Concurrent Ethene Generation and Growth of Dehalococcoides

As part of an ERD field demonstration, 45 groundwater samples were analyzed ... reductive dechlorination (ERD) is a cost-effective technology for reme...
0 downloads 0 Views 2MB Size
Download PDF
Environ. Sci. Technol. 2008, 42, 9302–9309

Concurrent Ethene Generation and Growth of Dehalococcoides Containing Vinyl Chloride Reductive Dehalogenase Genes During an Enhanced Reductive Dechlorination Field Demonstration C H A R L O T T E S C H E U T Z , * ,† NEAL D. DURANT,‡ PHILIP DENNIS,§ M A R I A H E I S T E R B E R G H A N S E N , †,∇ T O R B E N J Ø R G E N S E N , |,# RASMUS JAKOBSEN,† EVAN E. COX,⊥ AND POUL L. BJERG† Department of Environmental Engineering, Technical University of Denmark, Bygningstorvet - Building 115, DK-2800 Kgs. Lyngby, Denmark, Geosyntec Consultants, Columbia, Maryland 21046, SiREM, Guelph, Ontario, N1G5G3 Canada, COWI A/S, Odense, Denmark, and Geosyntec Consultants, Guelph, Ontario, N1G5G3, Canada

Received March 17, 2008. Revised manuscript received July 25, 2008. Accepted August 22, 2008.

Dehalococcoides bacteria that produce catabolic vinyl chloride (VC) reductive dehalogenase enzymes have been implicatedasarequirementforsuccessfulbiologicaldechlorination of VC to ethene in groundwater systems. Therefore, the functional genes in Dehalococcoides that produce VC reductase (e.g., vcrA) may be important biomarkers for predicting and monitoring the performance of bioremediation systems treating chloroethenes via enhanced reductive dechlorination (ERD). As part of an ERD field demonstration, 45 groundwater samples were analyzed for vcrA using quantitative PCR. The demonstration delivered lactate continuously via groundwater recirculation over 201 days to an aquifer contaminated with cis1,2-dichloroethene (cDCE, ∼150 µM) and VC (∼80 µM). Ethene (∼4 µM) and Dehalococcoides containing vcrA (average concentration of 4 × 103 gene copies L-1) were detected a priori in the demonstration plot; however, aquifer materials in a bench treatability test were able to dechlorinate cDCE with only a 4-month lag period. Given the short (7month) schedule for the field demonstration, the field plot was bioaugmented on Day 69 with a mixed culture (KB-1) that included Dehalococcoides containing vcrA. Stimulated ethene generation commenced within four weeks of donor addition. Ethene concentrations increased until Day 145, and reached maximum concentrations of 10-25 µM. Concentrations of * Corresponding author phone: +45 45 25 16 07; fax: + 45 45 93 28 50; e-mail: [email protected]. † Technical University of Denmark. ‡ Geosyntec Consultants, Columbia, Maryland. § SiREM. | COWI A/S. ⊥ Geosyntec Consultants, Guelph, Ontario. # Present address: Rambøll, Odense, Denmark. ∇ Present address: NIRAS Consulting Engineers A/S, Allerød, Denmark. 9302

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 24, 2008

vcrA increased concurrently with ethene production until Day 145, and plateaued thereafter at 107 to 108 gene copies L-1. These results indicate simultaneous growth of Dehalococcoides containing vcrA and ethene generation in an ERD field application. The quantitative increase in concentrations of Dehalococcoides containing vcrA at this site provides further evidence that the vcrA gene is an effective biomarker for fieldscale ERD systems.

Introduction In situ biological enhanced reductive dechlorination (ERD) is a cost-effective technology for remediation of chlorinated solvents in groundwater under a variety of conditions. ERD typically involves in situ injection of fermentable organic substrates (i.e., electron donor) and, in many instances, bioaugmentation with dehalorespiring bacterial cultures to promote dechlorination of chlorinated solvents to innocuous end-products. In the case of tetrachloroethene (PCE) and trichloroethene (TCE), ERD facilitates sequential dechlorination to cis-1,2-dichloroethene (cDCE), vinyl chloride (VC), and ethene. A range of phylogenetically different bacteria are known to mediate partial reductive dechlorination of PCE and TCE (e.g., Sulfurospirillium multivorans and Dehalobacter restrictus); however, only bacteria belonging to the genus Dehalococcoides are known to mediate complete dechlorination of PCE and TCE to ethene (1, 2). While bacteria capable of dechlorinating PCE and TCE are widespread in aquifers, Dehalococcoides capable of dechlorinating TCE to ethene occur naturally in some aquifers but are absent in others (3-7). Whether introduced via bioaugmentation, or naturally occurring, the presence of specific Dehalococcoides bacteria appears to be a prerequisite for effective and complete treatment of PCE and TCE in ERD systems (2, 5-11). A growing body of research has revealed significant diversity within the Dehalococcoides genus, and different strains of Dehalococcoides have been shown to dechlorinate chloroethenes with varying degrees of efficiency. For example, Dehalococcoides ethenogenes strain 195 respires PCE, TCE, and DCE, but transforms VC to ethene slowly by cometabolism (1). Dehalococcoides strain CBDB1 respires polychlorinated benzenes, phenols, and dibenzodioxins, but is incapable of dechlorination of chlorinated ethenes (12). Strain BAV1 respires DCE isomers and VC, and cometabolizes PCE and TCE in the presence of DCE or VC (13). Unlike Dehalococcoides strains 195 and CBDB1, the mixed Dehalococcoides cultures Victoria (13), KB-1 (14), and Pinellas (15) are capable of respiratory dechlorination of VC (16). Dehalococcoides strain GT, which is affiliated with the Pinellas group, also has been shown to respire TCE, cDCE, and VC (17). Increasingly, research on Dehalococcoides has focused on the diversity of membrane-bound dehalogenase enzymes (RDases) that mediate dechlorination reactions by pure and mixed cultures. Differences in metabolic capabilities of various Dehalococcoides strains are likely due, in large part, to differences in the RDase genes unique to each strain. Seventeen putative RDase genes have been identified in strain 195 (18), including tceA, which was the first Dehalococcoides RDase gene sequenced (19, 20). Genomic sequencing identified 32 putative RDase genes in strain CBDB1 that may participate in chlorobenzene dechlorination (21). At least 14 putative RDase genes each have been identified in Dehalococcoides strain FL2 and in the mixed culture KB-1 (22, 23). Dehalococcoides in all cultures known to respire VC produce vinyl chloride reductive dehalogenases (VC 10.1021/es800764t CCC: $40.75

