Construction and Rescue of a Functional Synthetic Baculovirus - ACS

Apr 6, 2017 - *E-mail: [email protected]. Tel/Fax: +86-27-87198465., *E-mail: [email protected]. Tel/Fax: +86-27-87197180. Cite this:ACS Synth. Biol. 6, 7, 13...
0 downloads 0 Views 5MB Size
Download PDF
Research Article pubs.acs.org/synthbio

Construction and Rescue of a Functional Synthetic Baculovirus Yu Shang,†,‡ Manli Wang,† Gengfu Xiao,† Xi Wang,†,‡ Dianhai Hou,† Kai Pan,†,‡ Shurui Liu,†,‡ Jiang Li,† Jun Wang,† Basil M. Arif,§ Just M. Vlak,∥ Xinwen Chen,† Hualin Wang,† Fei Deng,*,† and Zhihong Hu*,† †

State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, PR China University of Chinese Academy of Sciences, Beijing 100049, PR China § Laboratory for Molecular Virology, Great Lakes Forestry Centre, Sault Sainte Marie, Ontario P6A 2E5, Canada ∥ Laboratory of Virology, Wageningen University, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands ‡

S Supporting Information *

ABSTRACT: Synthetic viruses provide a powerful platform to delve deeper into the nature and function of viruses as well as to engineer viruses with novel properties. So far, most synthetic viruses have been RNA viruses ( 0.05). To compare the morphology of the synthetic baculovirus with its parental virus, OBs purified from Spodoptera exigua larvae infected with either AcMNPV-WIV-Syn1 or AcMNPVWT were processed for scanning electron microscopy (SEM) and transmission electron microscopy (TEM). SEM showed that the OBs of both viruses had similar polyhedral shapes and sizes, and both had a smooth surface (Figure 4a and 4b). TEM results showed that the OBs of both viruses were normal in size and structure, and contained a comparable numbers of occlusion-derived virions (Figure 4c and 4d). From all apparent morphological parameters such as shape, size and occlusion-

Figure 4. Electron micrographs of OBs of AcMNPV-WIV-Syn1 and AcMNPV-WT. (a and b) Scanning electron micrographs of OBs of AcMNPV-WIV-Syn1 and AcMNPV-WT, respectively. (c and d) Transmission electron micrograph of OBs of AcMNPV-WIV-Syn1 and AcMNPV-WT, respectively. Scale bars are presented.

derived virus, the synthetic virus produced OBs were indistinguishable from those produced by AcMNPV-WT. Oral infectivity of AcMNPV-WIV-Syn1 and AcMNPV-WT were assayed in fourth instar S. exigua larvae by the droplet feeding method (Methods). The bioassay results showed that there was no significant difference between two replicates of both viruses (data not shown). The data of two replicates were compiled together to calculate the median lethal concentration (LC50). The LC50 for AcMNPV-WIV-Syn1 and AcMNPV-WT were 3.7 × 105 OBs/mL and 6.2 × 105 OBs/mL, respectively (Table 2). Potency ratio test was performed by dividing the LC50 of the AcMNPV-WIV-Syn1 by that of AcMNPV-WT, and the 95% confidence interval of potency ratio included 1.0 F

DOI: 10.1021/acssynbio.7b00028 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology Table 2. Oral Infectivity in 4th Instar S. exigua

a

virus

LC50 (95% CL) (105 × OBs/mL)

slope (95% CL)

χ2/d.f.

potency ratioa (95% CL)

AcMNPV-WIV-Syn1 AcMNPV-WT

3.7(0.85−8.0) 6.2(0.02−19.2)

0.637(0.376−0.899) 0.786(0.516−1.055)

0.529 2.022

0.820 (0.364−1.781)

Potency ratio was calculated by dividing the LC50 value of the AcMNPV-WIV-Syn1 by that of AcMNPV-WT.

