Complex Consisting of Î²-Glucan and Antigenic Peptides with

Subscriber access provided by UNIVERSITY OF THE SUNSHINE COAST

Article

Complex Consisting of #-glucan and Antigenic Peptides with Cleavage Site for Glutathione and Aminopeptidases Induces Potent Cytotoxic T Lymphocytes Shinichi Mochizuki, Hiromi Morishita, and Kazuo Sakurai Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.7b00159 • Publication Date (Web): 24 Jul 2017 Downloaded from http://pubs.acs.org on July 31, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Complex Consisting of β-glucan and Antigenic Peptides with Cleavage Site for Glutathione and Aminopeptidases Induces Potent Cytotoxic T Lymphocytes

Shinichi Mochizuki†,*, Hiromi Morishita†, Kazuo Sakurai†,*

†

Department of Chemistry and Biochemistry, The University of Kitakyushu, 1-1,

Hibikino, Wakamatsu-ku, Kitakyushu, Fukuoka, 808-0135, Japan.

*Corresponding author. Department of Chemistry and Biochemistry, The University of Kitakyushu, 1-1, Hibikino, Wakamatsu-ku, Kitakyushu, Fukuoka, 808-0135, Japan. Tel: +81-93-695-3203; Fax: +81-93-695-3390 E-mail address: [email protected], [email protected]

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract The efficient induction of antigen-specific immune responses requires not only promotion of the uptake of antigens and adjuvant molecules into antigen-presenting cells, but also control of their intracellular behavior. We previously demonstrated that the β-glucan schizophyllan (SPG) can form complexes with CpG oligonucleotides with attached dA40 (CpG-dA/SPG), which can accumulate in macrophages in the draining inguinal lymph nodes and induce strong immune responses. In this study, we prepared various conjugates comprising antigenic peptide (OVA257-264) and dA40, and made complexes with SPG. The conjugates with a disulfide bond between OVA257-264 and dA40 were easily cleaved by glutathione. The resultant peptides with a hydrophobic amino acid at C-terminal end was recognized by puromycin-insensitive leucine aminopeptidase (PILS-AP), which trims antigenic peptide precursors and prepares peptides of eight or nine amino acids in length, which is the optimal length for binding to major histocompatibility complex (MHC)-I. The conjugate exposed to such enzymes induced a high antigen presentation level. The antigen presentation level was almost the same before and after the complexation with SPG. Immunization with a mixture of dA-OVA257-264/SPG and CpG-dA/SPG induced high antigen-specific cytotoxic T-lymphocyte activity at a much lower peptide dose than in previous studies. These results can be strongly ascribed to not only the cell-specific delivery by SPG, but also the control of the intracellular behavior by the introduction of cleavage sites. Therefore, peptide-dA/SPG complexes could be used as potent vaccine antigens for the treatment of cancers and infectious diseases.


Page 2 of 31

Page 3 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction

Immunotherapy has become one of the attractive strategies for antitumor treatment. The induction of tumor-specific cytotoxic T-lymphocytes (CTLs), which recognize and eradiate tumor cells, is essential for the treatment of tumors.1,2 Antigen-presenting cells (APCs) such as macrophages and dendritic cells play a crucial role in the initiation of T cell immune responses.3-5 Inflammatory signals by adjuvant molecules induce mature APCs, followed by enhanced expression of major histocompatibility complex (MHC)-I and II molecules and costimulatory molecules. APCs present the internalized antigenic peptides on either an MHC class I molecule to induce CD8+ T-cell responses or an MHC-II molecule to induce CD4+ T-cell responses.6-8 Peptide-based vaccines have been exclusively studied by identifying MHC-bound peptides derived from various tumor-associated antigens (TAAs) that are presented on the surface of tumor cells.9,10 Although many clinical trials of peptide-based vaccines have been carried out since the first clinical trial in 1996 by Hu et al.11 using a melanoma antigen gene-I-derived peptide, few vaccines exhibit sufficient therapeutic efficacy. One of the main reasons for this is the nonspecific uptake of antigenic peptides and adjuvant molecules by other cells rather than APCs. Therefore, the development of an efficient antigen and/or adjuvant delivery system for APCs is required for clinical applications of cancer vaccine therapies. Schizophyllan (SPG) is a β-glucan that comprises a main (1→3)-β-D-glucan chain and a (1→6)-β-D-glycosyl side chain that links to the main chain at every three glucose residues. SPG forms a stoichiometric complex with specific homo nucleotides



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

such as poly(C) or poly(dA) via interactions between its two main chain glucoses with one nucleotide base.12,13 We previously studied SPG as a delivery carrier of therapeutic oligonucleotides such as antisense ODN (AS-ODN) or short interfering RNA with an attached dA 40mer (dA40) and achieved efficient gene silencing in animal models of fulminant hepatitis and bowel disease.14-17 For achievement of peptide delivery to APCs, we prepared a peptide with dA40 and made a complex with SPG in the same manner as the preparation of DNA/SPG complex.18 When adjuvant molecule CpG-ODN conjugated with dA40 (CpG-dA) and antigenic peptide OVA257-264 conjugated with dA40 (OVA257-264-dA) were complexed with SPG and administered at the tail base in mice, strong antigen-specific cellular immune responses were induced. These powerful CTL activities are attributed to uptake mediated by SPG into macrophages and dendritic cells in drain lymph nodes. Because β-1,3-glucans are present on fungal cell walls and are recognized by the innate immune system,19,20 the SPG complexes could also be easily recognized by immune cells. The key strategy for the induction of potent CTL activities in vivo is not only to promote the uptakes of TAAs and adjuvant molecules into APCs, but also to incorporate the TAAs and adjuvants into the processing machinery in cells. In our delivery system, although we did not know whether the complexed dA40 dissociates from the complex, we confirmed that the antisense and siRNA portions can be recognized by target molecules such as mRNA and RNA-induced silencing complex without dissociation from the complex.14,17 Therefore, we can conclude that ODNs or peptides complexed with SPG move to biological pathways after internalization into APCs. However, the orientation of ODN relative to dA40 is vital for recognition by target molecules. For example, CpG-ODN attached to dA40 at the 3’ end induced strong