 2008 American Chemical Society

Published on Web 11/13/2008

FIGURE 1. (A) Geologic profile of the PTA. (B) Plan view of the PTA including injection (filled circles, b), extraction (shaded circles), and monitoring (open circles, O) wells; and principal groundwater flow direction (dashed arrow). RDases), which are responsible for respiratory dechlorination of VC to ethene (17, 23). Mu ¨ ller et al. (16) successfully isolated a VC RDase and the corresponding gene (vcrA) from Dehalococcoides strain VS from the Victoria culture. vcrA is the only RDase gene for which the corresponding protein has been purified and dehalogenase activity on VC (and cDCE) confirmed. A putative VC RDase gene (bvcA) was detected in Dehalococcoides BAV1 and KB-1 and its relationship to VC dechlorination assessed by transcriptional analysis (13, 23); however, the enzyme corresponding to bvcA has not yet been purified; the evidence for its role in VC dechlorination is based on detection in RNA (13, 24). Dehalocococcoides containing vcrA or bvcA have been demonstrated to respire both cDCE and VC (16, 17, 25, 26), while Dehalocococcoides containing tceA respire TCE and cDCE (18-20, 25, 26). The mechanism of VC metabolism by Dehalococcoides has critical relevance to ERD systems, as VC appears to be the most toxic of the chlorinated ethenes (27), and dechlorination of VC to ethene is often the rate-limiting step in treatment by ERD. As such, the presence of Dehalococcoides capable of growth on VC has been identified as a requirement for optimizing ERD systems (7, 16, 28). It has been suggested that the potential success of ERD remedies can be predicted based on molecular genetic assays for the Dehalococcoides group (29). Most commonly, this relationship has been established in the field primarily using tests targeting the Dehalococcoides 16S rRNA gene (3, 5, 11); however, such analyses are not adequate to predict ERD performance because they cannot distinguish between Dehalococcoides strains with differing VC dechlorination capabilities (14, 16, 23). The vcrA gene sequence isolated by Mu ¨ller et al. (16) provides a more relevant biomarker than the 16S rRNA gene for detection and monitoring of Dehalococcoides containing the vcrA gene in natural and engineered systems. Lookman et al. (7) provided qualitative PCR data from a Flemish site indicating a link between ethene generation and the presence of Dehalococcoides VC RDase genes (both vcrA and bvcA). Recently, Lee et al. (30) used tceA, vcrA, and bvcA gene sequences as biomarkers during an ERD test and reported an increase in vcrA and bvcA concurrent with dechlorination; however, after one year of treatment, mainly cDCE and VC had been produced, and consequently increases in vcrA and bvcA were not clearly correlated to respiration of VC by Dehalococcoides (30). This paper describes the application of quantitative polymerase chain reaction (qPCR) analysis to monitor the growth of Dehalococcoides containing vcrA during a full-scale ERD field demonstration. Data presented herein provide field

evidence linking ethene generation to quantitative growth of Dehalococcoides containing vcrA temporally and spatially in an active ERD field system. These data further elucidate the importance of Dehalococcoides containing vcrA in chloroethene-contaminated aquifers, and pose implications for the design and optimization of ERD systems. The collective results provide further evidence of the effectiveness of ERD as a technology for in situ remediation of chlorinated solvents, and novel data linking concurrent ethene generation and growth of Dehalococcoides containing vcrA in the field at full scale.

Materials and Methods Site Description. The demonstration site (Rugårdsvej 234, Odense, Denmark) is a former manufacturing facility where historical practices resulted in chlorinated solvent and oily waste contamination in the subsurface. Contamination was distributed throughout a 10-15 m thick sequence of interbedded clay till, sand stringers, and thin sand aquifer (Figure 1A). The primary source area in the shallow clayey till was excavated prior to the field demonstration; however significant residual contamination (primarily cDCE and VC) remained, sustaining a ∼150 m long cDCE/VC plume in the underlying sand aquifer. The pilot test area (PTA) for the ERD demonstration was established within the sand aquifer, which had a thickness of approximately 0.5-1 m, at depths ranging between 10 and 14 m below ground surface (Figure 1A). The horizontal hydraulic conductivity of the sand aquifer was estimated at 6 × 10-5 m s-1 from aquifer testing and the natural groundwater pore flow velocity was estimated at 0.24 m d-1. Prior to the field demonstration, geochemical conditions in the aquifer were predominantly iron- and sulfate-reducing. The maximum dissolved concentrations of cDCE, VC, and ethene in the PTA proximal to the source area were 12, 3.3, and 0.1 mg L-1, respectively. The collective data indicated that slow natural reductive dechlorination of cDCE and VC was occurring in the clay till (31), but suggested that dechlorination in the sand layer was largely stalled at cDCE (typical molar fractions of cDCE were between 60 and 84%). Pilot Test Layout and Operation. A closed-loop, recirculation design was selected for the test due to its demonstrated ability (e.g., refs 9, 10) to effectively deliver bioremediation additives and provide an opportunity to measure solute mass balances. Visual MODFLOW version 3.1.0 (Waterloo Hydrogeologic, Waterloo, ON) was used to develop a numerical groundwater flow model, and to evaluate various recirculation layout and pumping designs. Design objectives included achieving effective recirculation flow across the VOL. 42, NO. 24, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

