Comprehensive Thermodynamic Profiling for the Binding of a G

Subscriber access provided by CORNELL UNIVERSITY LIBRARY

Article

Comprehensive Thermodynamic Profiling for the Binding of a G-Quadruplex Selective Indoloquinoline Andrea Funke, and Klaus Weisz J. Phys. Chem. B, Just Accepted Manuscript • Publication Date (Web): 22 May 2017 Downloaded from http://pubs.acs.org on May 23, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

The Journal of Physical Chemistry B is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The Journal of Physical Chemistry

Comprehensive Thermodynamic Profiling for the Binding of a GQuadruplex Selective Indoloquinoline Andrea Funke, and Klaus Weisz* Institute of Biochemistry, Ernst-Moritz-Arndt University Greifswald, Felix-Hausdorff-Str. 4, D17487 Greifswald, Germany

Corresponding Author *E-mail: [email protected]. Fax: (+49) 3834 420-4427. Phone: (+49) 3834 420-4426.

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: Binding of a positively charged indoloquinoline derivative to a G-quadruplex formed by the G-rich promoter element of the c-MYC oncogene was subjected to a rigorous isothermal calorimetric analysis. Binding of the indoloquinoline is primarily enthalpy-driven but is also promoted by a favorable entropy term. Both binding enthalpy ∆H° and binding entropy ∆S° exhibit a noticeable temperature dependence with almost complete enthalpy–entropy compensation as a result of a negative change in heat capacity ∆Cp°. Salt dependent polyelectrolyte effects only moderately contribute to the overall free energy of association. More details on the binding process are revealed in an attempt to dissect the total free energy into individual contributory terms. Accordingly, specific intermolecular interactions between the indoloquinoline ligand and G-quadruplex substantially contribute in addition to hydrophobic effects in promoting the association. Comparing thermodynamic profiles for various quadruplex ligands indicates different energetic patterns that may aid in the rational design of more efficient quadruplex binding ligands in the future.


Page 2 of 31

Page 3 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Increasing efforts have been directed towards the design of G-quadruplex selective ligands in recent years. A growing interest in the targeting of G-quadruplex structures by low molecular weight compounds arises from their existence and putative regulatory roles in vivo but also from various technological applications that are based on a quadruplex platform. Thus, the formation of alternative quadruplex structures at G-rich sequences within the genome has been firmly established by an accumulated body of evidence.1,2 In order to form, four guanine bases must arrange in a cyclic array held together by mutual Hoogsteen-type hydrogen bonds. Strong stacking interactions typically involving 2-4 of such planar G-tetrads and the incorporation of suitable cations such as Na+ or K+ into the quadruplex central cavity offer sufficient stabilization of these non-canonical structures to even compete with double-helical DNA under appropriate conditions. Because in monomolecular quadruplex structures the four G-tracts are connected by intervening sequences forming different types of loops, quadruplexes exhibit a high structural variability.3,4 Depending on the relative orientation of the four G-tracts and the arrangement of the different loops, parallel, antiparallel, and (3+1)-hydrid structures can be distinguished. G-rich sequences in promoter regions of oncogenes like c-MYC mostly fold into parallel quadruplexes in vitro, exhibiting four parallel G-tracts linked by three propeller loops. Quadruplex forming sequences are not only overrepresented in promoter elements of various oncogenes but may also form at the 3’-telomeric ends of eukaryotic chromosomes, making them attractive targets for novel anticancer strategies.5,6 A ligand-induced quadruplex stabilization was shown to potentially result in oncogene transcriptional silencing or in the suppression of telomerase activity in cancer cells leading to cellular senescence in vivo.7,8 On the other hand, artificial aptamers selected by in vitro evolution and based on the quadruplex scaffold have been



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

found to constitute powerful tools for the detection and capture of proteins or smaller metabolites.9 A plethora of chemically diverse compounds has been tested as quadruplex ligands during the last years.10 They typically consist of a polycyclic core structure with a large aromatic surface area to optimize stacking interactions when binding upon a G-tetrad. On the other hand, differences in loops and quadruplex groove dimensions for additional specific interactions have hardly been exploited for a better discrimination among various quadruplex structures. While many promising ligands have been selected from a pool of compounds by screening methods, the rational design of suitable quadruplex ligands for clinical or technological applications is still in its infancy and largely relies on a structure-based approach. Unfortunately, comprehensive studies on the thermodynamics of G-quadruplex recognition as a complement to structural investigations are still sparse and only a limited database is available so far. However, understanding the energetic contributions that drive a particular binding event provides for a more solid basis in any design process. The quadruplex binding of some indoloquinoline derivatives has recently been studied in more detail through a combination of spectroscopic methods.11 Among the various derivatives, the N5methylated indoloquinoline PIQ-4m was identified as a quadruplex ligand with promising affinity as well as discriminatory potential not only against double-helical DNA but also against different quadruplex topologies (Figure 1). Interactions with its preferred c-MYC quadruplex target resulted in an exceptional quadruplex thermal stabilization of about 35 °C and dissociation constants in the micromolar range. The binding of PIQ-4m is expected to involve partial stacking on the quadruplex outer tetrads supported by additional interactions of its benzoylated alkylamine sidechain with flanking sequences, loops and/or grooves. Although no high-resolution structure of c-MYC complexed with PIQ-4m exists, a solution structure of the related indoloquinoline4 ACS Paragon Plus Environment

Page 4 of 31

Page 5 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


based quindoline bound to c-MYC may serve as clue for PIQ-4m binding.12 Here, two quindolines stack on both 5’- and 3’-terminal G-tetrads of the c-MYC quadruplex recruiting flanking bases to form a new binding pocket. Ligand binding on the two terminal faces is similar with some differences related to the flanking bases and to the accessibility and hydrophobicity of the outer tetrads.

