 21 -1.9

55.3/7.1

57/6.2

89

2

Day 28 -2.2

36.6/6.0

46/6.4

189

4

36.6/6.0

57/6.2

202

4

41.6/6.1

49/6.3

235

7

Day 21 +1.7 Day 7 +1.9 Day 14 -1.7

41.6/6.1

52/6.3

259

9

Day 28 -2.1

Day 14 -1.9 Day 14 -1.9 Day 14 -2.0 Day 14 +.8

Day 7 -1.7 Day 7 -3.1 Day 21 -∞ Day 28 +2.0 Day 14 -2.0

molecular function

nucleic acid binding proteolysis kinase activity glycolysis tricarboxylic acid cycle

glucose metabolic process ATP binding lombricine kinase activity glycolysis

calcium ion binding nucleic acid binding aldehyde dehydrogenase (NAD) activity proteolysis gonad development

sugar binding calcium ion binding

regulation of GTPase activity oxidation reduction

oxidation reduction oxidation reduction actin binding

actin binding

Day 28 Stress-related 24.7/8.7 24/6.5

138

6

-∞

superoxide metabolic process

17.5/6.0

21/6.2

109

21

Day 28 +∞

oxygen transport

17.5/6.0

21/6.2

109

21

Day 14 -2.2

oxygen transport

Day 21 Journal of Proteome Research • Vol. 9, No. 12, 2010 6553

research articles

Wang et al.

Table 3. Continued match ID

NCBI acc. no.

406 AAQ94359 181 CAD43405 155 ABC48926

311 O18425 453 O18423 122 O18423 133 AAC35887 449 AAC35887 445 AAC64517

16

Hsp90 (Opistophthalmus carinatus) gelsolin-like protein (Lumbricus terrestris) catalase (Eisenia fetida) lysenin-related protein 2 (Eisenia fetida) lysenin (Eisenia fetida) lysenin (Eisenia fetida) coelomic cytolytic factor 1 (Eisenia fetida) coelomic cytolytic factor 1 (Eisenia fetida) antimicrobial peptide lumbricin1 (Lumbricus rubellus)

BAC24089

orthodenticle (Achaearanea tepidariorum) 439 NP_001037041 activating transcription factor (Bombyx mori) 33 NP_009204 prohibitin 2 isoform 2 (Homo sapiens) 438 P23232

theor. Mw/pI

protein name and (species)

83.4/4.9

exp. MASCOT SCa maximum Mw/pI score (%) fold change

85/5.2

438

8

411.8/6.1 56/6.1

114

3

-1.9 Day 14 +2.3 Day 7 +2.1 Day 28

response to stress

-3.0 Day 7 -∞ Day 7 -4.4 Day 7 -2.4 Day 28 -∞ Day 28 -∞ Day 7

antibacterial activities against B. megaterium defense response to bacterium defense response to bacterium carbohydrate metabolic process carbohydrate metabolic process defense response to bacterium

-1.7 Day 21 -∞ Day 14 +1.7 Day 28

regulation of transcription regulation of transcription transcription

signal transduction

16.7/6.2

63/6.8

64

7

Defense-related 34.2/5.6

52/5.8

64

3

33.5/5.9

39/6.0

80

6

33.5/5.9

45/5.9

122

49

44.3/4.6

43/4.8

664

28

44.5/4.6

44/5.0

780

30

8.8/6.6

48/6.0

101

Transcription 34.1/9.6

17/7.5

70

4

26.3/9.2

20/6.8

51

3

33.3/9.8

30/5.4

61

3

Translation 37.9/5.8

40/5.8

60

3

-∞ Day 28

58

3

90

0

47

4

78

7

49

1

48

2

-1.7 Day 14 -1.9 Day 7 -1.7 Day 21 -2.1 Day 28 -∞ Day 28 -1.7

60

2

47

3

98

2

50/6.6

58

21

68.9/5.6

76/5.7

93

1

53.5/5.8

64/6.2

104

3

73.9/5.8

39/5.8

45

39.5/9.0

39/6.8

263

guanine nucleotide-binding protein subunit beta

(Loligo forbesi) Predicted and Hypothetical Proteins 254 XP_001625620 predicted protein 33.3/5.2 55/6.5 (Nematostella vectensis) 4 XP_001503943 PREDICTED: cardiomyopathy associated 5 43.9/4.7 17/7.1 (Equus caballus) 48 XP_001201155 PREDICTED: similar to cathepsin C 30.2/4.8 34/5.7 (Strongylocentrotus purpuratus) 263 XP_001377440 PREDICTED: similar to Titin (Connectin) 1190.2/6.8 55/7.6 (Monodelphis domestica) 249 EEB18649 conserved hypothetical protein 74.9/5.6 35/5.4 (Pediculus humanus corporis) 144 XP_001925548 PREDICTED: similar to neuronal guanine 93.6/9.2 48/6.3 nucleotide exchange factor (Sus scrofa) 125 XP_002114482 hypothetical protein TRIADDRAFT_28083 53.8/8.6 27/5.9 (Trichoplax adhaerens) 510 EEB17625 conserved hypothetical protein 37.5/9.5 39/6.2 (Pediculus humanus corporis) 245 XP_001642026 predicted protein 62.1/6.2 64/6.5 (Nematostella vectensis) 213 XP_001970855 GG10870 (Drosophila erecta) 224 CAA58705 intermediate filament protein (Lumbricus terrestris) 276 XP_780584 similar to phosphoglucomutase-1 (glucose phosphomutase 1) (PGM 1), partial (Strongylocentrotus purpuratus) 591 CAA60122 neurofilament protein NF70 (Helix aspersa) 598 AAH89125 LOC733147 protein (Xenopus laevis)