Page 4 of 31

Page 5 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


adjuvant activities for human peripheral blood mononuclear cells, while CpG-ODN attached to dA40 at the 5’end did not.21 In general, antigenic peptides of 8-10 amino acid residues are suitable for stable assembly with MHC class I molecules and can be loaded onto them with the help of peptidases such as endoplasmic reticulum (ER)-associated aminopeptidase 1 (ERAP1).22,23 ERAP1 is an IFN γ-inducible ER-localized aminopeptidase expressed in many tissues, and is known to trim antigenic peptide precursors and prepare peptides of eight or nine amino acids in length, which is the optimal length for binding to an MHC-I molecule.24,25 The first step of the peptide trimming is binding of the peptide precursors to ERAP1 through the C-terminal hydrophobic residue. After the removal of additional N-terminal residues, antigenic products (eight to nine residues) are released.22,25 In our previous study, antigenic peptides were conjugated with dA40 by click chemistry between the eight-amino-acid C-terminal end and the 5′-terminal end of nucleic acid.18 As the peptides are too short to bind to aminopeptidases and are not considered to be released from the conjugates having the linkage containing a triazole ring in endosomal compartments or cytosol by enzymes, the conjugation procedure seems to be disadvantage for peptide loading on MHC class I molecules. In this study, we show optimization of the peptide/SPG complex (Figure 1) for the induction of strong immune responses by changing the peptide length, sequence, and manner of conjugation between antigenic peptide and dA40.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. A schematic illustration showing a complex consisting of dA-OVA257-264 and SPG. A triple-stranded complex is formed from one DNA and two SPG strands with the interactions between two SPG main-chains glucoses (mG) and one dA.

Results

Antigenic peptide presentation on macrophages To induce cellular immune responses, antigens have to be presented on an MHC class I molecule. At 1 hour after the addition of peptides to peritoneal macrophages, OVA peptide (SIINFEKL, amino acids 257-264 from the OVA; OVA257-264) was detected on MHC class I molecules (Figure 2A). Regarding the conjugation with an amino group modified dA40, we prepared two types of antigenic peptide; OVA257-264 with a cysteine reside at N-terminal end (C-OVA257-264) or at the C-terminal end (OVA257-264-C). The peptides C-OVA257-264 and C-OVA254-264 (OVA254-264; QLESIINFEKL, amino acids 254-264 from the OVA) were detected on MHC class I molecules with time, while OVA257-264-C was not. These results indicate that OVA257-264, which shows high affinity for an MHC class I molecule, can directly bind to it on the cell surface by replacement with other antigens, resulting in staining with antibody even after 1 hour; in contrast, the peptides with cysteine at the N-terminal


Page 6 of 31

Page 7 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


end cannot fit in the groove in MHC class I molecules located on the cell surface. After they were incorporated into the cells and treated with aminopeptidases, they turned out to be a suitable length for loading on MHC class I molecules, resulting in their appearance on the cell surface. We did not observe a difference in the level of presentation between C-OVA257-264 and C-OVA254-264, indicating that the length of nine amino acids used in this study is sufficient for trimming by aminopeptidases. After proteolytic cleavage of the cysteine residue, the resulting eight amino acids OVA257-264 were loaded onto an MHC class I molecule. OVA257-264-C was not observed on an MHC class I molecule even at 24 hours after peptide addition, indicating that it cannot be recognized as a substrate by aminopeptidases in cells. At 24 hours, the cells were also subjected to flow cytometric analysis. Treatment with OVA257-264, C-OVA257-264, and C-OVA254-264 induced substantial MHC class I-OVA257-264 presentation in almost all cells (Figure 2B). The fluorescence intensities for C-OVA257-264 and C-OVA254-264 were slightly higher than that for OVA257-264. These results suggest that OVA257-264 of eight amino acids doesn’t have to be processed by aminopeptidases and can directly bind to MHC class I molecule. The longer constructs need to be taken up, processed and loaded into newly synthesized MHC I molecules. The efficacy of antigen presentation upon being subjected to intracellular processing is higher than that when bound to MHC class I molecules directly. Considering the treatment with aminopeptidases in cells, the N-terminal end can be more desirable as a position for conjugation to dA40 than the C-terminal end.



(A) OVA257-264-C

OVA257-264 Bright-field

Anti-H-2Kb/ SIINFEKL-PE

Bright-field

C-OVA257-264


Bright-field


C-OVA254-264 Bright-field


1h

4h

24 h

(B) PBS

OVA257-264

OVA257-264-C

C-OVA257-264

C-OVA254-264

Counts

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 31

H-2Kb/SIINFEKL

Figure 2. Antigen presentation after treatment with antigenic peptides. (A) Cells were supplemented with the peptides and incubated for the indicated times. The level of antigenic peptide presentation was analyzed with a fluorescence microscopy after staining with PE-labeled anti-mouse OVA257-264 peptide bound to H-2Kb antibody. The bar represents 50 µm. (B) At 24 hours, cells were also subjected to flow cytometric analysis. Cells left untreated (black line) and those treated with the indicated peptides (red line) are shown.