A

B

c-MYC 5’-d(TGAGGGTGGGTAGGGTGGGTAA )

PIQ-4m

Figure 1. A) Structure of the indoloquinoline PIQ-4m. B) Topology and sequence of the c-MYC quadruplex; guanine bases of the G–tetrads are underlined. The recent investigations on the quadruplex binding of indoloquinolines prompted us to engage in a more rigorous study on the thermodynamics of the PIQ-4m – c-MYC recognition process. A quantitative thermodynamic analysis of forces that influence a quadruplex-ligand association will expand the still limited pool of thermodynamic data collected on the quadruplex recognition by small molecules. Employing calorimetric techniques allows for the direct determination of enthalpic and entropic contributions to binding. However, isothermal titration calorimetry was used to not only determine a thermodynamic signature based solely on enthalpic and entropic contributions to binding but to further dissect the binding free energy into different component terms. Although approximate, such an analysis reveals valuable details of the binding process and is expected to aid in a better understanding of the energetics in quadruplex recognition. 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

EXPERIMENTAL SECTION Materials and sample preparation. DNA oligonucleotides were purchased from TIB MOLBIOL (Berlin, Germany) and further purified by ethanol precipitation. Concentrations were determined spectrophotometrically by measuring absorbances in an H2O solution at 80 °C using ε260 = 258930 M–1 cm-1 for the c-MYC sequence. Indoloquinoline derivative PIQ-4m was prepared as described and its concentration determined in buffer using a molar extinction coefficient ε376 = 22227 M-1 cm–1.11 Samples were obtained by dissolving the ligand and oligonucleotide in a buffer with 20 mM potassium phosphate, 100 mM KCl, pH 7.0, with the addition of 5% DMSO. For salt dependent measurements, additional buffers with 220 mM and 460 mM KCl were used. Prior to measurements, the oligonucleotide samples were annealed by heating to 80 °C followed by slow cooling to room temperature. Differential scanning calorimetry (DSC). DSC measurements were performed on a VP-DSC (Malvern Instruments, Great Britain) with a 50 µM c-MYC buffer solution. The sample was heated from 20 to 130 °C with a scan rate of 1 °C min–1. A buffer versus buffer scan was subtracted from the sample scan and the melting temperature Tm corresponding to the maximum of the DSC peak was obtained after a linear baseline subtraction. Isothermal titration calorimetry (ITC). ITC experiments were performed with a MicroCal PEAQ-ITC instrument (Malvern Instruments, Great Britain). Titrations were performed from 20 – 60 °C with a reference power of 4 µcal s–1 and a delay between injections of 240 s. The first injection volume (0.4 µL) was rejected before data analysis. Subsequent titration steps involved 25 injections with 1.5 µL each of an 800 µM ligand solution to 20 µM quadruplex. For the model-independent determination of binding enthalpies ∆H° by an excess-site method, a total of 12 injections with 3 µL each, a delay between injections of 240 s and buffer solutions of 100 µM 6 ACS Paragon Plus Environment

Page 6 of 31

Page 7 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


quadruplex and 200 µM ligand were employed. Molar binding enthalpies were determined by peak integration of the power output following each injection, normalization by the number of moles of added ligand and additionally corrected for the heats of dilution as determined by titrating the ligand into buffer under otherwise identical experimental conditions. Final data were analyzed with the MicroCal PEAQ-ITC analysis software. Unless otherwise stated, determined parameters are averages over three independent titration experiments. Molar free energies ∆G° and entropies ∆S° for the high-affinity binding were calculated according to the standard thermodynamic relationships ∆G° = –RTlnKa and –T∆S° = ∆G° – ∆H° with ∆H° being the average of 36 injections from three separate excess-site titrations. Linear least squares regressions were weighted according to the standard deviation SD with weights equal to 1/SD2. RESULTS The c-MYC promoter sequence is known to fold into a parallel quadruplex in a potassium containing buffer.13 Accordingly, circular dichroism (CD) spectra recorded for c-MYC in a buffer supplemented with 5% DMSO as used for subsequent ITC experiments exhibit negative and positive amplitudes centered at 243 and 264 nm in line with a parallel topology (Figure S1). Due to its high thermal stability, differential scanning calorimetry measurements were used to also test quadruplex melting under the solution conditions employed (not shown). The melting temperature of the c-MYC quadruplex was lowered from 91 °C to 84 °C upon addition of 5% DMSO, indicating that the presence of the organic solvent did not significantly compromise its exceptionally high thermal stability. In the following, isothermal titration calorimetry was used to monitor PIQ-4m binding and to extract thermodynamic parameters for the ligand-quadruplex association. In contrast to van’t 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hoff analyses, ITC allows for a direct determination of binding enthalpies and constitutes a powerful technique in establishing a full thermodynamic profile of binding reactions with a dissection of binding free energies into enthalpic and entropic contributions.14 We performed ITC measurements by titrating the PIQ-4m ligand into a c-MYC solution at 20, 30, 40, 50, and 60 °C. After integration of the power output for each injection and corrections for the heats of dilution, all thermograms follow a similar course (Figures 2 and S2). Their sigmoidal shape reveals the presence of high-affinity binding sites with strongly exothermic binding associated with heat released upon each addition of the ligand to the quadruplex. However, the only gradual return to baseline at high ligand-to-quadruplex molar ratios demonstrates additional weaker binding with ligand in excess and the presence of at least two non-equivalent binding sites.

Figure 2. Representative ITC binding isotherm (left) and corresponding excess-site ITC titration (right) of PIQ-4m to the c-MYC quadruplex at 40 °C. The upper and lower panels show the heat burst for every injection step and the integrated dilution-corrected heat versus the molar ratio, respectively. 8 ACS Paragon Plus Environment

Page 8 of 31

Page 9 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In contrast to higher temperatures, isotherms at 20 °C reveal a more pronounced small dip during the initial titration steps and an almost linear rise at later injections with ligand in excess. As has already been pointed out before,11 such a heat profile indicates the presence of more than two calorimetrically distinct binding processes for the ligand. Correspondingly, poorer fits with less reliable fitting parameters were obtained when employing only two sets of binding parameters in a two-site model. We therefore refrained from an evaluation of the full thermodynamic profile at 20 °C. On the other hand, excellent and reproducible fits with a model based on two independent binding sites were obtained for the other thermograms at temperatures ≥ 30 °C. All association constants Ka, molar enthalpies ∆H° and stoichiometries N as derived from curve fitting are summarized in Table 1. Association constants for the high-affinity binding decrease with increasing temperature ranging from 4.8·106 M–1 at 30 °C to 0.8·106 M–1 at 60 °C. On the other hand, binding constants are significantly lower by three orders of magnitude for the low-affinity binding sites. Stoichiometries N of 2.4 as derived for the strong binding at all temperatures corroborate interactions with the outer two tetrads. Although stoichiometries of 7-8 for the weak binding hint at nonspecific electrostatic interactions between cationic ligand and the negatively charged backbone of the quadruplex, additional more specific interactions cannot be excluded. In the following, only ligand binding at the high-affinity sites was thermodynamically characterized in more detail. Binding enthalpies ∆H° for strong binding were also directly measured through an excess-site method in a model-independent fashion (Figure 2 and Figure S2).14 In such a protocol, the ligand is titrated to a concentrated c-MYC solution to ensure its complete binding to the target quadruplex after each injection. Under these conditions, the molar binding enthalpy for the highaffinity binding sites is directly obtained by the heat released per injection without resorting to 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 31