Other 6.2/9.2

15

molecular function

Day 14 +1.9 Day 7 -∞ Day 28 -∞ Day 7 -1.8 Day 14 -1.7 Day 28 -2.6 Day 7 +1.7 Day 7 -2.3 Day 7

actin binding response to oxidative stress

proteolysis

glycolysis

structural molecule activity

intermediate filament cytoskeleton

a SC is the abbreviation for sequence coverage. The infinity symbol ∞ represents a gel spot unique to a particular condition, -∞ represents the gel spot being present only in the control sample, while +∞ represents the gel spot being present only in the E. coli O157:H7-exposed sample.

6554



research articles

Figure 3. Clustered expression ratios of the 52 differentially accumulated proteins representative of one biological experiment. In this dendrogram, quantitative information is transmitted using a color scale. The green color (-1) indicates the greatest decrease and the red color (+ 1) shows the greatest increase in accumulation. Dark boxes (0) indicate no changes in protein abundance compared to control conditions. Each row of colored boxes is representative of a single protein and each ratio per treatment is represented using a single column.

genase (GPD) family member GPD-1, was up-regulated significantly by 1.8-fold, on day 7 (P < 0.01). In apoptotic cells, GPD expression is 3-fold higher than in non-apoptotic cells.33 Spot 28, corresponding to soluble calcium-binding protein (SCBP) 3 protein was down-regulated on day 7. SCBPs were isolated from the body wall muscle of the earthworm Lumbricus terrestris.34 Little is known about their function, although they likely act as soluble relaxing factors in fast muscle, similar to parvalbumins.35 Spot 156, identified as GH12605, which molecular function is nucleic acid binding, was down-regulated significantly (p < 0.01). Spot 186, identified as CG31075, which prossesses aldehyde dehydrogenase activity, was down-regulated significantly (p < 0.01). Recently, proteomic analysis of

mitochondria from rats revealed that aldehyde dehydrogenase 2 is an enzyme the activation of which correlated with reduced ischemic heart damage in rodent models.36 Spot 466, identified as dihydrolipoamide dehydrogenase, was up-regulated significantly on day 14 (p < 0.01). Dihydrolipoamide dehydrogenase is a flavoprotein with broad specificity for electron acceptors and can transfer electrons from NAD(P)H to oxygen and catalyze transhydrogenase reactions with pyridine nucleotides.37,38 Spot 46, identified as 29-kDa galactose-binding lectin was upregulated significantly on day 14 (p < 0.01). Hirabayashi’s group cloned the cDNA of a novel galactose-binding lectin from annelida L. terrestris, and found that this protein, named 29kDa galactose-binding lectin, had multiple copies of the short Journal of Proteome Research • Vol. 9, No. 12, 2010 6555

research articles

Wang et al.

Figure 4. Function comparison of eight genes at the mRNA and protein level in the earthworm E. fetida during Escherichia coli O157: H7 stress. Quantitative real-time PCR was performed using gene-specific primers (Table 1) and SYBR Green Real-Time Master Mix. The protein and mRNA log2 values of the ratio of treated samples (7, 14, 21, and 28 days during Escherichia coli O157:H7 stress) to the control reference (CK) are plotted. The relative gene expression was evaluated using the ∆∆Ct method.

consensus amino acid motif G-X-X-Q-X-W.39 Many of the proteins listed in this superfamily have carbohydrate recognition domains. Spot 23 identified as myosin regulatory light chain, striated muscle, 25 kDa isoform, was down-regulated significantly on day 21 (p < 0.01). Ca2+-binding studies indicate the presence of one high-affinity binding site specific for Ca2+ in each myosin head. This binding site is likely located on LC25, because isolated LC25 demonstrates Ca2+ binding similar to that of myosin.40 Spot 189 identified as RabGDP dissociation inhibitor (GDI) family member gdi-1 was down-regulated significantly on days 21 and 28 (p < 0.01). RabGDI is a key regulator of Rab/Ypt GTPases that controls the distribution of active GTP and inactive GDP-bound forms between the membrane and cytosol.41 Spots 115 and 451, identified as actinmodulator of the earthworm (EWAM), were down-regulated significantly on day 28 (p < 0.01). EWAM from the obliquely striated body wall muscle of annelid L. terrestris was the first modulator isolated from nonvertebrate muscle tissue and has been demonstrated to form complexes with two molecules of G-actin.42 6556