9303

treatment zone, while minimizing contaminant spreading due to recirculation flow and maximizing recirculation capture. The final PTA design consisted of three injection wells, one extraction well, nine performance monitoring wells, and a control shed containing pumps, flowmeters, gauges, and filters to manipulate flow and delivery of amendments (Figure 1B). The distance between the injection wells and extraction well was 29 m and the design treatment volume for the PTA was approximately 280 m3, assuming an average aquifer thickness of 1 m and effective porosity of 0.25. Groundwater was extracted continuously at an average rate of 2.4 L min-1 using a Grundfos MP1 pump. The recirculation system was operated continuously over the following three phases of the demonstration: baseline monitoring (Day -16) and recirculation (Day -3 to Day 0); biostimulation alone (Day 0 to Day 69); biostimulation and bioaugmentation (Day 69 to Day 201). Although the groundwater data suggested that the site possessed a natural capacity for ethene generation, bioaugmentation was deemed necessary because the predesign biotreatability study determined that the indigenous bacteria were not able to dechlorinate cDCE without a 4-month lag period (see Supporting Information (SI)), and the objective time frame for the field demonstration period was 7 months. Tracer Tests. Two separate pulse input tracer tests were conducted to estimate flow velocity, residence times, influence area, and dilution in the PTA (details given in SI). Electron Donor Addition and Bioaugmentation. The design lactate concentration was based on the stoichiometric demand for reducing equivalents calculated from electron acceptors in the PTA and a safety factor of 5. Over the 201 day test, sodium lactate (60% w/w solution) was metered into the injection stream once daily in 13-min pulses to achieve a time-weighted average (TWA) concentration of 400 mg sodium lactate L-1. An estimated 455 kg of sodium lactate solution was injected over the 201 day test. At Day 69, after strongly reducing conditions had been established throughout the PTA (as indicated by decrease in average oxidationreduction potential [ORP] from 29 to -253 mV), each of three injection wells was bioaugmented with 9.3 L of KB-1 culture (SiREM, Guelph, Ontario) containing 108 Dehalococcoides cells mL-1. KB-1 is a PCE-to-ethene dechlorinating bacterial consortium consisting predominantly of Dehalococcoides organisms (32) that contain RDase genes highly similar to the VC RDase gene sequences Dehalococcoides strains VS (vcrA) and BAV1 (bcvA) (23). The culture was shipped to the site in two stainless steel vessels containing an N2/CO2 headspace. The culture was injected into the recirculation line at each injection well by connecting an N2-pressurized line to the KB-1 vessel, and displacing and transferring the culture via a discharge line into the recirculation line. The total volume of KB-1 injected (28 L) represented 0.01% of the design treatment pore volume. Collection of Groundwater Samples. Groundwater samples were collected biweekly from the nine PTA performance monitoring wells throughout the test. Additional wells outside the PTA were sampled at the beginning and end of the test period to assess the recirculation impact outside the PTA. Groundwater samples were collected using dedicated tubing and standard sampling protocols (i.e., the well was purged of two casing plus gravel pack volumes, and purge stabilization parameters (pH, temperature, ORP, dissolved oxygen [DO]) were monitored via an in-line flow-through cell (WTW-electrodes and instruments, Fagerberg, Brøndby, Denmark) prior to sample collection). Samples were analyzed for anions (nitrate and sulfate), cations (dissolved iron, lithium), hydrogen gas (H2), short-chained organic acids (lactate, acetate, formate, and propionate), chlorinated ethenes, dissolved hydrocarbon gases (ethene, ethane, and methane), and the vcrA gene. Groundwater samples were 9304

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 24, 2008

collected from an in-line 3-way valve using a syringe and transferred directly to sampling vials. All samples were maintained at 4 °C until analysis. The procedures for analysis of the biotreatability study and the PTA samples are described in the SI. Extraction of Genomic DNA. Samples for molecular analysis were collected periodically from a subset of performance monitoring wells to measure changes in concentration of vcrA temporally and spatially in the PTA. Groundwater samples (100-500 mL, depending on solids concentration) for molecular analysis were decanted into 0.20 µm cellulose nitrate filter units (Nalgene) and vacuum filtered. Filters were transferred into sterile 50 mL centrifuge tubes and stored at -20 °C. DNA was extracted using a PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc.). Up to 0.25 g of solids was used per isolation. Filters were placed into Bead Solution and pulverized using a sterile pipet tip. All subsequent DNA extraction steps were performed according to the manufacturer’s instructions. Cell lyses were performed using a MiniBeadbeater-8 (Biospec Products) at 50% of the maximum setting for 30 s. A negative control consisting of sterile water filtered and extracted with each set of samples was used to rule out background DNA or cross contamination. Quantitative PCR. Concentrations of Dehalococcoides containing vcrA were measured in samples collected on Days -16, 62, 90, 116, 145, 175, and 201; while concentrations of total Dehalococcoides (i.e., as measured by 16S rRNA) were measured in samples collected on Day -16 and Day 201. Primers used for the quantification of the vcrA gene were rdhA14_642f (GAAAGCTCAGCCGATGACTC) and rdhA14_846r (TGGTTGAGGTAGGGTGAAGG) (23). Primers used for quantification of total Dehalococcoides (16S rRNA gene) were performed using DuPont Primer Set 1 [U.S. patent US6894156B2 (Hendrickson and Ebersole)], which is similar to primer sets reported by Hendrickson et al. (3), and contains primers that bind to variable regions 4 and 7 of the Dehalococcoides 16S rRNA gene, producing a 512-bp amplicon. Forty µL PCR reactions consisted of 20 µL of 2X iQ SYBR Green Supermix (Bio-Rad Laboratories Inc.), 1.6 µL of primer mix (10 pmol each primer), and 18.4 µL of template DNA. Thermocycling was performed as follows: for 16S rRNA primers, initial denaturation of 94 °C for 2 min; 40 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min with a final extension of 8 min; for vcrA primers, initial denaturation at 94 °C for 5 min with 36 cycles of 94 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min with a final extension of 10 min at 72 °C. Data collection and multicomponent analysis were performed with MyiQ Single-Color Real-Time PCR Detection System Software (Bio-Rad Laboratories Inc.). Standard curves of threshold fluorescence (Ct) versus gene copy number were produced using dilutions of fluorometry-quantified plasmids containing either cloned Dehalococcoides vcrA genes or 16S rRNA genes [1386 bp length fragment of the Dehalococcoides strain KB-1/VC 16S rRNA gene (14)], and were used to quantify the number of DNA targets in samples. The specificity and identity of the PCR products was verified by a melting curve analysis between 72 and 95 °C. Quantification limits for the vcrA assays and the total Dehalococcoides (16s rRNA) were approximately 4300 gene copies L-1. For the pre-demonstration and Day 201 samples that were analyzed for Dehalococcoides 16S rRNA genes, total Dehalococcoides as a percentage of the total bacterial population was calculated by quantifying total DNA using fluorometry and assuming that all DNA extracted was prokaryotic and that each non-Dehalococcoides bacterium contained 4.0 × 10-6 ng of DNA (35). The mass of DNA attributed to Dehalococcoides was subtracted from the total DNA quantified by multiplying the moles of Dehalococcoides (Dehalo-