fitting procedures. The good reproducibility of these ∆H° values is also indicated by their rather small standard deviations calculated for three independent experiments with 12 injections each. Enthalpies ∆H° determined by the excess-site method are also given in Table 1. Apparently, binding is increasingly exothermic with increasing temperature, ranging from –4.4 kcal/mol at 20 °C to –7.3 kcal/mol at 60 °C. Table 1. ITC-Derived Thermodynamic Parameters for the Binding of PIQ-4m to the c-MYC Quadruplex in the Presence of 120 mM K+ at Different Temperatures.a T (°C)

N(1) / N(2)b

Ka(1) / Ka(2) (M-1)b

∆H°fit (kcal/mol)c

∆G° (kcal/mol)d

∆H°es (kcal/mol)c

–T∆S° (kcal/mol)d

20e

n.d.

n.d.

n.d.

n.d.

–4.42 ± 0.14

n.d.

n.d.

n.d.

n.d.

2.40 ± 0.03

(4.84 ± 1.13)·106

–5.31 ± 0.03

8.04 ± 0.25

(4.02 ± 0.12)·103

–3.31 ± 0.09

2.45 ± 0.22

(2.01 ± 0.84)·106

–6.35 ± 0.34

8.04 ± 1.99

(4.78 ± 1.58)·103

–2.94 ± 0.38

2.37 ± 0.03

(1.17 ± 0.12)·106

–7.28 ± 0.18

7.42 ± 1.81

(4.41 ± 0.85)·103

–3.12 ± 0.29

2.39 ± 0.08

(0.76 ± 0.42)·106

–8.42 ± 0.26

7.60 ± 1.27

(2.89 ± 1.65)·103

–2.94 ± 0.57

30

40

50

60

a

--–9.27

–5.06 ± 0.30

–4.20

--–9.03

–5.43 ± 0.12

–3.60

--–8.97

–6.33 ± 0.27

–2.64

--–8.96

–7.25 ± 0.21

–1.71

---

Average values with standard deviations from three independent measurements. b1 and 2 denote high-affinity (grey

rows) and low-affinity binding sites (white rows). c∆H°fit and ∆H°es denote standard molar enthalpy changes determined from curve fitting and from an excess-site method, respectively. dFrom the standard thermodynamic relationships ∆G° = –RTlnKa and –T∆S° = ∆G° – ∆H°es; only values for the high-affinity binding are given. e

Isotherm could not be fitted with a two-site model.


Page 11 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Conspicuously, deviations by up to 14% were systematically found for ∆H° values as obtained from fits of complete binding isotherms and from a direct determination with an excess-site approach. Whereas molar heats of dilution were close to zero when titrating a 200 µM ligand solution to buffer, significant dilution heats of about –1 kcal/mol developed for initial steps in blank titrations of an 800 µM ligand solution used for complete ITC titrations with final binding site saturation (Figure S3A). Such a dependence of dilution heats on ligand concentration suggests the formation of self-associated species. Negligible aggregation at lower ligand concentrations but partial formation of self-associated species in an 800 µM titrant is further corroborated by concentration dependent absorbance measurements (Figure S3B). Because ligand dissociation is coupled with quadruplex binding upon titrations to the quadruplex, blank corrections will insufficiently compensate for the self-association effects. Consequently, ∆H° values determined by curve fitting of isotherms recorded by the injection of a highly concentrated titrant should be less accurate compared to values directly extracted from excess-site titrations with injections of a less concentrated solution free of aggregates. On the other hand, imperfect heat corrections are not expected to significantly influence fitted values of association constants or complex stoichiometries.15 Applying thermodynamic relationships to also calculate the molar free energy of binding ∆G° and the entropic contribution to binding –T∆S°, the thermodynamic signature of PIQ-4m binding to the c-MYC quadruplex was established as a function of temperature (Figure 3A). Obviously, both enthalpy and entropy contribute to the PIQ-4m binding with the enthalpy being the major contributor in the temperature range studied. However, because enthalpic contributions decrease whereas favorable entropy changes gradually increase upon lowering the temperature, enthalpy and entropy terms will equally contribute to binding at ~20 °C. These opposing effects partially compensate and result in only marginal changes of the free energy of binding with ∆G° ~ –9 11 ACS Paragon Plus Environment


kcal/mol determined over the entire temperature range. Such an entropy-enthalpy compensation is revealed by plotting ∆H° against T∆S° (Figure 3B). A linear regression line yields a slope of 0.93 ± 0.11 and is thus close to 1 as expected for a full compensation.

0

A

30 °C

40 °C

50 °C

60 °C

-1 -2

kcal/mol

-3 -4 -5 -6 -7 -8 -9 -10

-4

B ∆Ho / kcal/mol

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 31

-5

-6

-7

-8 1.0

1.5

2.0

2.5

3.0

3.5

4.0

4.5

5.0

T∆So / kcal/mol

Figure 3. A) Temperature dependent thermodynamic profiles for the binding of PIQ-4m to the cMYC quadruplex with ∆G° (black bars), ∆H° (grey bars), and –T∆S° (white bars). B) Plot of ∆H° versus T∆S° for PIQ-4m binding to c-MYC with weighted linear least squares regression line. The significant dependencies for ∆H° and T∆S° on temperature emphasize the importance of the binding-induced molar heat capacity change ∆Cp° as a key thermodynamic parameter. ∆Cp° can be accessed from the temperature dependence of ∆H° (∂∆H°/∂T)p = ∆Cp°