4.2. Stress-related (12%). Spot 423, identified as manganous superoxide dismutase (MnSOD), was first up-regulated significantly on day 7 (p < 0.05), then was down-regulated significantly on days 14 and 28 (p < 0.05 and p < 0.01, respectively). MnSOD scavenges for potentially toxic superoxide radicals produced in the mitochondria.43 Reactive oxygen species (ROS), produced as a byproduct of aerobic metabolism or stress to oxidants, become toxic or lethal when they damage nucleic acids, proteins, and membrane lipids. To resist these potentially damaging reactive oxygen species, aerobic organisms have developed an enzymatic protection system consisting of antioxidant enzymes, including the superoxide dismutases (SODs).44 Spots 39 and 41 were identified as extracellular globin-4 (also called erythrocruorin), which was down-regulated significantly, on day 7. Its structure revealed details of its interfaces, including key side-chain interactions that are likely to contribute to ligand-linked allosteric transitions, and demonstrated the crowded nature of the ligand-binding pockets. Thus, these results provide the first step toward elucidating the structural basis for the strong allosteric properties of Lumbricus


Figure 5. Functional classification of the proteins identified by MALDI-TOF/TOF-MS and found to be regulated in the earthworm E. fetida after Escherichia coli O157:H7 stress. The relative percentages of proteins in each category are shown.

erythrocruorin.45 Erythrocruorins are readily retained in the vascular system as freely dissolved entities. Each complex possesses significant oxygen-binding capacity, and subunits can be arranged to permit cooperative oxygen binding and additional regulatory features that enhance oxygen transport.46 One spot (spot 406) that was down-regulated significantly on day 14 (p < 0.01) in the earthworm E. fetida following E. coli O157:H7 stress was identified as heat shock protein (Hsp90). Hsp90 is known to be involved in the inhibition of stressinduced apoptotic cell death and is a ubiquitous molecular chaperone found in eubacteria and all branches of Eukarya.47 It plays a central role in cellular signaling because it is essential for maintaining the activity of key signaling factors, including steroid hormone receptors and protein kinases.48 Spot 181 corresponding to gelsolin-like protein, was up-regulated significantly on day 7 (p < 0.01), suggesting a complex mechanism concerning these proteins in response to E. coli O157:H7 stress. Gelsolins all likely play an important role in altering the contractile function and motility of vascular smooth muscle.49 The increase of gelsolins may be one mechanism used by earthworms to defend against and eliminate the E. coli O157: H7. Spot 155, corresponding to catalase, was up-regulated significantly on day 28 (p < 0.01), and is important for peroxide and radical detoxification,50 which are antioxidant protective mechanisms that may cause an increase in catalase activity. This suggests that earthworms may require increased antioxidant protection, or alternatively, catalase activity may have been induced after E. coli O157:H7 stress. Catalase activity was studied as a possible biomarker of toxic stress in earthworms.51 4.3. Innate Immunity-related (12%). Three spots (311, 453, 122) that were down-regulated correspond to lysenin and lysenin-related proteins, which have been shown to cause contraction of rat vascular smooth muscles.52 Yamaji et al. demonstrated that lysenin binds specifically to sphingomyelin (SM) among the phospholipids found in the cell membrane,53 and that lysenin, after incubation with SM-liposomes, loses its lethal activity.54 The cytotoxic effects of lysenin may be due to membrane damage that is caused by the binding of lysenin to SM in the plasma membrane.53 Two proteins (spots 133, 449) that were down-regulated after E. coli O157:H7 stress were