coccoides gene copy titer/Avogadros number) by an assumed genome size of 1.5 million base pairs multiplied and an assumed 660 Daltons per base pair. Sequencing of Amplified DNA Sequences. Genomic DNA extracts from a subset of samples representing pre- and postbioaugmentation conditions were sequenced in order to compare the RDase sequences of indigenous Dehalococcoides populations against those of KB-1. PCR amplification and direct sequencing of vcrA genes (PCR products) was performed on three DNA samples collected prior to bioaugmentation (from wells M101, M102, and M2 on Day 62), and two samples collected post-bioaugmentation (from wells M101 and B119 on Day 201). The PCR primers used for amplification and for sequencing were “vcr f” (5′-CTATGAAGGCCCTCCAGATGC-3′) and “vcr r” (5′-GTAACAGCCCCAATATGCAAGTA-3′) (16). These primers are specific for the vcrA gene sequences in strain VS (16) and KB-1 (i.e., KB-1 rdhA14 (23)), and have been shown to detect genes highly similar to Dehalococcoides vcrA in a wide variety of environmental samples (16, 36). Sequences used in the vcrA gene alignment of the 3′ end of the primer were produced by using the compliment of sequences obtained using the reverse primer (vcr r). The DNA sequences obtained were aligned and compared with the vcrA sequence from SiREM KB-1 culture and the published KB-1 vcrA sequence (rdhAB14 [GenBank Accession DQ177519]).

Results Geochemistry and Electron Donor Trends in the PTA. Prior to biostimulation, the groundwater was moderately anaerobic with an average ORP on the order +29 mV, and iron- to sulfate-reducing conditions throughout the PTA (nondetectable concentrations of oxygen and nitrate, 0.8-4.0 mg L-1 dissolved iron, 55-123 mg L-1 sulfate, and 0.2-2.0 mg L-1 methane [Figure 2A]). H2 concentrations were between 0.2 and 2.3 nM (Figure 2B). Biostimulation with lactate immediately resulted in the onset of stimulated sulfate reduction and concurrent removal of dissolved iron (presumably via precipitation of FeS). After 200 days of lactate addition, sulfate was completely reduced in all wells with the exception of well M103 (Figure 2A). After 120-160 days small amounts of methane (0.8-6.6 mg L-1) were detected in all wells, and average ORP values decreased to -300 mV, indicating the establishment of highly reducing conditions (data not shown). Lactate in the PTA was fermented rapidly as evidenced by only trace detections of lactate and significant formation of propionate, acetate, and H2 in the two wells nearest the injection wells (Figure 2B). These fermentation products were transported with the groundwater, supplying electron donor in the PTA to a distance of 20-25 m from the injection wells. In wells located up to 15 m from the injection wells, concentrations of acetate increased to 2-3 mM (118-177 mg L-1) and propionate increased to 1-1.5 mM (73-110 mg L-1) until Day 120. At the same time, H2 concentrations increased to 2-19 nM. After Day 120, concentrations decreased to approximately 0.5-1.5 mM for propionate and acetate and 0.5-5 nM for H2, and remained at these levels throughout the test period (Figure 2B). Overall, the addition of lactate led to an increase of dissolved carbon and H2 in the PTA, providing reducing equivalents to support dechlorination. The measured H2 concentrations were at or above the threshold values reported for reductive dechlorination (0.4-2 nM) (33, 34). Chlorinated Ethene and Ethene Concentration Trends in the PTA. Prior to the field demonstration, the following maximum dissolved phase concentrations were observed in the PTA: TCE at 1.5 µM (0.2 mg L-1), cDCE at 124 µM (12 mg L-1), VC at 56 µM (3.3 mg L-1), ethene at 3.6 µM (0.1 mg L-1), and ethane at 0.7 µM (0.02 mg L-1). The onset of stimulated