Preparation of peptide-modified dA40 We prepared dA-OVA257-264 by crosslinking between dA40 with an amino group

at

the

5’-terminus

and

C-OVA257-264

using

a

succinimidyl

6-[3’-(2-pyridyldithio)-propionamido] hexanoate (LC-SPDP); Figure 3A. After the


Page 9 of 31

pyridyldithiol-activated dA40 (see Materials and methods) had been mixed with C-OVA257-264, the reaction mixture was analyzed with HPLC. From the chromatograms obtained by monitoring UV absorbance at 260 nm before and after the reaction, the peak of dA40 shifted to a later elution time, indicating the increment in hydrophobicity by conjugation with the hydrophobic peptide OVA257-264 (Figure. 3B). After fractionation with HPLC and freeze-drying, we confirmed the high purity of the obtained dA-OVA257-264, from the observed lack of unreacted dA40, and that the molecular weight matched the desirable level, from time-of-flight mass spectrometer analysis (Supporting Information Figure S1). We also obtained other types (A)

(B)

NH2

N

H2 N

O

N O

O H H

300

O

N

N

H

H

O O

P

P

O O

O-

N H

O

H N

CH C CH2

S

N H

S

H O-

O

40

dA-OVA257-264 dA40

CSIINFEKL

peptide

Abs (260 nm) / a.u.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


250 200 150 100

50 0 5

10

OVA257-264-dA

15

20

25

30

Elusion time / min SIINFEKLC

dA40

dA-OVA254-264 dA40

CQLESIINFEKL

dA40

CQLESIINFEKK

dA-OVA254-264(miss)

Figure 3. Preparation of peptide-modified dA40. (A) The schematic illustration showing the prepared peptide-modified dA40 conjugates and the chemical structure between peptide and dA40. (B) HPLC chromatograms of dA40 with an amino group at the 5’ end



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 31

(dotted line) and the reaction mixture with C-OVA257-264 after purification by fractionation (solid line). of

peptide-modified

dA40,

denoted

as

OVA257-264-dA,

dA-OVA254-264,

and

dA-OVA254-264(miss), in a similar manner (Figure 3A).

Cleavage of peptide modified with dA40 by glutathione and aminopeptidase PILS-AP After uptake into cells, peptides attached to dA40 can’t be directly presented on the cell surface without being freed in the form of peptide from the conjugate. In this study, because the linkage between peptide and dA40 contains a disulfide bond, the conjugate can be cleaved by glutathione other than aminopeptidases in the cytosol, resulting in the production of dA40 with SPDP and peptide. All conjugates linked with SPDP were cleaved by treatment with glutathione, while the conjugate linked with azide alkyne Huisgen cycloaddition26 was not at all (Figure 4A). When dA-OVA257-264 was treated with puromycin-insensitive leucine aminopeptidase (PILS-AP)27 for 24 hours, a weak lower-molecular-weight band containing DNA was observed (Figure 4B). This indicates that PILS-AP trimmed the peptide, resulting in the production of a trimmed peptide and the remains. A long peptide-modified dA40, dA-OVA254-264, was completely trimmed. dA-OVA254-264(miss), which has a lysine residue instead of a leucine residue at the C-terminal end, did not work as a substrate, indicating that a hydrophobic amino acid at the C-terminal end is vital for recognition by PILS-AP. Other conjugates linked by click chemistry and cysteine at the C-terminal end did not change before and after the treatment with PILS-AP. These results suggest that the conjugates linked with SPDP


Page 11 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


are divided into dA40 with SPDP and a peptide by glutathione in the cytosol. After such cleavage, peptides with cysteine at the N-terminal end are certainly trimmed by (A)

glutathione

-

-

- +

-

+ - +

- +

-

+

-

-

- +

-

+ - +

- +

-

+

(B)

PILS-AP

Figure 4. Cleavage of the conjugates by glutathione (A) and PILS-AP (B). The indicated conjugates were treated with glutathione or PILS-AP and separated by polyacrylamide gel electrophoresis.

aminopeptidase. The conjugates with a long peptide over 12 amino acids can be directly treated with aminopeptidases without cleavage by glutathione. This corroborates the results of the high level of antigen presentation of the peptides with cysteine at the N-terminal end (Figure 2).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Antigenic peptide presentation by peptide modified with dA40 and the complex on macrophages To evaluate the antigen presentation by treatment with the prepared conjugates, we added the conjugates to peritoneal macrophages plated at 1.5 × 105 cells/well in 48-well plates. After 24 hours, the cells were stained with anti-mouse OVA257-264 peptide bound to H-2Kb antibody, and the fluorescence of the cells was observed. As expected, most of the cells treated with dA-OVA257-264 and dA-OVA254-264 presented the peptides on MHC class I molecules (Figure 5A). The treatment with OVA257-264–dA and dA-OVA254-264(miss) did not induce peptide presentation on the cell surface. Considering the results of the treatment with PILS-AP, the efficacy of trimming is dependent on the peptide length. However, the efficacy of antigen presentation for short peptide OVA257-264 is almost the same as that for OVA254-264 (Figure 2), with or without dA40 conjugation (Supporting Information Figure S2). In cells, for the peptides with the minimal length required for recognition by aminopeptidases, sufficient presentation on the surface can be assured. After dA-OVA257-264 was complexed with SPG, dA-OVA257-264/SPG was added to peritoneal macrophages. The presentation level of OVA257-264 by treatment of the complexes was almost the same as that of dA-OVA257-264 (Figure 6A). When antisense-dA/SPG complex and mRNA were mixed in an in vitro assay, the complex hybridized with the target RNA in a sequence-dependent manner.14 However, the efficacy of hybridization by the complex was not so high compared with that by AS-ODN alone. This is considered to be attributable to the steric hindrance by SPG, resulting in interference in the access of target molecules. In this study, this obstacle is overcome by the introduction of a cleavage site in response to the cytosolic environment.