Figure 5. Constructing pGF-egfp and AcMNPV-WIV-Syn1. (a) The flow diagram of construction of plasmid pGF-egf p from plasmid pGF. The vector pGF was amplified and two ends were added by PCR with primers pGF-egf p-F and pGF-egf p-R. The egfp fragment with an hsp70 promoter (phsp70) and a SV40 polyA signal (pA) and the linearized vector were used to cotransform yeast cells to generate plasmid pGF-egfp. The plasmid was further amplified in E. coli. (b) The representative construction procedures of the intermediates B1 and C1, as well as the whole genome of AcMNPV-WIV-Syn1. For B1 and C1 assembly, the plasmid pGF was linearized and two ends were added by PCR with indicated primers. After cotransformed into yeast with input fragments, pGF-B1 and pGF-C1 were generated by TAR. After amplification in E. coli, the plasmids were digested by Bsu36I to generate B1 or C1 fragments. For whole genome assembly, the process was similar to that of B1 and C1, except a different vector pGF-egf p was used. After amplification of AcMNPV-WIV-Syn1 DNA in E. coli, it was extracted and used to transfect Sf9 insect cells to generate progeny baculoviruses.

studies of AcMNPV-WIV-Syn1 pathogenesis in vivo and in cell culture, in combination with multiple alterations in the baculovirus genome. The synthetic baculovirus technology provides a powerful tool to further our understanding of the basic biology of this virus (AcMNPV) and of other baculoviruses, which may not have a susceptible cell culture system. The technology can also be used to determine the minimal requirements of a baculovirus to replicate in cell culture (mini-baculovirus), as well enhance the expression of foreign genes qualitatively by adding pathways of protein modification. This proof of concept offers a major step forward in the field of gene manipulation not only for baculoviruses, but

indicating that there was no significant biological difference between the two viruses.36

■

CONCLUSION In the present investigations, we reconstructed the AcMNPV genome by a combination of PCR and TAR in yeast and rescued its biological activity by transfecting insect cells. Critical tests were performed to assess the biological properties of the synthetic baculovirus. Parameters such as one-step growth curves, TEM and SEM analyses revealed that the synthetic virus was indistinguishable from its parental virus (Figures 2, 3 and 4). The presence of egf p in the synthetic virus allows further G

DOI: 10.1021/acssynbio.7b00028 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology Table 3. Primers Used for Amplification of Vector pGF or pGF-egfp name

sequencea

primer siteb

pGF-F-A5 pGF-R-A1 pGF-F-A10 pGF-R-A6 pGF-F-A16 pGF-R-A11 pGF-F-A21 pGF-R-A17 pGF-F-A27 pGF-R-A22 pGF-F-A32 pGF-R-A28 pGF-F-A37 pGF-R-A33 pGF-F-A41

5′-TTGTTAACAAATCTAACGAAAAGCATGTAACGTTTGACGGCCTTAGGCTAGAGTCGACCTGCAGGCATG-3′ 5′-GAATCTGTTCATTGAGACGAGTATTTTCTTCTATCAGCTGTCGCCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-GGAAATCAATTGCCGTTGAAGGGAAATAATTCGTGGTGTGCCTTAGGCTAGAGTCGACCTGCAGGCATG-3′ 5′-TGCTACAAAAGGTAGCCTGAATATAAGCGCTATCAAAGCCATCTCCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-AGAAGCGTCGACGAGGCTGGCGAACACAACATGAGCGTTTCCTTAGGCTAGAGTCGACCTGCAGGCATG-3′ 5′-GTGCAGGAAGCAATAAATGATTTTAAACGACTTAATATAACACCGGGCCACTCCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-AAGCAAGAAGAGCGTTTGAAGATGCAGTCGCTGTACGCAACGCCTTAGGCTAGAGTCGACCTGCAGGCATG-3′ 5′-TGATCGTTGCGCAACAAGTGCCGATAATACAATTTCGCGTGCCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-TTAAGCGGATACAACGGGCAGTCCGAGCTGTTAAAGTCAATACAACCCCTTAGGCTAGAGTCGACCTGCAGGCATG-3′ 5′-CATGAAAAACAAACGGCTTTAAACGAAGGACAATGACCATCAATCGTATACACCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-TATATACCTCAAAATATTTCACATTTTTGCATCATCGTAAAATATACATGCCTTAGGCTAGAGTCGACCTGCAGGCATG-3′ 5′-TGAGACCGTTCAATGGCCCATTGAGTGTGTTAAACGACTTATTCCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-CCGGCGGATTGGTGCACGGCATCAGCAAAAACGTGTCGTCCCTTAGGCTAGAGTCGACCTGCAGGCATG-3′ 5′-CTTAAATATTGTAAAAAATATTACACGTTGTTTCATTGACGTCACAAAATTTCCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-TTCAAAGTAATACATGAATTTAGAGTATTCAGGAAAATGATAAACGTTGGCCTTAGGCTAGAGTCGACCTGCAGGCATG3′ 5′-TAATTGCTACAACAACAGCATCTACAAAGAAGGGCGTTGGCCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-TTTATGCCGGAACTTCTGCTGCTAGTTCATGTGATGTAAATGTTCCTTAGGCTAGAGTCGACCTGCAGGCATG-3′ 5′-GCCGTCGATTTAACTAATGCCAGTAGGTATGCCATACATATGCCCTTAGGCGGGTACCGAGCTCGAATTC-3′ 5′-CTTATCATGTCTGGATCTGATCACTGCTTGAGCCTAGGAGGAATTCGAGCTCGGTACCCGGGATC-3′ 5′-AAGAGAGAATAACGAATAACGGCCAGAGAAATTTCTCGAGTGCCCTATAGTGAGTCGTATTACAATTCACTG-3′