dechlorination of cDCE to VC in the PTA was evident soon after the commencement of lactate addition, and the first appearance of ERD at each monitoring point generally correlated to the average groundwater flow velocity (0.5 m d-1) within the PTA. At monitoring well B119, located within an estimated 10-day groundwater travel time from the injection wells, stimulated dechlorination of cDCE to VC was evident within 15 days of lactate addition, and stimulated ethene generation commenced by Day 25 (Figure 2C and D). Similarly, at monitoring well M2, located within an estimated 37 day average hydraulic residence time of injection, stimulated dechlorination of cDCE began by Day 62 (Figure 2C). Significant reductions in cDCE were apparent throughout the PTA monitoring network by Day 116 (Table S2 in SI), and those reductions continued throughout the demonstration. In general, decreases in cDCE concentrations were balanced by concurrent increases in the concentrations and molar fractions of VC and ethene (Figures 2C and D). The increase in VC molar fraction was transient, while the molar fraction of ethene increased steadily throughout most of the demonstration (Figures 2C). At the conclusion of the demonstration (Day 201), the average molar fraction of ethene+ethane in PTA wells had increased from 3% ((3) to 54% ((27) (Table S2 in SI). PTA Trends in Total Dehalococcoides and Dehalococcoides Containing vcrA. Increases in ethene after commencement of lactate addition were accompanied by a 3-4 order of magnitude increase in concentrations of vcrA gene copies throughout the PTA monitoring network (Figures 2D and 3). Prior to start-up of the field demonstration, Dehalococcoides containing vcrA was detected in the PTA groundwater at estimated concentrations (all below method quantification limits) in the range of 3 × 102 to 9 × 103 gene copies L-1, except for well M103, where Dehalococcoides containing vcrA was not detected. By Day 62, vcrA concentrations increased to 3 × 104 to 5 × 106 gene copies L-1 (except for wells B119 and M103, where vcrA was not detected) suggesting growth of indigenous Dehalococcoides containing vcrA (Figure S2 in SI). Twenty eight L of KB-1 containing approximately 2.7 × 1012 total Dehalococcoides cells was injected into the PTA on Day 69; however, the effect of bioaugmentation on total Dehalococcoides and vcrA counts in the PTA was not readily apparent, as growth of native Dehalococcoides containing vcrA and ethene generation appeared to commence prior to bioaugmentation (Figure S2 in SI). As the field demonstration progressed, the concentration of Dehalococcoides containing vcrA increased both temporally and spatially in the PTA, and increases in vcrA concentrations progressed in the direction of groundwater flow (Figures 3 and S2 in SI). Concentrations of Dehalococcoides containing vcrA concentrations peaked in the range of 3 × 107 to 1 × 108 gene copies L-1 in the majority of monitoring wells by Day 145 (equivalent time frame for two pore volume flush); thereafter, concentrations plateaued (Figures 2D and 3). Consistent with the trends in Dehalococcoides containing vcrA, the concentration of total Dehalococcoides in the PTA increased significantly between Day -16 and Day 201 (Figure 4A), and the proportion of Dehalococcoides DNA as a percent of the total biomass DNA also increased significantly, typically reaching 15-20% of the total biomass by Day 201 (Figure 4C). These data indicate that by the end field demonstration, Dehalococcoides represented a substantially greater fraction of the total bacterial population in PTA than was observed for the baseline conditions. In most samples where both total Dehalococcoides and Dehalococcoides containing vcrA were detected, total Dehalococcoides gene copies were approximately 1 order of magnitude higher (Figure 4A and B). VOL. 42, NO. 24, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

9305

FIGURE 2. (A) Redox parameters, (B) electron donor, (C) chlorinated ethene (mol fraction), and (D) Dehalococcoides containing vcrA and ethene concentration trends in PTA during field demonstration. The average hydraulic residence time between injection and wells B119.d, M101, and M2 was 7, 20, and 37 d, respectively (see tracer test details in SI). It is noted that lactate addition commenced on Day 0 and injection wells were bioaugmented on Day 69. H2 was not measured in well M101. Dehalococcoides Containing vcrA - DNA Sequences in PTA Samples. PCR products from the pre-bioaugmentation samples produced high quality sequences only from the 3′ end of the vcrA gene, providing approximately 600 base pairs of sequence for analysis. Alignment of these sequences with a published KB-1 vcrA sequence (i.e., rdhAB14 [GenBank Accession DQ177519]) indicated that, over the region compared, all of the sequences were virtually identical to the KB-1 vcrA sequence with the exception of variability at position 635 and several putative sequencing artifacts. These results indicate that the indigenous Dehalococcoides harbors a vcrA gene sequence very similar, or identical, to that found in KB-1 over the region analyzed. The vcrA sequence of the postbioaugmentation samples from well B119 and well M101 were 100% and 99.9% identical, 9306

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 24, 2008

respectively, to the published KB-1 vcrA sequence over 1225 base pairs (see Figure S3 in SI).

Discussion The presence of Dehalococcoides bacteria that contain VC RDase genes such as vcrA is thought to be a prerequisite for effective and complete treatment of chloroethenes via ERD. As such, application of qPCR with vcrA gene probes may serve as a valuable tool for evaluating performance of ERD systems at chloroethene sites. At a field site in Denmark, probes complementary to the vcrA gene were effective for predicting and monitoring treatment of cDCE and VC during an ERD demonstration. Dehalococcoides containing vcrA were detected at this field site prior to implementation of ERD

FIGURE 3. Total sum of dissolved chlorinated ethenes, ethene, and suspended Dehalococcoides containing vcrA over time in the PTA during field demonstration. Calculations are based on the measured groundwater concentrations in wells I102, B103.d, B119.d, M102, M1, M101, M2, B123.d, M103, M3, and AV, a porosity of 0.25, and involved subdividing the PTA treatment volume into rectangular blocks that extended across the PTA (transgradient to the principal flow direction) between each well pair along the principal flow direction. A homogeneous distribution of contaminants and bacteria was assumed within each rectangular block pore volume.

FIGURE 4. (A, B) Concentrations of total Dehalococcoides and Dehalococcoides containing vcrA before (Day -16) and after the field demonstration (Day 201); (C) total Dehalococcoides as a percent of total biomass, before (Day -16) and after field demonstration (Day 201). It is noted that with the exception of the total Dehalococcoides result for B119.d, all the results for Day -16 were below the analysis quantitation limit. This was also the case for the analysis of vcrA for well M103 for Day -16. (Figures 2D and 4), suggesting that the indigenous bacteria in the aquifer were capable of dechlorinating cDCE and VC