Page 12 of 31

Page 13 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Therefore, the complex showed the same level of presentation efficacy as the naked one. The complex dA-OVA257-264/SPG linked with click chemistry between OVA257-264 and dA40 induced a much lower level of OVA257-264 presentation than that linked with a disulfide bond (Supporting Information Figure S3).

Bright-field


Figure 5.

Antigen presentation after treatment with the conjugates. Cells were treated

with the indicated conjugates for 24 hours and observed with a fluorescence microscopy after staining with PE-labeled anti-mouse OVA257-264 peptide bound to H-2Kb antibody. The bar represents 50 µm.

dA-OVA257-264/SPG induces peptide-specific immune responses by combination with CpG-ODN/SPG In our previous study, when OVA257-264-dA/SPG linked with click chemistry was immunized in combination with CpG-dA/SPG, the antigen-specific CTL responses were induced.18 We verified the CTL activities in vivo with various peptide doses by using dA- OVA257-264/SPG. Splenocytes from naïve mice were pulsed with or without OVA 257-264 , and labeled with either high or low level of carboxyfluorescein succinimidyl ester (CFSE), respectively (OVA257-264-pulsed CFSEhigh, non-pulsed CFSElow). Seven days after vaccination, mice were intravenously injected with a



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 31

mixture containing equal amounts of OVA257-264-pulsed CFSEhigh and non-pulsed CFSElow. After 24 hours, the elimination of OVA257-264-pulsed CFSEhigh was analyzed using flow cytometry. For mice immunized with a mixture of dA-OVA257-264/SPG and CpG-dA/SPG, the OVA257-264-presenting cells (OVA257-264-pulsed CFSEhigh) were e l i m i n a t e d

f r o m

r e c i p i e n t

m i c e

i n

a

Figure 6. dA-OVA257-264/SPG induces potent CTL activity in combination with CpG-dA/SPG. (A) Antigen presentation level after treatment with dA-OVA257-264 (dotted line) or dA-OVA257-264/SPG complex (solid line). The gray filled histogram represents untreated cells. (B) In vivo CTL activity for cells pulsed with OVA257-264 peptide after immunization with dA-OVA257-264/SPG at the indicated doses of peptide and CpG-dA/SPG (CpG-dA; 30 µg/head).


Page 15 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


peptide dose-dependent manner (Figure 6B). We were not completely able to observe the OVA257-264-presenting cells from mice immunized with a peptide dose of more than 100 ng/head. For immunization with OVA257-264-dA/SPG linked with click chemistry, a peptide dose of at least 2 µg was needed to induce CTL responses.18 Therefore, we succeeded in achievement of the induction of high CTL responses at a much lower peptide dose than in the previous system by changing the design between antigenic peptide and dA40. The difference in the CTL activities between dA-OVA257-264/SPG linked with LC-SPDP and click chemistry is consistent with the OVA257-264 presentation levels on the cell surface (Supporting Information Figure S3).

Discussion

Recent advances in cancer vaccines have proposed that a carrier is essential for delivering antigens and adjuvants to APCs to ensure the maximum efficacy. A carrier is required to achieve not only target delivery along with protection against enzymatic degradation, but also controlled release in response to stimuli such as pH,28-30 temperature,31,32 light,33,34 and biomolecules.35,36 The precise design for specific targeting and controlled release behavior should be based on a full understanding of the related interaction between a receptor and a ligand, and the release machinery that responds to the stimuli. Developments in the fields of immunology, oncology, molecular biology and nanotechnology have made it possible to create multifunctional drug carrier materials. The present study demonstrates that a complex with the ability not only to target APCs but also to release peptides in response to intracellular



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

molecules can induce antigen-specific immune responses at a much lower dose than in previous studies. After intradermal administration, CpG-dA/SPG promptly moved to the lymphatic vessels and was accumulated in lymph nodes, such as the inguinal lymph node and the axillary lymph node.18 We also demonstrated that dA/SPG and SPG alone can bind to the representative β-glucan receptor Dectin-1.37 Although we have not identified the receptors involved in this uptake, these results suggest that the uptake of dA-OVA257-264/SPG is attributed to the recognition of SPG or dA/SPG by some kind of β-glucan receptor. This specific and efficient uptake by use of SPG enormously helps the induction of strong CTL activities. In our previous system, the ODNs and peptides complexed with SPG were not able to dissociate from the complexes. CpG-ODNs induce intense immune responses by complexation with SPG.38 When multiple CpG-ODNs are conjugated on one substrate, cytokine production is dramatically (or allosterically) induced.39-41 The dimerization of TLR9 is necessary for its activation.42 Once a CpG-ODN branch binds to one TLR9 dimer, the complex is locked adjacently to the vesicle surface where other TLR9 dimers are present. Because the complex behaves as a semiflexible rod,43 it can easily induce adjacent second binding. This accessibility of the complex seems to be responsible for the allosteric effect. In contrast to CpG-ODN, AS-ODN and antigenic peptide do not exhibit pronounced biological effects.14 The complexes are too balky for large target molecules such as mRNA and protein to access, resulting in low efficacy compared with naked ODN or peptide. Therefore, our system had certain advantages and disadvantages. In this study, after internalization into APCs, peptides should be translocated to the lumen of the ER and loaded onto MHC class I molecules with the