research articles identified as coelomic cytolytic factor 1 (CCF-1). CCF-1 may represent a conserved key recognition molecule of innate defense in earthworms.8 In annelids, CCF is a defense molecule with functional analogies to mammalian tumor necrosis factor (TNF), which plays an important role in regulating immune responses.6,55 CCF binds efficiently to different pathogenassociated molecular patterns,56 triggering the activation of the prophenoloxidase (proPO) cascade, which is an important invertebrate defense mechanism. Engelmann et al. (2005) demonstrated that earthworm innate immunity depended on small and large leukocytes (coelomocytes) that synthesized and secreted humoral antimicrobial molecules (e.g., lysenin, CCF, and lumbricin I).22 Coelomocytes contain several lysosomal enzymes involved in phagocytosis and a pattern-recognition molecule (CCF) that may trigger the prophenoloxidase cascade, a crucial innate immune response. Down-regulation of CCF may be caused by a defect in the innate immune system. However, it is now known that certain innate immune functions are down-regulated at the level of control of pathogen recognition receptors (PRRs) during infection.57 Recently, some of the PPRs involved in the innate immune responses to PAMPs were identified.58 The three spots (311, 453, 122) corresponding to lysenin and the two spots (133, 449) corresponding to CCF were most likely caused by PTMs. One protein (spot 445) that was down-regulated after E. coli O157:H7 stress was identified as the antimicrobial peptide lumbricin1 on days 7, 21, and 28 (p < 0.01). Antimicrobial peptides have been considered to be a universal host defense tool used by earthworms against microbial infection. Lumbricin 1 has been isolated and characterized from the earthworm L. rubellus, which showed antimicrobial activity in vitro against a broad spectrum of microorganisms without hemolytic activity.59 4.4. Transcription (6%). One of the proteins down-regulated after E. coli O157:H7 stress is orthodenticle (spot 16). In invertebrates, the orthodenticle gene is involved in regulating morphogens by activating transcription.60-62 We identified one transcription factor (spot 439), activating transcription factor (ATF1) that was down-regulated significantly on day 14 (p < 0.01). In human metastatic melanoma cells, ATF1 is upregulated. Disruption of ATF1 activity in these cells using an inhibitory ATF1 antibody fragment suppressed their tumorigenicity and metastatic potential in nude mice.63 4.5. Translation (2%). One of the proteins involved in translation that was down-regulated significantly on days 21 and day 28 (p < 0.01) after E. coli O157:H7 stress is guanine nucleotide-binding protein subunit beta (spot 438). This protein, which functions as a modulator in various transmembrane signaling pathways, is required for GTPase activity.64 Our observation of down-regulated guanine nucleotide-binding protein subunit beta may represent a response of E. coli O157: H7 stress to accommodate decreased GTP binding. 4.6. Predicted and Hypothetical Proteins (17%). One predicted protein spot (spot 48), similar to cathepsin C, was downregulated significantly on days 21 and 28 (p < 0.01). McKim et al. (1992) found that apo-metallothionein was degraded by cathepsins and less apo-metallothionein substrate is available to the protease and degradation decreases.65 The downregulated of cathepsin C means apo-metallothionein upregulated, more apo-metallothionein is not available to the protease and degradation increases. Down-regulation of cathepsin C may indicate earthworms under toxic stress. One predicted protein spot (spot 4) cardiomyopathy associated 5 was down-regulated significantly on days 7 (p < 0.01). One Journal of Proteome Research • Vol. 9, No. 12, 2010 6557

research articles predicted protein spot (spot 263), similar to titin (connectin), was down-regulated significantly on days 28 (p < 0.01). One predicted protein spot (spot 144), similar to neuronal guanine nucleotide exchange factor, was down-regulated significantly on days 14 (p < 0.01). 4.7. Other Proteins (10%). Spot 224, corresponding to an intermediate filament protein, was significantly down-regulated on day 28 (p < 0.01). Djabali et al. found that the intracellular state of alpha B-crystallin correlated directly with the remodeling of the intermediate filament network in response to stress.66 Spot 276, similar to phosphoglucomutase-1 (PGM 1), was significantly down-regulated on days 7 and day 21 (p < 0.01). PGM1 is an important regulatory enzyme in cellular glucose utilization and energy homeostasis.67 Kinetic measurements of PGM activity indicate that PGM preferentially converts glucose1-phosphate to glucose-6-phosphate even when the two substrates are present in equimolar concentrations in the reaction.68 PGM activity has been reported to be inhibited under oxidizing conditions and activated by dithiothreitol and reduced thioredoxin A.69 4.8. Correlation between mRNA and Protein. Our results demonstrated that mRNA levels did not correlate well with protein levels. The disparity between the relative expression levels of mRNA and their corresponding proteins has also been reported elsewhere.70-72 The lack of correspondence between mRNA and protein levels may occur because mRNA levels usually peak before protein levels. Posttranscriptional and posttranslational modifications, as well as differential mRNA and protein degradation rates, may also contribute to these discrepancies.72

Conclusions In the present study, the molecular responses to E. coli O157: H7 stress were investigated at the protein level in the earthworm E. fetida. In total, 124 proteins were significantly different between the exposed and control groups for at least one time point, and 52 proteins were identified by MALDI-TOF/TOFMS and database searching. These proteins were involved in several processes, including transcription, translation, the tricarboxylic acid cycle, and the glucose metabolic process, and may work cooperatively to establish a new homeostasis under E. coli O157:H7 stress. The identification of novel E. coli O157: H7 stress proteins provides not only new insight into E. coli O157:H7 stress responses but also a starting point for further investigation of their functions using genetic and other approaches. Abbreviations: 2-DE, two-dimensional electrophoresis; IEF, isoelectric focusing; MALDI, matrix-assisted laser desorption/ ionization; TOF, time of flight; MS, mass spectrometry; Mr, relative molecular mass; pI, isoelectric point; SDS, sodium dodecylsulfate; qPCR, quantitative real-time polymerase chain reaction; IAA, iodoacetamide.