to ethene. Pre-design microcosm studies indicated that the indigenous bacteria would not degrade cDCE without a 4-month lag period (see Figure S1 in SI); however, generation of VC and ethene in the field demonstration commenced at locations proximal to the injection wells (e.g., well M101) within 4 weeks of the start of lactate injection (Figure 2 and Table S2 in SI). These data indicate that detection of the Dehalococcoides vcrA gene is an effective predictor of ERD performance, and suggest that screening for this gene might, in some cases, serve as a more rapid and accurate predictor of ERD performance than microcosm testing. Results of molecular monitoring for the vcrA gene during the test indicated that treatment performance was correlated to growth and proliferation of Dehalococcoides containing this gene. The average number of this gene copies in PTA groundwater increased by a factor of approximately 104 during the test, from an average concentration of 4 × 103 gene copies L-1 prior to the test to an average concentration of 1 × 107 at the end of the test. Several lines of evidence suggest that this increase was due to growth of Dehalococcoides containing vcrA, including the following: (1) vcrA concentrations in groundwater increased by 2-3 orders of magnitude in a majority of PTA monitoring wells within the first 62 days, prior to bioaugmentation with KB-1; (2) After bioaugmentation, peak concentrations of Dehalococcoides containing vcrA exceeded those which could be achieved by bioaugmentation alone, absent growth. Approximately 2.7 × 1012 Dehalococcoides cells were injected into the PTA on Day 69. If all those cells were equally distributed in suspension throughout the approximate PTA pore volume (375-450 m3), without adhering to aquifer solids, the resulting concentration would be 6 × 106 to 7.2 × 106 cells L-1. Total Dehalococcoides concentrations in the PTA wells at Day 201 (Figure 4A), were about 1-2 orders of magnitude higher than this, again suggesting growth; (3) Although not measured in this study, the major fraction (>90%) of bacterial biomass in aquifers is adhered to aquifer solids, and not present in suspension (6, 37, 38, 39). It follows that the increase in numbers of Dehalococcoides and Dehalococcoides containing vcrA measured in groundwater samples underestimated the actual increase in the aquifer underestimated as the groundwater sample represented only a minor fraction of the total increase in Dehalococcoides cells and Dehalococcoides-vcrA that occurred in the PTA; and (4) vcrA counts increased concurrent with cDCE and VC dechlorination to ethene; and others have already established from laboratory tests that Dehalococcoides containing vcrA grow during respiratory conversion of cDCE and VC to ethene (16). The collective data indicate that ethene generation in this field demonstration was correlated to the presence and growth of Dehalococcoides containing vcrA, and that application of the vcrA gene as a biomarker served to confirm that bacteria required for effective ERD were present and growing within the ERD system. Not surprisingly, total Dehalococcoides concentrations (as indicated by 16S rRNA gene copy counts) increased several orders of magnitude during the field demonstration, and exceeded the vcrA counts by about 1 order of magnitude in all samples at the conclusion of the test (Figure 4). These data suggest that a significant fraction of the Dehalococcoides present at the site did not contain vcrA. The VC RDase gene bvcA, which was not monitored in this study, is present in KB-1, and has been detected at other chloroethene sites (23, 30). As such, it is probable that Dehalococcoides containing bvcA accounted for a portion of the difference between the total Dehalococcoides counts and the vcrA counts. It is also possible that this difference occurred, in part, due to the presence of Dehalococcoides strains that respire cDCE, but not VC. Dehalococcoides Strain 195, for example, contains tceA and respires cDCE, but is not capable of growth on VC (18, 19). Therefore, data from the application VOL. 42, NO. 24, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

9307

and monitoring for additional RDase biomarkers (e.g., for tceA and bvcA) in this field demonstration might have identified the participation of additional Dehalococcoides strains. Nevertheless, the data provided herein provide a strong indication that the vcrA was an effective biomarker both for predicting ERD performance and monitoring the microbiology of the ERD system. This project also provided further evidence of the effectiveness of ERD as a technology for in situ treatment of chlorothenes in groundwater. In this demonstration, the ERD system established strongly reducing conditions, stimulated ethene generation and growth of indigenous Dehalococcoides containing vcrA throughout the PTA within 116 days of system startup. The average molar fraction of ethene in the PTA increased from 3% to 55% during the 7-month test, a time frame equivalent to approximately three pore volume flushes of the treatment area. We suspect that back-diffusion of cDCE and VC from the overlying clay till may have masked the effectiveness of the overall treatment, and that the extent of treatment would have been greater if the diffusive influx into the PTA had not occurred. On the basis of pre-design treatability test results, the ERD system was bioaugmented on Day 69 to maximize the opportunity for rapid and complete dechlorination to ethene. Considering all the results from this study, it is evident that bioaugmentation was not required to achieve complete dechlorination to ethene due to the fact that indigenous Dehalococcoides with vcrA like gene were already present at the site. The vcrA gene sequence of indigenous bacteria at this site had a sequence nearly identical to that of the vcrA gene present in KB-1, and this confounded attempts to distinguish the impacts of bioaugmented from indigenous Dehalococcoides. Nevertheless, the quantification of vcrA gene was strongly correlated with system performance regardless of the source of this gene. The detection of an indigenous vcrA in Denmark in addition to VC Rdases originally found in the United States is of interest because it provides additional evidence that the vcrA gene is widely distributed geographically, and indicates promise for ERD remedies at numerous chlorinated solvent sites around the world without the use of bioaugmentation. In this study, molecular tests targeting vcrA genes provided insufficient resolution to distinguish indigenous Dehalococcoides from Dehalococcoides in KB-1. Similarly, Lee et al. (30) found that application of tceA, bcvA, and vcrA as biomarkers in another ERD pilot test were not able to reveal differences in the contributions of a bioaugmented Dehalococcoides culture (Bachman Road culture) and indigenous Dehalococcoides toward ERD performance. These results highlight a need for further research to determine the effectiveness of additional biomarkers for monitoring bioaugmentation cultures. Waller et al. (20) identified 14 different putative RDase genes in the KB-1 culture, and reported that multiple RDase genes contribute to chloroethene degradation by KB1. Similarly, Ho¨lscher et al. (17) identified at least 14 putative RDase genes in Dehalococcoides strain FL2. One or more of these putative RDase gene sequences, like vcrA, might serve as potential biomarkers for successfully differentiating bioaugmented from non-bioaugmented Dehalococcoides when monitoring ERD of chloroethenes.

Acknowledgments The project was funded by the Danish EPA and former Funen County. Any opinions and conclusions expressed in this publication are those of the authors and do not necessarily reflect the views of the funding agencies. We thank Laila Nielsen and Lars Nissen of COWI A/S for assistance with the field demonstration. Ximena Druar (SiREM) performed qPCR testing and vcrA sequence analysis. Use of vcrA gene primers (from Dehalococcoides strain VS) are subject to exclusive 9308

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 24, 2008

license agreement with Stanford University (U.S. Patent Application USSN 60/598459 [Spormann and McCarty]).

Supporting Information Available Additional text, figures, and tables summarizing the biotreatability study methods and results and aspects of the field site, along with a sequence distance matrix (output DNASTAR Lasergene) comparing the indigenous bacteria to the injected KB-1 culture.This material is available free of charge via the Internet at http://pubs.acs.org.