Page 16 of 31

Page 17 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


assistance of a variety of chaperones. The antigen presentation level was drastically enhanced by the introduction of cleavage site disulfide bonding, compared with non-cleavage site triazole ring (Supporting Information Figure S3). This finding indicates that glutathione tripeptide is not so large a molecule as to have difficulty accessing the target site in the complex. Although PILS-AP, the molecular weight of which is 105 kDa, was able to trim the peptide in the conjugates dA-OVA257-264 and dA-OVA254-264 (Figure 4B), the complex can still prevent its access to the trimming site because of the bulkiness. Considering these accessibility issues, C-OVA257-264 can first be released from the complex dA-OVA257-264/SPG by glutathione, followed by trimming by aminopeptidases. In this study, we succeeded in inducing strong CTL activity at a peptide dose of 100 ng/head. In general, it is necessary to administer antigenic peptide at a dose of at least 10-100 µg/head.44-46 Compared with the efficacy at this dose, we achieved the same efficacy at almost one-thousandth of the dose, which can be ascribed to the synergistic effect of targeting to APCs along with controlling the intracellular behavior. Stayton et al. demonstrated that the packaging of CpG-ODN and an antigen significantly enhanced antigen

cross-presentation.47

Although

we

prepared

the

ternary

complex

(CpG-dA/dA-OVA257-264/SPG) and used it for immunization, we did not observe a significant difference in the immune responses, compared with immunization with dA-OVA257-264/SPG and CpG-dA/SPG complexes separately (data not shown). In this study, CpG-dA/SPG contained seven CpG-ODNs in one complex on average. This composition was optimized for the induction of strong immune responses by changing the number of CpG-ODNs in one complex.38 When we prepared the ternary complex, five CpG-ODNs and two OVA257-264 were contained in one complex. Because the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

density of CpG-ODN departs from the optimal composition, the complex cannot exert sufficient adjuvant activity. In conclusion, antigenic peptide OVA257-264 with dA40 at the N-terminal end was efficiently recognized by PILS-AP, resulting in the induction of a high level of antigen presentation. There was no difference in the antigen presentation level between before and after the complexation with SPG. Immunization with a mixture of dA-OVA257-264/SPG and CpG-dA/SPG induced high antigen-specific CTL activity at a much lower peptide dose than in previous studies. These results can be attributed to not only the cell-specific delivery but also the control of intracellular behavior. Therefore, peptide-dA/SPG complexes could be used as a potent vaccine antigen for the treatment of cancers and infectious diseases.

Materials and Methods

Materials CpG-dA, where CpG sequence is as follows; ATCGACTCTCGAGCGTTCTC, was synthesized by Gene Design Co., Ltd (Osaka, Japan) and purified with high-performance liquid chromatography. In this study, we used phosphorothioate (PS) backbone instead of phosphodiester (PO) backbone for dA since PS-dA forms the stable complex with SPG, compared with PO-dA.48 SPG (Mw = 1.5 × 105 as the single chain, determined with gel-permeation chromatography coupled to multi angle light scattering analysis) was kindly provided by Mitsui Sugar Co., Ltd. (Tokyo, Japan). Antigenic peptides, OVA257-264 and OVA254-264, were synthesized by Gene Design Co., Ltd.


Page 18 of 31

Page 19 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


N’N-dimethylformamide (DMF) and triethylammonium acetate (TEAA) were purchased from Wako Pure Chemical Industries, Ltd., (Osaka, Japan).

Preparation of conjugate consisting of OVA peptide and dA40 dA40 with amino group at 5’ end and LC-SPDP (Thermo Scientific, Waltham, MA) were mixed in PBS at molar ratio of 1 : 30 and stirred at 40 °C for 3 hours. After purification using NAP-5 column (GE Healthcare UK Ltd, Buckinghamshire, UK), pyridyldithiol-activated dA40 and peptide (CSIINFEKL) were mixed in water containing 30% DMF at molar ratio of 1 : 25 and stirred at 40 °C for 18 hours. The conjugate, dA-OVA257-264, was purified with HPLC fractionation. HPLC was carried out using an Agilient 1260 Infinity LC (Agilient Technology, Santa Clara, CA) with a ZORBAX Eclipse plus C18 (4.6 mm × 250 mm; Agilient) at a flow rate of 1.0 ml/min at 40 °C. Buffer A was 0.1 M TEAA buffer of pH 7.0, and buffer B was acetonitrile. The reaction mixtures were eluted using a linear gradient of 10 to 30% buffer B over 30 minutes. Effluents were monitored at 260 nm using a UV detector (MDW; Agilient). After fractionation with HPLC and freeze dry, the concentration of dA-OVA257-264 was determined from UV measurement. We obtained other dA-peptide conjugates in the same way.

Preparation of SPG/dA-OVA257-264 (Figure 1) SPG was dissolved in 0.25 N NaOHaq for 2 - 5 days to dissociate triple helix to single chain. The alkaline SPG solution, dA-OVA257-264 in water, and phosphate buffer solution (330 mM NaH2PO4, pH = 4.7) were mixed. After mixing, the mixture



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(dA-OVA257-264 60 µM, pH = 7.4) was stored at 4 °C overnight. The molar ratio ([dA-OVA257-264]/[SPG]) was controlled to 4.0. From gel permeation chromatography and polyacrylamide gel electrophoresis analyses as described in previous reports,14,18 we confirmed that dA-OVA257-264 was completely complexed with SPG. Because the complex has an exact stoichiometric composition that two main chain glucoses bind with one nucleotide, dA-OVA257-264/SPG contains seven or eight OVA257-264 peptides in one complex on average. We prepared CpG-dA/SPG complex in the same way.

Cleavage of DNA-peptide conjugates by glutathione Each DNA-peptide conjugate in 25 mM Tris buffer (pH 7.8) was added glutathione at 0.5 µM (Wako Pure Chemical Industries, Ltd., Osaka, Japan). After incubation at 37 °C for 18 hours, the mixtures were separated by 15% acrylamide gel electrophoresis. DNA was stained with SYBR Gold (Invitrogen, Carlsbad, CA) and the image was obtained using a PharosFX (Bio-Rad, Richmond, CA).