Acknowledgment. This work was supported financially by the National Natural Science Foundation of China (Nos. 30470220 and 30770275), the National Key Technology R&D Program in the 11th Five year Plan of China (2008BADA7B04), the Key Beijing Discipline of Ecology (XK10019440), and the Graduate Research and Innovation Project of China Agricultural University Basic R&D Operating Expenses (kycx09068). Supporting Information Available: Supplemental Table 2 provides the accession numbers corresponding to the 6558


Wang et al. protein spots shown in Figure 2. Also included are the expression profiles of these individual protein spots, the putative names of proteins, the organism from which the protein was identified, the MASCOT score, together with the sequence coverage, the values for experimental and theoretical pI, and the molecular mass. Supplemental Table 1 is the table for the peptide information of MS/MS data. Supplemental Figure 1 is an example of spot 342 via MALDI-TOF/TOF-MS. This material is available free of charge via the Internet at http://pubs.acs.org.

References (1) Tarr, P. I. Escherichia coli O157:H7: clinical, diagnostic and epidemiological aspects of human infection. Clin. Infect. Dis. 1995, 20 (1), 1–10. (2) Fukushima, H‘.; Seki, R. High numbers of Shiga toxin-producing Escherichia coli found in bovine faeces collected at slaughter in Japan. FEMS. Microbiol. Lett. 2004, 238 (1), 189–197. (3) Hutchison, M. L.; Walters, L. D.; Avery, S. M.; Synge, B. A.; Moore, A. Levels of zoonotic agents in British livestock manures. Lett. Appl. Microbiol. 2004, 39 (2), 207–214. (4) Winfield, M. D.; Groisman, E. A. Role of non-host environments in the lifestyles of Salmonella and Escherichia coli. Appl. Environ. Microbiol. 2003, 69 (7), 3687–3694. (5) Manning, S. D.; Motiwala, A. S.; Springman, A. C.; Qi, W. H.; Lacher, D. W.; Ouellette, L. M.; Mladonicky, J. M.; Somsel, P.; Rudrik, J. T.; Dietrich, S. E.; Zhang, W.; Swaminathan, B.; Alland, D.; Whittam, T. S. Variation in virulence among clades of Escherichia coli O157: H7 associated with disease outbreaks. Proc. Natl. Acad. Sci. U.S.A. 2008, 105 (12), 4868–4873. (6) Ko¨hlerova´, P.; Beschin, A.; Silerova´, M.; Baetselier, P. D.; Bilej, M. Effect of experimental microbial challenge on the expression of defense molecules in Eisenia foetida earthworm. Dev. Comp. Immunol. 2004, 28 (7-8), 701–711. (7) Field, S. G.; Kurtz, J.; Cooper, E. L.; Michiels, N. K. Evaluation of an innate immune reaction to parasites in earthworms. J. Invertebr. Pathol. 2004, 86 (1-2), 45–49. (8) Cooper, E. L.; Roch, P. Earthworm immunity: a model of immune competence. Pedobiologia 2004, 47 (5-6), 673–688. (9) Reinecke, S. A.; Reinecke, A. J. The comet assay as biomarker of heavy metal genotoxicity in earthworms. Arch. Environ. Contam. Toxicol. 2004, 46 (2), 208–215. (10) Cooper, E. L.; Kauschke, E.; Cossarizza, A. Digging for innate immunity since Darwin and Metchnikoff. BioEssays 2002, 24 (4), 319–333. (11) Kumar, A. G.; Sekaran, G. Enteric pathogen modification by anaecic earthworm Lampito mauritii. J. Appl. Sci. Environ. Manage. 2005, 9 (1), 15–17. (12) OECD. OECD guideline for testing chemicals. Section 2: effects on biotic systems. Method, Earthworm, acute toxicity tests, Paris, France. 1984, p 207. (13) Liu, X. L.; Sun, Z. J.; Wang, C.; Sun, Z. T.; He, C. K. Growth and stress responses of the earthworm Eisenia fetida to Escherichia coli O157:H7 in an artificial soil. Microb. Pathog. 2009, 46 (5), 266– 272. (14) Stein, E. A.; Cooper, E. L. The role of opsonins in phagocytosis by coelomocytes of the earthworm Lumbricus terrestris. Dev. Comp. Immunol. 1981, 5 (3), 415–425. (15) Martin, N. A. Toxicity of pesticides to Allobophora caliginosa (Oligochaeta: Lumbricidae). N. Z. J. Agric. Res. 1986, 29, 699–706. (16) Wang, X.; Chang, L.; Wang, G. C.; Sun, Z. J.; Ma, H. B.; Sun, Q.; Li, J. Protein extraction from the earthworm Eisenia fetida for 2-DE. Proteomics 2010, 10 (5), 1095–1099. (17) Carpentier, S. C.; Witters, E.; Laukens, K.; Deckers, P.; Swennen, R.; Panis, B. Preparation of protein extracts from recalcitrant plant tissues: An evaluation of different methods for two-dimensional gel electrophoresis analysis. Proteomics 2005, 5 (10), 2497–2507. (18) Lim, H.; Eng, J.; Yates, J. R.; Tollaksen, S. L.; Giometti, C. S.; Holden, J. F.; Adams, M. W. W.; Reich, C. I.; Olsen, G. J.; Hays, L. G. Identification of 2D-gel proteins: A comparison of MALDI/TOF peptide mass mapping to mu LC-ESI tandem mass spectrometry. J. Am. Soc. Mass Spectrom. 2003, 14 (9), 957–970. (19) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods 2001, 25 (4), 402–408. (20) de Hoon, M. J. L.; Imoto, S.; Nolan, J.; Miyano, S. Open source clustering software. Bioinformatics 2004, 20, 1453–1454.