(1) 12 ACS Paragon Plus Environment

Page 13 of 31

Fitting the data from 20 to 60 °C by linear regression gives a moderately negative ∆Cp° of -66.8 ± 5.7 cal/mol·K in line with a more exothermic binding at higher temperatures (Figure 4). For the entropic contribution the temperature dependence is given by ∂(T∆S°)/∂T)p = ∆S° + ∆Cp°

(2)

It follows from (1) and (2), that in case of ‫∆׀‬Cp°‫∆׀ » ׀‬S°‫׀‬ ∂(T∆S°)/∂T)p ≃ (∂∆H°/∂T)p ≃ ∆Cp°

(3)

with the T∆S° term being more favorable at lower temperatures for a negative ∆Cp°. Also, ∆H° and T∆S° will exhibit similar temperature dependencies resulting in the observed entropy– enthalpy compensation for the PIQ-4m binding to the c-MYC quadruplex. On the other hand (∂∆G°/∂T)p = –∆S°

(4)

As a consequence of only small entropy changes ∆S° when compared to ∆Cp°, ∆G° is found to be hardly influenced by temperature in the accessible temperature range and thus contrasts with the noticeable temperature dependencies of ∆H° and T∆S°. -2 -3

∆Ho / kcal/mol

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


-4 -5 -6 -7 -8 10

20

30

40

50

60

70

Temperature / °C

Figure 4. Plot of ∆Ho as a function of temperature. ∆Cp° = –66.8 ± 5.7 cal/mol·K is derived from the slope of the weighted linear least squares regression line.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 31

If a positively charged ligand binds to a nucleic acid with its high negative charge density, electrostatic interactions on binding with a concomitant release of counterions will occur. Based on a linear charge density parameter, the Manning counterion condensation theory predicts the extent of charge neutralization through ion condensation in case of cylindrical polyelectrolytes like double-helical DNA but will be less appropriate for quadruplexes expected to essentially behave as a hydrodynamic sphere in solution.16,17 Polyelectrolyte effects link ligand binding with DNA-cation interactions and the ionic strength of the solution. With n potassium ions effectively released through the ligand-quadruplex association, a true binding equilibrium constant KT is proportional to [K+]n and related to the observed Ka by18 KT = Ka·[K+]n

(5)

logKa = logKT – nlog[K+]

(6)

A plot of logKa over log[K+] will thus have a slope of –n and the contribution of the polyelectrolyte effect on the molar free energy change can be expressed by the saltdependent term ∆G°pe = nRTln[K+]. To assess polyelectrolyte effects on the PIQ-4m binding to c-MYC we performed additional ITC measurements at 40 °C in buffer solutions of different K+ concentration (Figure S4). From the plot of logKa over log[K+] the number of displaced potassium ions is determined to be n = 1.28 ± 0.18 by the slope of the linear regression line (Figure 5). As expected, the polyelectrolyte contribution decreases with an increase in salt concentration ranging from ∆G°pe = –1.69 kcal/mol at 120 mM K+ to ∆G°pe = –0.59 kcal/mol at 480 mM K+ (Table 2). This translates into a contribution on the total binding free energy of about 7% to 19% over the salt concentrations examined. Although ionic interactions support a ligand-quadruplex association, polyelectrolyte


Page 15 of 31

effects of the protonated PIQ-4m ligand, suggested to have two positive charges under the present solution conditions, are only moderate and do not constitute a major driving force for binding. 6.5 6.4 6.3 6.2 6.1 logKa

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


6,0 5.9 5.8 5.7 5.6 5.5 5.4 -1.1 -1.0 -0.9 -0.8 -0.7 -0.6 -0.5 -0.4 -0.3 -0.2 log[K+]

Figure 5. Dependence of the observed association constant Ka on K+ ion concentration for binding of PIQ-4m to the c-MYC quadruplex at 40 °C. The slope –n of the linear least squares regression line indicates the number of displaced K+ ions for each ligand bound and amounts to n = 1.28 ± 0.18. Table 2. Thermodynamic Parameters at Different K+ Concentrations for the High-Affinity Binding of PIQ-4m to the c-MYC Quadruplex at 40 °C.a [K+]

N

Ka (M-1)

∆G°

∆H°

∆S°

∆G°pe

(kcal/mol)b

(kcal/mol)c

(cal/K·mol)b

(kcal/mol)d

120 mM

2.45 ± 0.22

(2.01 ± 0.84)·106

–9.03

–5.43 ± 0.12

11.5

–1.69 (18.7%)

240 mM

2.32 ± 0.06

(1.02 ± 0.29)·106

–8.60

–5.37 ± 0.18

10.3

–1.14 (13.3%)

480 mM

2.23 ± 0.11

(0.34 ± 0.14)·106

–7.92

–4.92 ± 0.20

9.6

–0.59 (7.4%)

a

Average values with standard deviations from three independent measurements. bFrom the standard thermodynamic

relationships ∆G° = –RTlnKa and ∆S° = –∆G°/T + ∆H°/T. cStandard molar enthalpy changes determined from an excess-site method. dAbsolute and relative (in parentheses) free energy contribution from the polyelectrolyte effect.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 31

In contrast to binding free energies and entropies, binding enthalpies of double-stranded DNA minor groove binders have previously been shown to be independent of salt concentration irrespective of monomer or dimer binding and the target sequence.19 These findings are in line with the general view of electrostatic interactions and the release of counterions being entropic in nature.20,21 However, the thermodynamic profiles determined for the quadruplex binding of PIQ-4m at different salt conditions also indicate subtle changes in binding enthalpy with ∆H° becoming less exothermic with increasing ionic strength (Table 2). Finally, to also assess the impact of polyelectrolyte effects as a function of temperature we determined the binding thermodynamics for different salt concentrations at additional temperatures. The corresponding data at 30, 40, and 50 °C are compiled in Table S1 of the Supporting Information. Apparently, ∆G°pe decreases at elevated temperatures associated with a reduced impact of polyelectrolyte effects on PIQ-4m binding for all K+ concentrations (Figure 6). Thus, polyelectrolyte contributions with 120 mM K+ vary between about 21% at 30 °C and 17% at 50 °C. At the same time, the number of displaced K+ ions decreases from n = 1.50 at 30 °C to n = 1.12 at 50 °C (Figure S5 and Table S1). Low-affinity binding as revealed by the only gradual approach of the ITC isotherms to baseline at high ligand-to-quadruplex molar ratios is increasingly attenuated at elevated K+ concentrations, corroborating its strongly electrostatic nature (see also Figure S4). With additional weak interactions mostly eliminated at 40 °C in a buffer with 480 mM K+, we also recorded UV-vis titration curves for an independent determination of binding free energies under identical buffer conditions, i.e. with 5% DMSO as an additive (Figure S6). At 40 °C a stepwise titration of cMYC to the ligand gives sharp isosbestic points within the PIQ-4m absorption range between 330 and 540 nm in line with only two spectrally distinct species. Assuming equivalent binding sites, a non-linear least squares fit of the isotherm constructed by plotting absorbances at 376 nm as a 16 ACS Paragon Plus Environment