Cleavage of DNA-peptide conjugates by aminopeptidase PILS-AP Each DNA-peptide conjugate in 25 mM Tris buffer (pH 7.8) was added PILS-AP (R&D Systems, Inc., Minneapolis, MN) at 0.5 µg/ml. After incubation at 37 °C for 18 hours, the mixtures were separated by 15% acrylamide gel electrophoresis. DNA was stained with SYBR Gold.


Page 20 of 31

Page 21 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Observation of peptide presentation on APCs All animal experiments were performed according to the guidelines for animal care and use committee of the University of Kitakyushu. C57BL/6J mice were purchased from Japan SLC, Inc., (Shizuoka, Japan). Peritoneal macrophages were isolated from mice as described in previous report,14 and cultured in RPMI 1640 medium (Wako) supplemented with 10% FCS, 100 U/ml penicillin, 0.1 mg/ml streptomycin at 37 °C in CO2. The cells were plated at 1.5 × 105 cells/well in 48-well plates, and added peptides (or DNA-peptide conjugates) at 5 µg/ml of peptide dose. After incubation for the indicated times, the cells were washed with PBS three times, and fixed with 4% paraformaldehyde (Wako). The cells were stained with PE-labeled anti-mouse OVA257-264 (SIINFEKL) peptide bound to H-2Kb antibody (ThermoFisher SCIENTIFIC), and the fluorescence intensity of the cells was observed using a BZ-9000 digital fluorescence microscope (Keyence, Osaka, Japan) or a flow cytometer (Epics XL; Beckman Coulter, Fullerton, CA).

In vivo CTL assay Mice were immunized with dA-OVA257-264/SPG (OVA257-264; 20, 100, 500 ng) and CpG-dA/SPG (CpG-dA; 30 µg) at the base of the tail at day 0. At day 7, naïve mouse splenocytes were pulsed with or without OVA257-264 (10 µg/ml) for 90 min at 37 °C. After washing three times with PBS, the peptide-pulsed and non-pulsed cells were labeled with CFSE (Invitrogen, Carlsbad, CA) at 5 and 0.5 µM, respectively, for 10 min at room temperature. After washing three times with PBS, equal numbers of CFSEhigh (peptide-pulsed cells) and CFSElow (non-pulsed cells) were mixed and injected



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

intravenously into the immunized mice. 24 hours later, splenocytes were collected and subjected to flow cytometric analysis.

Acknowledgements

We would like to gratefully thank Ms. Motoko Tanaka for her help. This work was supported by JST CREST Grant Number JPMJCR1521, Japan, and NapaJen Pharma, Inc. This work was performed under the Research Program for CORE lab of "Five-star Alliance" in "NJRC Mater. & Dev." Grant Number 20166011.

Supporting Information

The Supporting Information is available free of charge on the ACS Publications website at DOI: Figures for TOF MS spectrum of dA-OVA257-264 and flow cytometric analysis of antigen presentation.

Author Information

Corresponding Author *E-mail: [email protected] ORCID Shinichi Mochizuki: 0000-0001-9832-5070


Page 22 of 31

Page 23 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Notes The authors declare no competing financial interest.

Abbreviations

CTL, cytotoxic T-lymphocyte; APC, antigen-presenting cell; MHC, major histocompatibility

complex;

SPG,

schizophyllan;

dA40,

dA

40mer;

ERAP1,

endoplasmic reticulum (ER)-associated aminopeptidase 1; LC-SPDP, succinimidyl 6-[3’-(2-pyridyldithio)-propionamido] hexanoate; PILS-AP, puromycin-insensitive leucine aminopeptidase; CFSE, carboxyfluorescein succinimidyl ester;

References

(1) Dougan, M., and Dranoff, G. (2009) Immune therapy for cancer. Annu. Rev. Immunol. 27, 83-117. (2) Mellman, I., Coukos, G., and Dranoff, G. (2011) Cancer immunotherapy comes of age. Nature 480, 480-489. (3) Gilboa, E. (2007) DC-based cancer vaccines. J. Clin. Invest. 117, 1195-1203. (4) Banchereau, J., and Palucka, A. K. (2005) Dendritic cells as therapeutic vaccines against cancer. Nat. Rev. Immunol. 5, 296-306. (5) O'Neill, D. W., Adams, S., and Bhardwaj, N. (2004) Manipulating dendritic cell biology for the active immunotherapy of cancer. Blood 104, 2235-2246. (6) Pardoll, D. M. (1995) Paracrine cytokine adjuvants in cancer immunotherapy. Annu. Rev. Immunol. 13, 399-415.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(7) Sandler, A. D., Chihara, H., Kobayashi, G., Zhu, X., Miller, M. A., Scott, D. L., and Krieg, A. M. (2003) CpG oligonucleotides enhance the tumor antigen-specific immune response of a granulocyte macrophage colony-stimulating factor-based vaccine strategy in neuroblastoma. Cancer Res. 63, 394-399. (8) Smits, E. L., Ponsaerts, P., Berneman, Z. N., and Van Tendeloo, V. F. (2008) The use of TLR7 and TLR8 ligands for the enhancement of cancer immunotherapy. Oncologist 13, 859-875. (9) Bijker, M. S., Melief, C. J., Offringa, R., and van der Burg, S. H. (2007) Design and development of synthetic peptide vaccines: past, present and future. Expert rev. Vaccines 6, 591-603. (10) Yamada, A., Sasada, T., Noguchi, M., and Itoh, K. (2013) Next-generation peptide vaccines for advanced cancer. Cancer Sci. 104, 15-21. (11) Hu, X., Chakraborty, N. G., Sporn, J. R., Kurtzman, S. H., Ergin, M. T., and Mukherji, B. (1996) Enhancement of cytolytic T lymphocyte precursor frequency in melanoma patients following immunization with the MAGE-1 peptide loaded antigen presenting cell-based vaccine. Cancer Res. 56, 2479-2483. (12) Sakurai, K., and Shinkai, S. (2000) Molecular Recognition of Adenine, Cytosine, and Uracil in a Single-Stranded RNA by a Natural Polysaccharide: Schizophyllan. J. Am. Chem. Soc. 122, 4520-4521. (13) Sakurai, K., Mizu, M., and Shinkai, S. (2001) Polysaccharide--polynucleotide complexes. 2. Complementary polynucleotide mimic behavior of the natural polysaccharide schizophyllan in the macromolecular complex with single-stranded RNA and DNA. Biomacromolecules 2, 641-650.