research articles

Proteomic Analysis of Proteins in Eisenia fetida (21) Kiyokawa, E.; Makino, A.; Ishii, K.; Otsuka, N.; Yamaji-Hasegawa, A.; Kobayashi, T. Recognition of sphingomyelin by lysenin and lysenin-related proteins. Biochemistry 2004, 43 (30), 9766–9773. (22) Engelmann, P.; Cooper, E. L.; Ne´meth, P. Anticipating innate immunity without a Toll. Mol. Immunol. 2005, 42 (8), 931–942. (23) Dales, R. P.; Kalac, Y. Phagocytic defence by the earthworm Eisenia foetida against certain pathogenic bacteria. Comp. Biochem. Physiol. 1992, 101 (3), 487–490. (24) Besser, T. E.; Richards, B. L.; Rice, D. H.; Hancock, D. D. Escherichia coli O157:H7 infection of calves: infectious dose and direct contact transmission. Epidemiol. Infect. 2001, 127, 555–560. (25) Edwards, C. A.; Bater, J. E. The use of earthworms in environmental management. Soil Biol. Biochem. 1992, 24 (12), 1683–1689. (26) Choi, J.; Ha, M. H. Effect of cadmium exposure on the globin protein expression in 4th instar larvae of Chironomus riparius Mg. (Diptera: Chironomidae): an ecotoxicoproteomics approach. Proteomics 2009, 9 (1), 31–39. (27) Zeis, B.; Lamkemeyer, T.; Paul, R. J.; Nunes, F.; Schwerin, S.; Koch, M.; Schu ¨ tz, W.; Madlung, J.; Fladerer, C.; Pirow, R. Acclimatory responses of the Daphnia pulex proteome to environmental changes. I. Chronic exposure to hypoxia affects the oxygen transport system and carbohydrate metabolism. BMC Physiol. 2009, 9, 7. (28) Huang, F.; Fulda, S.; Hagemann, M.; Norling, B. Proteomic screening of salt-stress-induced changes in plasma membranes of Synechocystis sp. strain PCC 6803. Proteomics 2006, 6 (3), 910– 920. (29) Park, Y.; Ryu, E.; Kim, H.; Jeong, J.; Kim, J.; Shim, J.; Jeon, S.; Jo, Y.; Kim, W.; Min, B. Characterization of antithrombotic activity of lumbrokinase-immobilized Polyurethane valves in the total artificial heart. Artif. Organs 1999, 23 (2), 210–214. (30) Nakajima, N.; Mihara, H.; Sumi, H. Characterization of potent fibrinolytic enzymes in earthworm: Lumbricus rubellus. Biosci. Biotech. Biochem. 1993, 57, 1726–1730. (31) Lee, C. K.; Shin, J. S.; Kim, B. S.; Cho, I. I. H.; Kim, Y. S.; Lee, E. B. Antithrombotic effects by oral administration of novel proteinase fraction from earthworm Eisenia andrei on venous thrombosis model in rats. Arch. Pharm. Res. 2007, 30 (4), 475–480. (32) Ellington, W. R. Evolution and physiological roles of phosphagen systems. Annu. Rev. Physiol. 2001, 63, 289–325. (33) Dastoor, Z.; Dreyer, J. L. Potential role of nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase in apoptosis and oxidative stress. J. Cell Sci. 2001, 114 (9), 1643–1653. (34) Huch, R.; D’Haese, J.; Gerday, C. A soluble calcium-binding protein from the terrestrial annelid Lumbricus terrestris L. J. Comp. Physiol. B 1988, 158, 325–334. (35) Piront, A.; Lebacq, J.; Gillis, J. M. Physiological properties of calcium binding proteins from crayfish muscle. J. Muscle Res. Cell Motil. 1980, 1, 468–469. (36) Chen, C. H.; Budas, G. R.; Churchill, E. N.; Disatnik, M. H.; Hurley, T. D.; Mochly-Rosen, D. Activation of aldehyde dehydrogenase-2 reduces ischemic damage to the heart. Science 2008, 321 (5895), 1493–1495. (37) Massey, V.; Veeger, C. Studies on the reaction mechanism of lipoyl dehydrogenase. Biochim. Biophys. Acta 1961, 48 (1), 33–47. (38) Igamberdiev, A. U.; Bykova, N. V.; Ens, W.; Hill, R. D. Dihydrolipoamide dehydrogenase from porcine heart catalyzes NADHdependent scavenging of nitric oxide. FEBS Lett. 2004, 568 (1), 146– 150. (39) Hirabayashi, J.; Dutta, S. K.; Kasai, K. Nobel galactose-binding proteins in annelida: characterization of 29-kDa tandem-repeat type lectins from the earthworm Lumbricus terrestris. J. Biol. Chem. 1998, 273 (23), 14450–14460. (40) Serwe, M.; Meyer, H. E.; Craig, A. G.; Carlhoff, D.; D’haese, J. Complete amino acid sequence of the regulatory light chain of obliquely striated muscle myosin from earthworm Lumbricus terrestris. Eur. J. Biochem. 1993, 211 (1-2), 341–346. (41) Alory, C.; Balch, W. E. Organization of the Rab-GDI/CHM superfamily: The functional basis for choroideremia disease. Traffic 2001, 2 (8), 532–543. (42) D’Haese, J.; Hinssen, H. Isolation and characterization of a Ca2+activated actin-modulating protein from obliquely striated muscle. J. Comp. Physiol. B 1987, 157 (5), 615–623. (43) Wong, G. H.; Goeddel, D. V. Induction of manganous superoxide dismutase by tumor necrosis factor: possible protective mechanism. Science 1988, 242 (4880), 941–944. (44) Dash, B.; Metz, R.; Huebner, H. J. Molecular characterization of two superoxide dismutases from Hydra vulgaris. Gene 2007, 387 (1-2), 93–108. (45) Strand, K.; Knapp, J. E.; Bhyravbhatla, B.; Royer, W. E. Crystal structure of the hemoglobin dodecamer from lumbricus erythro-