Page 17 of 31

function of quadruplex-to-ligand molar ratios yields a Ka = 0.48·106 M-1 and a free energy of –8.1 kcal/mol at 40 °C. This is in very good agreement with a ∆G° = –7.9 kcal/mol as determined by the calorimetric measurements under the same conditions (Table 2) and gives additional confidence in the thermodynamic parameters as obtained from the ITC experiments.

50 °C 40 °C

480

30 °C

[K +] / mM

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


50 °C 240

40 °C 30 °C 50 °C

120

40 °C 30 °C 0

-1

-2

-3

-4

-5

-6

-7

-8

-9

-10

∆G° / kcal/mol

Figure 6. Polyelectrolytic contribution ∆G°pe (black bar) and non-polyelectrolytic contribution (grey bar) to the total binding free energy ∆G° as a function of K+ concentration and temperature. DISCUSSION The present ITC measurements and determined stoichiometries support binding of the indoloquinoline derivative PIQ-4m through high-affinity outer stacking on both the 3’- and 5’-tetrad of the c-MYC quadruplex as previously suggested.11 Clearly, the non-equivalence of quadruplex binding sites is expected to result in different affinities and ITC thermograms at 20 °C may indeed be interpreted by two sequential high-affinity binding events with similar enthalpies of binding. Unfortunately, with Ka values being in the same range no reliable fit parameters using models with extended parameter sets could be obtained for the individual 17 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 31

association processes. On the other hand, at T ≥ 30 °C only one calorimetrically distinct highaffinity species was observed in the thermograms, allowing for the determination of a single binding constant with an equivalent-site model. Apparently, binding affinities increasingly converge and become essentially non-distinguishable at higher temperatures. The use as well as the magnitude of a single association constant as determined by ITC for the high-affinity binding was further confirmed through its close correspondence with results obtained from an independent UV-vis reverse titration. Excluding thermodynamic data at 20 °C (vide supra), we decided to use a reference temperature for the binding experiments of 40 °C close to the human body temperature. It should also be noted, that binding sites with similar affinities may still exhibit very different enthalpic and entropic contributions to binding. Using an excess-site method for the determination of binding enthalpies, mean values are extracted that are biased towards the binding event with higher affinity. However, as mentioned above similar enthalpies of binding are strongly suggested for the two putative ligand outer stacking interactions that are partially resolved by the isotherms acquired at lower temperature. Consequently, assuming only small to moderate differences within the whole temperature range studied, the following free energy analysis although based on averages will likewise apply to both non-equal but similar binding events. The binding of PIQ-4m is enthalpy-driven at T > 20 °C but entropic contributions start to predominate at lower temperatures due to entropy–enthalpy compensation effects over temperature and a negative molar heat capacity ∆Cp°. Based on the still limited data available, negative ∆Cp° values seem to be typical for quadruplex ligands with ∆Cp° ranging from –50 to – 200 cal/molˑK.22-27 Consequently, both molar enthalpy and entropy are a function of temperature with the enthalpic contribution increasing at higher temperatures and vice versa. Also, entropy– 18 ACS Paragon Plus Environment

Page 19 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


enthalpy compensation effects over temperature are expected to be a general feature of ligand– quadruplex interactions. Thus, only small temperature dependent changes of the binding free energy ∆G° are observed with typical values for efficient quadruplex ligands in the range 7–10 kcal/mol.28 In such a situation it is the different enthalpic and entropic contribution to ∆G° that primarily differentiates between ligand–quadruplex associations. Indeed, quadruplex ligands with well-defined thermodynamic profiles vary widely in their relative magnitude of enthalpic and entropic terms at physiological temperatures. Whereas binding of PIQ-4m is mostly enthalpydriven for T > 20 °C, binding of oxazole-based macrocycles with their large nonpolar surface area have been shown to be primarily driven by entropic contributions.22 Whereas the partitioning of free energies into enthalpic and entropic terms gives valuable insight into the energetics of binding, a further dissection of ∆G° may give more detailed information on specific contributory factors for the association process. Based on the comprehensive thermodynamic analysis of PIQ-4m binding and following the concept of a binding free energy that can be approximated by the sum of contributing terms, ∆G° may be parsed according to ∆G° = ∆G°hyd + ∆G°pe + ∆G°res + ∆G°mol

(7)

∆G°hyd and ∆G°pe represent hydrophobic and polyelectrolyte free energy terms, respectively. ∆G°res combines unfavorable effects from the reduction of conformational entropy and from losses in translational and rotational degrees of freedom whereas ∆G°mol involves all noncovalent interactions between the ligand and c-MYC within the formed complex, i.e. hydrogen bonds, ion pairs, dipole-dipole and van der Waals interactions.29-31 Negative heat capacity effects have been associated with a removal of nonpolar surface area exposed to water upon ligand binding (the hydrophobic effect). Employing solvent transfer 19 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 31