Page 24 of 31

Page 25 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(14) Mochizuki, S., and Sakurai, K. (2011) Dectin-1 targeting delivery of TNF-alpha antisense ODNs complexed with beta-1,3-glucan protects mice from LPS-induced hepatitis. J. Control. Release 151, 155-161. (15) Mochizuki, S., Morishita, H., and Sakurai, K. (2013) Macrophage specific delivery of TNF-alpha siRNA complexed with beta-1,3-glucan inhibits LPS-induced cytokine production in a murine acute hepatitis model. Bioorg. Med. Chem. 21, 2535-2542. (16) Takedatsu, H., Mitsuyama, K., Mochizuki, S., Kobayashi, T., Sakurai, K., Takeda, H., Fujiyama, Y., Koyama, Y., Nishihira, J., and Sata, M. (2012) A new therapeutic approach using a schizophyllan-based drug delivery system for inflammatory bowel disease. Mol. Ther. 20, 1234-1241. (17) Zhang, Q., Ichimaru, N., Higuchi, S., Cai, S., Hou, J., Fujino, M., Nonomura, N., Kobayashi, M., Ando, H., Uno, A., et al. (2015) Permanent acceptance of mouse cardiac allografts with CD40 siRNA to induce regulatory myeloid cells by use of a novel polysaccharide siRNA delivery system. Gene Ther. 22, 1-10. (18) Mochizuki, S., Morishita, H., Kobiyama, K., Aoshi, T., Ishii, K. J., and Sakurai, K. (2015) Immunization with antigenic peptides complexed with beta-glucan induces potent cytotoxic T-lymphocyte activity in combination with CpG-ODNs. J. Control. Release 220, 495-502. (19) Marakalala, M. J., Graham, L. M., and Brown, G. D. (2010) The role of Syk/CARD9-coupled C-type lectin receptors in immunity to Mycobacterium tuberculosis infections. Clin. Dev. Immunol. 2010, 1-9. (20) Goodridge, H. S., Wolf, A. J., and Underhill, D. M. (2009) Beta-glucan recognition by the innate immune system. Immunol. Rev. 230, 38-50.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 31

(21) Kobiyama, K., Aoshi, T., Narita, H., Kuroda, E., Hayashi, M., Tetsutani, K., Koyama, S., Mochizuki, S., Sakurai, K., Katakai, Y., et al. (2014) Nonagonistic Dectin-1 ligand transforms CpG into a multitask nanoparticulate TLR9 agonist. Proc. Natl. Acad. Sci. U. S. A. 111, 3086-3091. (22) Chang, S. C., Momburg, F., Bhutani, N., and Goldberg, A. L. (2005) The ER aminopeptidase, ERAP1, trims precursors to lengths of MHC class I peptides by a "molecular ruler" mechanism. Proc. Natl. Acad. Sci. U. S. A. 102, 17107-17112. (23) York, I. A., Brehm, M. A., Zendzian, S., Towne, C. F., and Rock, K. L. (2006) Endoplasmic reticulum aminopeptidase 1 (ERAP1) trims MHC class I-presented peptides in vivo and plays an important role in immunodominance. Proc. Natl. Acad. Sci. U. S. A. 103, 9202-9207. (24) Schomburg, L., Kollmus, H., Friedrichsen, S., and Bauer, K. (2000) Molecular characterization of a puromycin-insensitive leucyl-specific aminopeptidase, PILS-AP. Eur. J. Biochem. 267, 3198-3207. (25) Saric, T., Chang, S. C., Hattori, A., York, I. A., Markant, S., Rock, K. L., Tsujimoto,

M.,

and

Goldberg,

A.

L.

(2002)

An

IFN-gamma-induced

aminopeptidase in the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat. Immunol. 3, 1169-1176. (26) Spiteri, C., and Moses, J. E. (2010) Copper-catalyzed azide-alkyne cycloaddition: regioselective synthesis of 1,4,5-trisubstituted 1,2,3-triazoles. Angew. Chem. Int. Ed. Engl. 49, 31-33. (27) Serwold, T., Gonzalez, F., Kim, J., Jacob, R., and Shastri, N. (2002) ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum. Nature 419, 480-483.


Page 27 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(28) Yang, Y., Wang, S., Wang, Y., Wang, X., Wang, Q., and Chen, M. (2014) Advances in self-assembled chitosan nanomaterials for drug delivery. Biotechnol. Adv. 32, 1301-1316. (29) Chang, Y., Hou, C., Ren, J., Xin, X., Pei, Y., Lu, Y., Cao, S., and Pei, Z. (2016) Multifunctional