(46)

(47)

(48)

(49)

(50)

(51)

(52)

(53) (54)

(55)

(56) (57)

(58) (59)

(60) (61) (62) (63)

(64)

(65) (66)

cruorin: allosteric core of giant annelid respiratory complexes. J. Mol. Biol. 2004, 344 (1), 119–134. Royer, W. E.; Omartian, M. N.; Knapp, J. E. Low resolution crystal structure of Arenicola erythrocruorin: Influence of coiled coils on the architecture of a megadalton respiratory protein. J. Mol. Biol. 2007, 365 (1), 226–236. Pandey, P.; Saleh, A.; Nakazawa, A.; Kumar, S.; Srinivasula, S. M.; Kumar, V.; Weichselbaum, R.; Nalin, C.; Alnemri, E. S.; Donald, K.; Kharbanda, S. Negative regulation of cytochrome c-mediated oligomerization of Apaf-1 and activation of procaspase-9 by heat shock protein 90. EMBO. J. 2000, 19 (16), 4310–4322. Zhao, R.; Davey, M.; Hsu, Y. C.; Kaplanek, P.; Tong, A.; Parsons, A. B.; Krogan, N.; Cagney, G.; Mai, D.; Greenblatt, J.; Boone, C.; Emili, A.; Houry, W. A. Navigating the chaperone network: An integrative map of physical and genetic interactions mediated by the Hsp90 chaperone. Cell 2005, 120 (5), 715–727. McGregor, E.; Kempster, L.; Wait, R.; Gosling, M.; Dunn, M. J.; Powell, J. T. F-actin capping (CapZ) and other contractile saphenous vein smooth muscle proteins are altered by hemodynamic stress. Mol. Cell. Proteomics 2004, 3 (2), 115–124. Ram, R. J.; VerBerkmoes, N. C.; Thelen, M. P.; Tyson, G. W.; Baker, B. J.; Blake II, R. C.; Shah, M.; Hettich, R. L.; Banfield, J. F. Community proteomics of a natural microbial biofilm. Science 2005, 308 (5730), 1915–1920. Brown, P. J.; Long, S. M.; Spurgeon, D. J.; Svendsen, C.; Hankard, P. K. Toxicological and biochemical responses of the earthworm Lumbricus rubellus to pyrene, a non-carcinogenic polycyclic aromatic hydrocarbon. Chemosphere 2004, 57 (11), 1675–1681. Sekizawa, Y.; Kubo, T.; Kobayashi, H.; Nakajima, T.; Natori, S. Molecular cloning of cDNA for lysenin, a novel protein in the earthworm Eisenia foetida that causes contraction of rat vascular smooth muscle. Gene 1997, 191 (1), 97–102. Yamaji, A.; Sekizawa, Y.; Emoto, K.; Sakuraba, H.; Inoue, K.; Kobayashi, H.; Umeda, M. Lysenin, a novel sphingomyelin-specific binding protein. J. Biol. Chem. 1998, 273 (9), 5300–5306. Kobayashi, H.; Ohtomi, M.; Sekizawa, Y.; Ohta, N. Toxicity of coelomic fluid of the earthworm, Eisenia foetida, to vertebrates but not invertebrates: probable role of sphingomyelin. Comp. Biochem. Physiol. PTC 2001, 128 (3), 401–411. Zhang, X. M.; Luan, W.; Jin, S. J.; Xiang, J. H. A novel tumor necrosis factor ligand superfamily member (CsTL) from Ciona savignyi: molecular identification and expression analysis. Develop. Comp. Immunol. 2008, 32 (11), 1362–1373. Beschin, A.; Bilej, M.; Brys, L.; Torreele, E.; Lucas, R.; Magez, S.; Baetselier, P. D. Convergent evolution of cytokines. Nature 1999, 400, 627–628. Zarember, K. A.; Godowski, P. J. Tissue expression of human tolllike receptors and differential regulation of toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J. Immunol. 2002, 168, 554–561. Pashine, A.; Valiante, N. M.; Ulmer, J. B. Targeting the innate immune response with improved vaccine adjuvants. Nat. Med. 2005, 11, 63–68. Cho, J. H.; Park, C. B.; Yoon, Y. G.; Kim, S. C. Lumbricin I, a novel proline-rich antimicrobial peptide from the earthworm: purification, cDNA cloning and molecular characterization. Biochim. Biophys. Acta 1998, 1408 (1), 67–76. Gao, Q.; Finkelstein, R. Targeting gene expression to the head: the Drosophila orthodenticle gene is a direct target of the Bicoid morphogen. Development 1998, 125, 4185–4193. Schro¨der, R. The genes orthodenticle and hunchback substitute for bicoid in the beetle Tribolium. Nature 2003, 422, 621–625. Lynch, J. A.; Brent, A. E.; Leaf, D. S.; Pultz, M. A.; Desplan, C. Localized maternal orthodenticle patterns anterior and posterior in the long germ wasp Nasonia. Nature 2006, 439, 728–732. Jean, D. C.; Tellez, C.; Huang, S.; Davis, D. W.; Bruns, C. J.; McConkey, D. J.; Hinrichs, S. H.; Bar-Eli, M. Inhibition of tumor growth and metastasis of human melanoma by intracellular antiATF-1 single chain Fv fragment. Oncogene 2000, 19 (22), 2721– 2730. Johnson, M. D.; Yu, L. R.; Conrads, T. P.; Kinoshita, Y.; Uo, T.; Matthews, J. D.; Lee, S. W.; Smith, R. D.; Veenstra, T. D.; Morrison, R. S. Proteome analysis of DNA damage-induced neuronal death using high throughput mass spectrometry. J. Biol. Chem. 2004, 279 (25), 26685–26697. McKim, J. M.; Choudhuri, S.; Klaassen, C. D. Appl. Pharmacol 1992, 116 (1), 117–124. Djabali, K.; de Nechaud, B.; Landon, F.; Portier, M. M. AlphaBcrystallin interacts with intermediate filaments in response to stress. J. Cell Sci. 1997, 110 (21), 2759–2769.