experiments of liquid hydrocarbons as a model for the hydrophobic interaction in biomolecular associations, a semiempirical relationship ∆G°hyd = 80·∆Cp° between the molar heat capacity change and the hydrophobic driving force of association was derived.32 It should be noted, however, that this correlation applies for temperatures near 20 °C and is based on the assumption that the total ∆Cp° results from the hydrophobic effect and other contributions, e.g. from changes in vibrational modes upon binding, can be neglected. Therefore, a ∆G°hyd of –5.4 kcal/mol as calculated from the observed heat capacity change should be considered an estimate with uncertainties of up to 20%. Nonetheless, hydrophobic effects associated with the release of water molecules from hydrophobic surfaces into bulk water constitute more than 50% of the overall binding free energy. On the other hand, favorable polyelectrolyte effects through the coupled release of potassium ions upon ligand binding only play a minor role in the formation of a stable complex with a ∆G°pe of –1.7 kcal/mol at 40 °C and 120 mM K+ (Figure 6 and Table 2). Ligand binding may be accompanied by significant changes in conformation. Thus, the intercalation between base pairs in double-stranded DNA will lead to a highly unfavorable free energy due to the formation of an intercalation cavity. On the other hand, simple stacking on an outer G-tetrad can be considered a rigid body association and seems to be free of major rearrangements. One should keep in mind, however, that putative ligand-induced reorientations especially of the quadruplex flanking sequences to form a binding pocket as suggested by the high-resolution structure with a quindoline ligand12 may add to a, albeit rather small, energetic cost from associated changes in conformational entropy. The magnitude for the other contribution to ∆G°res, namely the reduction in the translational and rotational degrees of freedom when two reactants form a complex, has been heavily debated in the past. Remarkably, depending on the particular approach proposed values for the translational and rotational entropy differ by one


Page 21 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


order of magnitude with corresponding free energy contributions ranging from 1 kcal/mol up to 15 kcal/mol at 298 K.20,33 In following established relationships between the thermodynamics of liquid hydrocarbons in H2O and hydrophobic effects in biomolecular interactions, we wanted to arrive at a reasonable estimate for ∆G°res based on our own thermodynamic data that have been collected between 20 and 60 °C for the PIQ-4m binding. Because the entropy for the transfer of hydrocarbons from water to the pure liquid extrapolates to zero at TS = 386 K,34 the temperature dependent contribution from the hydrophobic effect ∆S°hyd to the observed entropy change ∆So is given at any temperature T by ∆S°hyd(T) = ∆Cp°hyd ln(T/TS)

(8)

∆Cp° for binding is generally assumed to be independent of temperature and to entirely result from the hydrophobic interaction. This approximation implies that ∆Cp°hyd = ∆Cp°, affording the hydrophobic contribution ∆S°hyd to the total entropy from eq. 8 in a straightforward way.34 With an observed ∆S° of 11.5 cal/K·mol (see Table 2) and a calculated ∆S°hyd of 14 cal/K·mol at 313 K a residual entropic contribution of –2.5 cal/K·mol must be attributed to non-hydrophobic effects. The latter contributes an unfavorable free energy of 0.8 kcal/mol and originates from losses in conformational entropy and in translational and rotational degrees of freedom but also from favorable polyelectrolyte effects. Assuming the latter to be entirely entropic, the favorable free energy ∆G°pe (–1.7 kcal/mol at 40 °C and 120 mM K+) will be included in the non-hydrophobic T∆S°res term and its separation results in an only modest polyelectrolyte-independent ∆G°res = (0.8 – ∆G°pe) = 2.5 kcal/mol. Likewise, enthalpies for the hydrocarbon aqueous transfer were found to be zero at TH = 295 K.34 In analogy to the determination of ∆S°hyd the contribution of the hydrophobic 21 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 31

interactions ∆H°hyd to the total enthalpy ∆H° can be calculated from the temperature dependence of enthalpies according to ∆H°hyd(T) = ∆Cp°hyd (T–TH)

(9)

With a ∆H°hyd = –1.2 kcal/mol and a ∆H°res = –4.2 kcal/mol both contributions favor binding at 40 °C. Whereas hydrophobic interactions increasingly contribute to ∆H° of ligand binding at elevated temperatures, the residual non-hydrophobic component ∆H°res includes all non-covalent ligand-quadruplex interactions and should be mostly independent of temperature. Having determined ∆H°hyd and ∆S°hyd, ∆G°hyd can be recalculated using ∆G°hyd = ∆H°hyd – T∆S°hyd. The obtained value of –5.6 kcal/mol slightly differs by 0.2 kcal/mol from the value determined by using the semiempirical relationship ∆G°hyd = 80·∆Cp° (vide supra). However, the ∆G°hyd/∆Cp° ratio is strictly derived for T ≃ TH and increases at higher temperatures in line with our results.32 Having quantified most contributions to the total binding free energy ∆G°, the difference between ∆G° and the sum of terms (∆G°hyd + ∆G°pe + ∆G°res) yields the contribution from noncovalent ligand-quadruplex interactions ∆G°mol of –4.2 kcal/mol. It should be noted, that according to our dissection of the total free energy ∆G°mol = ∆H°res, revealing that the same enthalpic contributions can be ascribed to these two parameters. The contribution of individual terms to the binding free energy is summarized in Figure 7. Apparently, specific molecular interactions and hydrophobic effects are of about equal importance in promoting PIQ-4m binding to c-MYC. Because it is primarily ∆G°mol that contributes to a significant enthalpic gain, this thermodynamic analysis also offers a molecular interpretation of the observed enthalpy-driven PIQ-4m–quadruplex association.


Page 23 of 31

4

∆G° res

2 kcal mol-1

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


∆G° hyd

∆G° pe

∆G° mol

0 -2 -4 -6

Figure 7. Free energy terms contributing to the total free energy ∆G° = –9 kcal/mol at 40 °C in the presence of 120 mM K+. Previously, data on the binding thermodynamics have revealed different signatures for DNA duplex intercalators and minor groove binders.35 Whereas intercalators were shown to primarily bind with favorable enthalpy, binding within the duplex minor groove seems to be entropy-driven through the release of bound water within the groove. Although quadruplex ligands seem to share a lot of common thermodynamic features especially when stacking upon the quadruplex outer tetrads, different contributions of hydrophobic effects and of specific molecular interactions to the driving force of association may be valuable fingerprints for binding modes and selectivities towards different quadruplex folds. In the rare case of an established quadruplex groove binder, distamycin A was shown to bind in an entropically driven process.36,37 Apparently, binding within one of the quadruplex grooves leads to the release of bound water with an increase of entropy in analogy to duplex minor groove binders. Similarly, the binding of ligands possessing large nonpolar surface areas as typified by telomestatin or other synthetic oxazole macrocycles is often associated with a favorable entropic term that outweighs enthalpic contributions.22 In addition to extensive π-π stacking interactions with the outer G-tetrads, the release of water on burial of large nonpolar surface upon binding results in considerable hydrophobic effects 23 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 31