Literature Cited (1) Maymo-Gatell, X.; Chien, Y.; Gossett, J. M.; Zinder, S. H. Isolation of a bacterium that reductively dechlorinates tetrachloroethene to ethene. Science 1997, 276, 1568–1571. (2) Major, D. W.; Edwards, E.; McCarty, P. L.; Gossett, J. M.; Hendrickson, E.; Lo¨ffler, F. E.; Zinder, S. H.; Ellis, D. E.; Vidumsky, J.; Harkness, M.; Klecka, G.; Cox, E. Discussion of Environment vs. Bacteria or let’s play ’name that bacteria’. Ground Water Monit. Rem. 2003, 23, 32–48. (3) Hendrickson, E. R.; Payne, J. A.; Young, R. M.; Starr, M. G.; Perry, M. P.; Fahnestock, S.; Ellis, D. E.; Ebersole, R. C. Molecular analysis of Dehalococcoides 16S ribosomal DNA from chloroethene-contaminated sites throughout North America and Europe. Appl. Environ. Microbiol. 2002, 68, 485–495. (4) Fennell, D. E.; Carroll, A. B.; Gossett, J. M.; Zinder, S. H. Assessment of indigenous reductive dechlorinating potential at a TCE-contaminated site using microcosms, polymerase chain reaction analysis, and site data. Environ. Sci. Technol. 2001, 35, 1830–1839. (5) Lu, X.; Wilson, J. T.; Kampbell, D. H. Relationship between Dehalococcoides DNA in ground water and rates of reductive dechlorination at field scale. Water Res. 2006, 40, 3131–3140. (6) Lu, X.; Wilson, J. T.; Kampbell, D. H. Relationship between geochemical parameters and the occurrence of Dehalococcoides DNA in contaminated aquifers. Water Resour. Res. 2006, 42, W08427. (7) Lookman, R.; Paulus, D.; Marnette, E.; Pijls, C.; Ryngaert, A.; Diels, L.; Volkering, F. Ground water transfer initiates complete reductive dechlorination in a PCE-contaminated aquifer. Ground Water Monit. Rem. 2007, 27, 65–74. (8) Ellis, D. E.; Lutz, E. J.; Odom, J. M.; Buchanan, R. J.; Bartlett, C. L.; Lee, M. D.; Harkness, M. R.; Deweerd, K. A. Bioaugmentation for accelerated in situ anaerobic bioremediation. Environ. Sci. Technol. 2000, 34, 2254–2260. (9) Major, D. W.; McMaster, M. L.; Cox, E. E.; Edwards, E. A.; Dworatzek, S. M.; Hendrickson, E. R.; Starr, M. G.; Payne, J. A.; Buonamici, L. W. Field demonstration of successful bioaugmentation to achieve dechlorination of tetrachloroethene to ethene. Environ. Sci. Technol. 2002, 36, 5106–5116. (10) Lendvay, J. M.; Lo¨ffler, F. E.; Dollhopf, M.; Aiello, M. R.; Daniels, G.; Fathepure, B. Z.; Gebhard, M.; Heine, R.; Helton, R.; Shi, J.; Krajmalnik-Brown, R.; Major, C. L.; Barcelona, M. J.; Petrovksis, E.; Hickey, R.; Tiedje, J. M.; Adriaens, P. Bioreactive barriers: a comparison of bioaugmentation and biostimulation for chlorinated solvent remediation. Environ. Sci. Technol. 2003, 37, 1422–1431. (11) Rahm, B. G.; Chauhan, S.; Holmes, V. F.; Macbeth, T. W.; Sorensen, K. S.; Alvarez-Cohen, L. Molecular characterization of microbial populations at two sites with differing reductive dechlorination abilities. Biodegradation 2006, 17, 523–534. (12) Adrian, L.; Rahnenfu ¨hrer, J.; Gobom, J.; Ho¨lscher, T. Identification of a chlorobenzene reductive dehalogenase in Dehalococcoides sp. Strain CBDB1. Appl. Environ. Microbiol. 2007, 73, 7717–7724. (13) He, J. Z.; Ritalahti, K. M.; Yang, K. L.; Koenigsberg, S. S.; Lo¨ffler, F. E. Detoxification of vinyl chloride to ethene coupled to growth of an anaerobic bacterium. Nature 2003, 424, 62–65. (14) Duhamel, M.; Mo, K.; Edwards, E. A. Characterization of a highly enriched Dehalococcoides-containing culture that grows on vinyl chloride and trichloroethene. Appl. Environ. Microbiol. 2004, 70, 5538–5545. (15) Harkness, M. R.; Bracco, A. A.; Brennan, M. J.; Deweerd, K. A.; Spivack, J. L. Use of bioaugmentation to stimulate complete reductive dechlorination of trichloroethene in Dover soil columns. Environ. Sci. Technol. 1999, 3, 1100–1109.