Journal of Proteome Research • Vol. 9, No. 12, 2010 6559

research articles (67) Gururaj, A.; Barnes, C. J.; Vadlamudi, R. K.; Kumar, R. Regulation of phosphoglucomutase 1 phosphorylation and activity by a signaling kinase. Oncogene 2004, 23, 8118–8127. (68) Gao, H.; Leary, J. A. Kinetic measurements of phosphoglucomutase by direct analysis of glucose-1-phosphate and glucose-6-phosphate using ion/molecule reactions and Fourier transform ion cyclotron resonance mass spectrometry. Anal. Biochem. 2004, 329 (2), 269– 275. (69) Lindahl, M.; Florencio, F. J. Thioredoxin-linked processes in cyanobacteria are as numerous as in chloroplasts, but targets are different. Proc. Natl. Acad. Sci. U.S.A. 2003, 100 (26), 16107–16112. (70) Tian, Q.; Stepaniants, S. B.; Mao, M.; Weng, L.; Feetham, M.; Doyle, M. J.; Yi, E. C.; Dai, H. Y.; Thorsson, V.; Eng, J.; Goodlett, D.; Berger, J. P.; Gunter, B.; Linseley, P. S.; Stoughton, R. B.; Aebersold, T.;

6560


Wang et al. Collins, S. J.; Hanlon, W. A.; Hood, L. E. Integrated genomic and proteomic analyses of gene expression in mammalian cells. Mol. Cell. Proteomics 2004, 3 (10), 960–969. (71) Yan, S. P.; Zhang, Q. Y.; Tang, Z. C.; Su, W. A.; Sun, W. N. Comparative proteomics analysis provides new insights into chilling stress responses in rice. Mol. Cell. Proteomics 2006, 5 (3), 484–496. (72) Torabi, S.; Wissuwa, M.; Heidari, M.; Naghavi, M. R.; Gilany, K.; Hajirezaei, M. R.; Omidi, M.; Yazdi-Samadi, B.; Ismail, A. M.; Salekdeh, G. H. Comparative proteome approach to decipher the mechanism of rice adaptation to phosphorous deficiency. Proteomics 2009, 9 (1), 159–170.

PR1007398

Comparative Proteomic Analysis of Differentially Expressed Proteins

Recommend Documents