associated with significant negative heat capacity changes. This seems to contradict enthalpically driven binding of DNA duplex intercalators. However, in the latter case an entropic penalty is suggested to arise from a stiffening of the helix through intercalation,38 an effect absent for quadruplex outer stacking. Accordingly and in line with the suggested mode of binding, extensive outer stacking interactions combined with additional groove binding of the attached flexible sidechain can be anticipated for the predominantly entropy-driven binding of halogenated cyanine dyes to the c-MYC quadruplex.39 In contrast, ligands with a less extended aromatic surface area but endowed with appropriate substituents for additional interactions with loops or overhang sequences are often found to bind through major enthalpic contributions. Examples include di- and trisubstituted acridines like proflavine27 and BRACO-1940 but also the present indoloquinoline PIQ-4m. As found for the latter, a small negative ∆Cp° associated with only moderate hydrophobic effects seems to be a more general signature in case of quadruplex binding for this type of compounds. On the other hand, expressed by a large and favorable ∆G°mol term binding is equally promoted by more specific intermolecular contacts involving suitable substituents of the ligand. Using a global thermodynamic analysis of calorimetric and spectroscopic data, thermodynamic fingerprints of several ligands binding to the human telomeric G-quadruplex were recently evaluated by also taking into account folding intermediates.41 In line with the present observations, quadruplex binding of non-selective ligands was suggested to be primarily driven by the burial of hydrophobic surfaces whereas binding of more selective ligands was found to be additionally supported by specific intermolecular interactions. At present, the lack of more comprehensive thermodynamic data as well as high-resolution structures of quadruplex-ligand complexes hampers the search for more detailed correlations preferably also including different quadruplex topologies. This will likely change in the future, paving the way for a better rational 24 ACS Paragon Plus Environment

Page 25 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


design of efficient quadruplex ligands based on structural information but also on a more detailed understanding of the binding energetics.

Supporting Information Available • CD spectrum of PIQ-4m in the ITC buffer • Concentration dependent heats of dilution and absorbances of PIQ-4m • Compilation of thermodynamic parameters at different temperatures and K+ concentrations • Representative temperature and salt dependent ITC thermograms • Plots of logKa over log[K+] at 30 °C and 50 °C • UV-vis titration in ITC buffer at 40 °C and 480 mM K+ ACKNOWLEDGEMENTS This research was supported by the Deutsche Forschungsgemeinschaft (INST 292/138-1). REFERENCES (1)

Lam, E. Y. N.; Beraldi, D.; Tannahill, D.; Balasubramanian, S. G-Quadruplex structures

are stable and detectable in human genomic DNA. Nat. Commun. 2013, 4, 1796. (2)

Henderson, A.; Wu, Y.; Huang, Y. C.; Chavez, E. A.; Platt, J.; Johnson, F. B.; Brosh, R.

M., Jr.; Sen, D.; Lansdorp, P. M. Detection of G-quadruplex DNA in mammalian cells. Nucleic Acids Res. 2014, 42, 860–869. (3)

Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S. Quadruplex DNA:

sequence, topology and structure. Nucleic Acids Res. 2006, 34, 5402–5415. (4)

Phan, A. T.; Kuryavyi, V.; Luu, K. N.; Patel, D. J. In Quadruplex Nucleic Acids;

Balasubramanian, S., Neidle, S., Eds.; RSC Publishing: Cambridge, U.K., 2006; Chapter 3.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(5)

Page 26 of 31

Collie, G. W.; Parkinson, G. N. The application of DNA and RNA G-quadruplexes to

therapeutic medicines. Chem. Soc. Rev. 2011, 40, 5867–5892. (6)

Balasubramanian, S.; Neidle, S. G-Quadruplex nucleic acids as therapeutic targets. Curr.

Opin. Chem. Biol. 2009, 13, 345–353. (7)

Ou, T.-M.; Lu, Y.-J.; Zhang, C.; Huang, Z.-S.; Wang, X.-D.; Tan, J.-H.; Chen, Y.; Ma, D.-

L.; Wong, K.-Y.; Tang, J. C.-O.; Chan, A. S.-C.; Gu, L.-Q. Stabilization of G-quadruplex DNA and down-regulation of oncogene c-myc by quindoline derivatives. J. Med. Chem. 2007, 50, 1465–1474. (8)

Müller, S.; Sanders, D. A.; Di Antonio, M.; Matsis, S.; Riou, J.-F.; Rodriguez, R.;

Balasubramanian, S. Pyridostatin analogues promote telomere dysfunction and long-term growth inhibition in human cancer cells, Org. Biomol. Chem. 2012, 10, 6537–6546. (9)

Neo, J. L.; Kamaladasan, K.; Uttamchandani, M. G-Quadruplex based probes for visual

detection and sensing. Curr. Pharm. Des. 2012, 18, 2048–2057. (10)

Monchaud, D.; Teulade-Fichou, M.-P. A hitchhiker’s guide to G-quadruplex ligands. Org.

Biomol. Chem. 2008, 6, 627–636. (11)

Funke, A.; Dickerhoff, J.; Weisz, K. Towards the development of structure-selective G-

quadruplex-binding indolo[3,2-b]quinolines. Chem. Eur. J. 2016, 22, 3170–3181. (12)

Dai, J.; Carver, M.; Hurley, L. H.; Yang, D. Solution structure of a 2:1 quindoline-c-MYC

G-quadruplex: insights into G-quadruplex-interactive small molecule drug design. J. Am. Chem. Soc. 2011, 133, 17673–17680. (13)

Ambrus, A.; Chen, D.; Dai, J.; Jones, R. A.; Yang, D. Solution structure of the biologically

relevant G-quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization. Biochemistry 2005, 44, 2048–2058.


Page 27 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(14)


Haq, I.; Chowdhry, B. Z.; Jenkins, T. C. Calorimetric techniques in the study of high-order

DNA-drug interactions. Methods Enzymol. 2001, 340, 109–149. (15)

Haq, I.; Ladbury, J. E.; Chowdhry, B. Z.; Jenkins, T. C. Molecular anchoring of duplex

and triplex DNA by disubstituted anthracene-9,10-diones: calorimetric, UV melting, and competition dialysis studies. J. Am. Chem. Soc. 1996, 118, 10693–10701. (16)

Manning, G. S. The molecular theory of polyelectrolyte solutions with applications to the

electrostatic properties of polynucleotides. Quart. Rev. Biophys. 1978, 11, 179–246. (17)

Manning, G. S. Counterion condensation on charged spheres, cylinders, and planes. J.