(16) Mu ¨ ller, J. A.; Rosner, B. M.; von-Abendroth, G.; MeshulamSimon, G.; McCarty, P. L.; Spormann, A. M. Molecular identification of the catabolic vinyl chloride reductase from Dehalococcoides sp. strain VS and its environmental distribution. Appl. Environ. Microbiol. 2004, 70, 4880–4888. (17) Sung, Y.; Ritalahti, K. M.; Apkarian, R. P.; Lo¨ffler, F. E. Quantitative PCR confirms purity of Strain GT, a novel trichloroethene-to-ethene-respiring Dehalococcoides isolate. Appl. Environ. Microbiol. 2006, 72, 1980–1987. (18) Seshadri, R.; Adrian, L.; Fouts, D. E.; Eisen, J. A.; Phillippy, A. M.; Methe, B. A.; Ward, N. L.; Nelson, W. C.; Deboy, R. T.; Khouri, H. M.; Kolonay, J. F.; Dodson, R. J.; Daugherty, S. C.; Brinkac, L. M.; Sullivan, S. A.; Madupu, R.; Nelson, K. E.; Kang, K. H.; Impraim, M.; Tran, K.; Robinson, J. M.; Forberger, H. A.; Fraser, C. M.; Zinder, S. H.; Heidleberg, J. F. Genome sequence of PCE-dechlorinating bacterium Dehalococcoides ethenogenes. Science 2005, 307, 105–108. (19) Magnuson, J. K.; Romine, M. F.; Burris, D. R.; Kingsley, M. T. Trichloroethene reductive dehalogenase from Dehalococcoides ethenogenes: sequence of tceA and substrate range characterization. Appl. Environ. Microbiol. 2000, 66, 5141–5147. (20) Magnuson, J. K.; Stern, R. V.; Gossett, J. M.; Zinder, S. H.; Burris, D. R. Reductive dechlorination of tetrachloroethene to ethene by two-component enzyme pathway. Appl. Environ. Microbiol. 1998, 64, 1270–1275. (21) Kube, M.; Beck, A.; Zinder, S. H.; Kuhl, H.; Reinhart, R.; Adrian, L. Genome sequence of chlorinated compound-respiring bacterium Dehalococcoides species strain CBDB1. Nat. Biotechnol. 2005, 23, 1269–1273. (22) Ho¨lscher, T.; Krajmalnik-Brown, R.; Ritalahti, L. M.; von Wintzingerode, F.; Go¨risch, H.; Löffler, F. E.; Adrian, L. Multiple nonidentical reductive-dehalogenase-homologous genes are common in Dehalococcoides. Appl. Environ. Microbiol. 2004, 70, 5290–5297. (23) Waller, A. S.; Krajmalnik-Brown, R.; Lo¨ffler, F. E.; Edwards, E. A. Multiple reductive-dehalogenase-homologous genes are simultaneously transcribed during dechlorination by Dehalococcoides-containing cultures. Appl. Environ. Microbiol. 2005, 71, 8257–8264. (24) Krajmalnik-Brown, R.; Holscher, T.; Thomson, I. N.; Saunders, F. M.; Ritalahti, K. M.; Lo¨ffler, F. E. Genetic identification of a putative vinyl chloride reductase in Dehalococcoides sp strain BAV1. Appl. Environ. Microbiol. 2004, 70, 6347–6351. (25) Holmes, V. F.; He, J. Z.; Lee, P. K. H.; Alvarez-Cohen, L. Discrimination of multiple Dehalococcoides strains in a trichloroethene enrichment by quantification of their reductive dehalogenase genes. Appl. Environ. Microbiol. 2006, 72, 5877–5883. (26) Ritalahti, K. M.; Amos, B. K.; Sung, Y.; Wu, Q.; Koenigsberg, S. S.; Lo¨ffler, F. E. Quantitative PCR targeting 16S rRNA and reductive dehalogenase genes simultaneously monitors multiple Dehalococcoides strains. Appl. Environ. Microbiol. 2006, 72, 2765–2774.

(27) The Risk Assessment Information System. Toxicity Summary for vinyl chloride; http://rais.ornl.gov/tox/profiles/vinylc. shtml; accessed July 2008. (28) Cupples, A. M.; Spormann, A. M.; McCarty, P. L. Vinyl chloride and cis-dichloroethene dechlorination kinetics and microorganism growth under substrate limiting conditions. Environ. Sci. Technol. 2004, 38, 1102–1107. (29) U.S. Air Force Center of Environmental Excellence (AFCEE). Principles and Practices of Enhanced Bioremediation of Chlorinated Solvents; Brooks City, TX, 2004. (30) Lee, P. K. H.; Macbeth, T. W.; Sorensen, K. S.; Deeb, R. A.; AlvarezCohen, L. Quantifying genes and transcripts to assess the in situ physiology of “Dehalococcoides” spp. in a trichloroethenecontaminated groundwater site. Appl. Environ. Microbiol. 2008, 74, 2728–2739. (31) Jørgensen, T. H.; Nissen, L.; Nielsen, L.; Weeth, E. B.; Scheutz, C.; Broholm, M. M.; Bjerg, P. L.; Durant, N. D.; Cox, E.; Christophersen, M.; Rasmussen, P. Oprensning af klorerede opløsningsmidler i moræneler med stimuleret reduktiv deklorering - pilotforsøg. Hovedrapport - Lok. nr. 461-169. Rugårdsvej 234-238, 5210 Odense NV, COWI, DTU, Geosyntec, Region Syddanmark; 2007; pp 1-136 (in Danish); available at http://www.env.dtu.dk/publications/fulltext/2007/MR2007251.pdf.; accessed July 2008. (32) Duhamel, M.; Edwards, E. A. Microbial composition of chlorinated ethene-degrading cultures dominated by Dehalococcoides. FEMS Microbiol. Ecol. 2006, 58, 538–549. (33) Yang, Y.; McCarty, P. L. Competition for hydrogen within a chlorinated solvent dehalogenating anaerobic mixed culture. Environ. Sci. Technol. 1998, 30, 3591–3597. (34) Mazur, C. S.; Jones, W. J. Hydrogen concentrations in sulfatereducing estuarine sediments during PCE dehalogenation. Environ. Sci. Technol. 2001, 35, 4783–4788. (35) Paul, E. A.; Clark F. E. Soil Microbiology and Biochemistry; Academic Press, Inc.: New York, 1996. (36) Dennis, P.; Druar, X. Monitoring Chlorinated Solvent Bioremediation Using Quantitative PCR, Relevance of Specific Genes and Interpretation of Results Platform. Presented at The 2nd International Conference on “Challenges in Site Remediation: Proper Characterization, Effective Technology Screening and Testing and Performance Monitoring (CSR-2), Niagara Falls, NY,September 23-27, 2007. (37) Harvey, R. W.; Smith, R. L.; George, L. Effect of organic contamination upon microbial distributions and heterotrophic uptake in a Cape Cod, Mass., Aquifer. Appl. Environ. Microbiol 1984, 48, 1197–1202. (38) Holm, P. E.; Nielsen, P. H.; Albrechtsen, H.-J.; Christensen, T. H. Importance of unattached bacteria and bacteria attached to sediment in determining potentials for degradation of xenobiotic organic contaminants in an aerobic aquifer. Appl. Environ. Microbiol. 1992, 58, 3020–3206. (39) Lehman, R. M.; Colwell, F. S.; Bala, G. A. Attached and unattached microbial communities in a simulated basalt aquifer under fracture- and porous-flow conditions. Appl. Environ. Microbiol. 2001, 67, 2799–2809.

ES800764T

VOL. 42, NO. 24, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

9309