supramolecular

vesicles

based

on

the

complex

of

ferrocenecarboxylic acid capped pillar[5]arene and a galactose derivative for targeted drug delivery. Chem. Commun. 52, 9578-9581. (30) Wang, M., Gong, G., Feng, J., Wang, T., Ding, C., Zhou, B., Jiang, W., and Fu, J. (2016) Dual pH-Mediated Mechanized Hollow Zirconia Nanospheres. ACS appl. Mater. Interfaces 8, 23289-23301. (31) Chen, K. J., Liang, H. F., Chen, H. L., Wang, Y., Cheng, P. Y., Liu, H. L., Xia, Y., and Sung, H. W. (2013) A thermoresponsive bubble-generating liposomal system for triggering localized extracellular drug delivery. ACS Nano 7, 438-446. (32) Deng, L., Ren, J., Li, J., Leng, J., Qu, Y., Lin, C., and Shi, D. (2015) Magnetothermally responsive star-block copolymeric micelles for controlled drug delivery and enhanced thermo-chemotherapy. Nanoscale 7, 9655-9663. (33) Riedinger, A., Guardia, P., Curcio, A., Garcia, M. A., Cingolani, R., Manna, L., and Pellegrino, T. (2013) Subnanometer local temperature probing and remotely controlled drug release based on azo-functionalized iron oxide nanoparticles. Nano letters 13, 2399-2406. (34) Poelma, S. O., Oh, S. S., Helmy, S., Knight, A. S., Burnett, G. L., Soh, H. T., Hawker, C. J., and Read de Alaniz, J. (2016) Controlled drug release to cancer cells from modular one-photon visible light-responsive micellar system. Chem. Commun. 52, 10525-10528.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 31

(35) Climent, E., Martinez-Manez, R., Sancenon, F., Marcos, M. D., Soto, J., Maquieira, A., and Amoros, P. (2010) Controlled delivery using oligonucleotide-capped mesoporous silica nanoparticles. Angew. Chem. Int. Ed. Engl. 49, 7281-7283. (36) Zhong, J., Li, L., Zhu, X., Guan, S., Yang, Q., Zhou, Z., Zhang, Z., and Huang, Y. (2015) A smart polymeric platform for multistage nucleus-targeted anticancer drug delivery. Biomaterials 65, 43-55. (37) Mochizuki, S., Morishita, H., Adachi, Y., Yamaguchi, Y., and Sakurai, K. (2014) Binding assay between murine Dectin-1 and beta-glucan/DNA complex with quartz-crystal microbalance. Carbohydrate Research 391, 1-8. (38) Minari, J., Mochizuki, S., Matsuzaki, T., Adachi, Y., Ohno, N., and Sakurai, K. (2011) Enhanced cytokine secretion from primary macrophages due to Dectin-1 mediated uptake of CpG DNA/beta-1,3-glucan complex. Bioconjug. Chem. 22, 9-15. (39) Marshall, J. D., Hessel, E. M., Gregorio, J., Abbate, C., Yee, P., Chu, M., Van Nest, G., Coffman, R. L., and Fearon, K. L. (2003) Novel chimeric immunomodulatory compounds containing short CpG oligodeoxyribonucleotides have differential activities in human cells. Nucleic Acids Res. 31, 5122-5133. (40) Wu, C. C., Lee, J., Raz, E., Corr, M., and Carson, D. A. (2004) Necessity of oligonucleotide aggregation for toll-like receptor 9 activation. J. Biol. Chem. 279, 33071-33078. (41)Kerkmann, M., Costa, L. T., Richter, C., Rothenfusser, S., Battiany, J., Hornung, V., Johnson, J., Englert, S., Ketterer, T., Heckl, W., et al. (2005) Spontaneous formation

of

nucleic

acid-based

nanoparticles


is

responsible

for

high

Page 29 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


interferon-alpha induction by CpG-A in plasmacytoid dendritic cells. J. Biol. Chem. 280, 8086-8093. (42) Latz, E., Verma, A., Visintin, A., Gong, M., Sirois, C. M., Klein, D. C., Monks, B. G., McKnight, C. J., Lamphier, M. S., Duprex, W. P., et al. (2007) Ligand-induced conformational changes allosterically activate Toll-like receptor 9. Nat. Immunol. 8, 772-779. (43) Sanada, Y., Matsuzaki, T., Mochizuki, S., Okobira, T., Uezu, K., and Sakurai, K. (2012) beta-1,3-D-glucan schizophyllan/poly(dA) triple-helical complex in dilute solution. J. Phys. Chem. B 116, 87-94. (44) Xu, Z., Ramishetti, S., Tseng, Y. C., Guo, S., Wang, Y., and Huang, L. (2013) Multifunctional nanoparticles co-delivering Trp2 peptide and CpG adjuvant induce potent cytotoxic T-lymphocyte response against melanoma and its lung metastasis. J. Control. Release 172, 259-265. (45) Zhu, X., Nishimura, F., Sasaki, K., Fujita, M., Dusak, J. E., Eguchi, J., Fellows-Mayle, W., Storkus, W. J., Walker, P. R., Salazar, A. M., et al. (2007) Toll like receptor-3 ligand poly-ICLC promotes the efficacy of peripheral vaccinations with tumor antigen-derived peptide epitopes in murine CNS tumor models. J. Transl. Med. 5, 10. (46) Cho, H. I., Lee, Y. R., and Celis, E. (2011) Interferon gamma limits the effectiveness of melanoma peptide vaccines. Blood 117, 135-144. (47) Wilson, J. T., Keller, S., Manganiello, M. J., Cheng, C., Lee, C. C., Opara, C., Convertine, A., and Stayton, P. S. (2013) pH-Responsive nanoparticle vaccines for dual-delivery of antigens and immunostimulatory oligonucleotides. ACS Nano 7, 3912-3925.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(48) Mochizuki, S., and Sakurai, K. (2010) beta-1,3-Glucan/antisense oligonucleotide complex stabilized with phosphorothioation and its gene suppression. Bioorg. Chem. 38, 260-264.


Page 30 of 31

Page 31 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents (TOC)

dA40

peptide dA-OVA257-264/SPG

SPG

glutathione aminopeptidase

Induction of CTL activity

CD8+ T cell


Complex Consisting of Î²-Glucan and Antigenic Peptides with

Recommend Documents