Phys. Chem. B 2007, 111, 8554-8559. (18)

Wyman, J., Jr. Linked functions and reciprocal effects in hemoglobin: a second look. Adv.

Protein Chem. 1964, 19, 223-286. (19)

Wang, S.; Kumar, A.; Aston, K.; Nguyen, B.; Bashkin, J. K.; Boykin, D. W.; Wilson, W.

D. Different thermodynamic signatures for DNA minor groove binding with changes in salt concentration and temperature. Chem. Commun. 2013, 49, 8543–8545. (20)

Spolar, R. S.; Record, M. T., Jr. Coupling of local folding to site-specific binding of

proteins to DNA. Science 1994, 263, 777–784. (21)

Record, M. T., Jr.; Ha, J.-H.; Fisher, M. A. Analysis of equilibrium and kinetic

measurements to determine thermodynamic origins of stability and specificity and mechanism of formation of site-specific complexes between proteins and helical DNA. Methods Enzymol. 1991, 208, 291–343. (22)

Pilch, D. S.; Barbieri, C. M.; Rzuczek, S. G.; LaVoie, E. J.; Rice, J. E. Targeting human

telomeric G-quadruplex DNA with oxazole-containing macrocyclic compounds. Biochimie 2008, 90, 1233–1249.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(23)

Page 28 of 31

Arora, A.; Balasubramanian, C.; Kumar, N.; Agrawal, S.; Ojha, R. P.; Maiti, S. Binding of

berberine to human telomeric quadruplex – spectroscopic, calorimetric and molecular modeling studies. FEBS J. 2008, 275, 3971–3983. (24)

Bhadra, K.; Kumar, G. S. Interaction of berberine, palmatine, coralyne, and sanguinarine

to quadruplex DNA: a comparative spectroscopic and calorimetric study. Biochim. Biophys. Acta 2011, 1810, 485–496. (25)

Ghosh, S.; Pradhan, S. K.; Kar, A; Chowdhury, S.; Dasgupta, D. Molecular basis of

recognition of quadruplexes human telomere and c-myc promoter by the putative anticancer agent sanguinarine. Biochim. Biophys. Acta 2013, 1830, 4189–4201. (26)

Bhowmik, D.; Fiorillo, G.; Lombardi, P.; Kumar, G. S. Recognition of human telomeric

G-quadruplex DNA by berberine analogs: effect of substitution at the 9 and 13 positions of the isoquinoline moiety. J. Mol. Recognit. 2015, 28, 722–730. (27)

Basu, A.; Kumar, G. S. Calorimetric investigation on the interaction of proflavine with

human telomeric G-quadruplex DNA. J. Chem. Thermodynamics 2016, 98, 208–213. (28)

Pagano, B.; Mattia, C. A.; Giancola, C. Applications of isothermal titration calorimetry in

biophysical studies of G-quadruplexes. Int. J. Mol. Sci. 2009, 10, 2935–2957. (29)

Chaires, J. B. Energetics of drug-DNA interactions. Biopolymers 1997, 44, 201–215.

(30)

Haq, I. Thermodynamics of drug-DNA interactions. Arch. Biochem. Biophys. 2002, 403,

1–15. (31)

Ren, J.; Jenkins, T. C.; Chaires, J. B. Energetics of DNA intercalation reactions.

Biochemistry 2000, 39, 8439–8447. (32)

Ha, J.-H.; Spolar, R. S.; Record, M. T., Jr. Role of the hydrophobic effect in stability of

site-specific protein-DNA complexes. J. Mol. Biol. 1989, 209, 801–816.


Page 29 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(33)


Tamura, A.; Privalov, P. L. The entropy cost of protein association. J. Mol. Biol. 1997,

273, 1048-1060. (34)

Baldwin, R. L. Temperature dependence of the hydrophobic interaction in protein folding.

Proc. Natl. Acad. Sci. USA 1986, 83, 8069-8072. (35)

Chaires, J. B. A thermodynamic signature for drug-DNA binding mode. Arch. Biochem.

Biophys. 2006, 453, 26–31. (36)

Pagano, B.; Virno, A.; Mattia, C. A.; Mayol, L.; Randazzo, A.; Giancola, C. Targeting

DNA quadruplexes with distamycin A and its derivatives: an ITC and NMR study. Biochimie 2008, 90, 1224–1232. (37)

Martino, L.; Virno, A.; Pagano, B.; Virgilio, A.; Di Micco, S.; Galeone, A.; Giancola, C.;

Bifulco, G.; Mayol, L.; Randazzo, A. Structural and thermodynamic studies of the interaction of distamycin A with the parallel quadruplex structure [d(TGGGGT)]4. J. Am. Chem. Soc. 2007, 129, 16048–16056. (38)

Reinert, K. E. Anthracycline-binding induced DNA stiffening, bending and elongation;

stereochemical implications from viscometric investigations. Nucleic Acids Res. 1983, 11, 3411– 3430. (39)

Nanjunda, R.; Owens, E. A.; Mickelson, L.; Alyabyev, S.; Kilpatrick, N.; Wang, S.;

Henary, M.; Wilson, W. D. Halogenated pentamethine cyanine dyes exhibiting high fidelity for G-quadruplex DNA. Bioorg. Med. Chem. 2012, 20, 7002–7011. (40)

White, E. W.; Tanious, F.; Ismail, M. A.; Reszka, A. P.; Neidle, S.; Boykin, D. W.; Wilson,

W. D. Structure-specific recognition of quadruplex DNA by organic cations: influence of shape, substituents and charge. Biophys. Chem. 2007, 126, 140–153.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(41)

Page 30 of 31

Bončina, M.; Podlipnik, Č.; Piantanida, I.; Eilmes, J.; Teulade-Fichou, M.-P.; Vesnaver,

G.; Lah, J. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes. Nucleic Acids Res. 2015, 43, 10376–10386.


Page 31 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC Graphic


Comprehensive Thermodynamic Profiling for the Binding of a G

Recommend Documents