13965−14004 133269−133311 28962−29901 13903−13946 45693−45732 28880−28931 60765−60806 45570−45610 78130−78176 60652−60703 93496−93545 77968−78010 108659−108698 93744−93795 121372−121421

pGF-R-A38 pGF-F-A45 pGF-R-A42 pGF-egfp-F pGF-egfp-R

108609−108648 133489−133532 121086−121128 − −

a

Each of pGF-F and pGF-R primers contains 3 parts, sequences identical or complementary to that of AcMNPV were shown in italics, the Bsu36I site were in bold and underlined, and the rest unmarked were sequences identical or complementary to that of the vector pGF; pGF-egf p-F and pGFegfp-R contains 2 parts, sequences identical or complementary to that of egfp gene were shown in italics, and the rest unmarked were sequences identical or complementary to that of the vector pGF. bThe locus of the primer (shaded sequence) in AcMNPV-WT genome.

egf p region of BamHI site and its upstream sequence (Table 3). PCR was carried out by using KOD DNA polymerase kit (Toyobo). In the meantime, a linear fragment of egf p with a phsp70 and SV40 pA signal was prepared by overlapping PCR. The egf p fragment and PCR-generated linearized vector were used to cotransform the protoplast of S. cerevisiae strain VL6− 48N as described.25 The assembled DNA was extracted from yeast cells and used to transform E. coli EPI300 for further amplification. The correctness of the resulting plasmid pGFegf p was confirmed by Sanger sequencing. Synthesis of the AcMNPV-WIV-Syn1 genome was based on TAR in S. cerevisiae in 4 steps as outlined in Figure 1. The detailed representative process of TAR is summarized in Figure 5 b. First, the entire AcMNPV-WT genome was amplified into 45 overlapping fragments (A1-A45) with a set of primers listed in Table 1. In step 2, as indicated in Figure 5 b, the vector pGF was linearized with BamHI, and two linker sequences were added to each end of the vector by PCR using two long primers pGF-F-A5 and pGF-R-A1. Primer pGF-F-A5 contained the last 40 nts of A5 followed by a Bsu36I site and 22 nts of pGF downstream of the BamHI site, while primer pGF-R-A1 contained 43 nts complementary to the first 43 nt of A1, followed by a Bsu36I site and 20 nts complementary to the pGF sequence upstream of the BamHI site (Table 3). The A1 to A5 fragments and the linearized pGF sequence were used to cotransform the protoplast of S. cerevisiae strain VL6−48N. The sets of fragments plus the vector were joined together through the short overlaps between the fragments via TAR in yeast. The assembled DNA was extracted from yeast cell and used to transform E. coli EPI300 for further amplification. Amplified DNA extracted from E. coli was digested with Bsu36I to generate B1 fragment for the next step assembly. Intermediate fragments B2−B9 were generated with similar methods. In step 3, intermediate C1 was generated with a procedure similar to that of B1, except that the primers used for amplifying vector

also for other large double stranded DNA viruses such as herpesviruses, poxviruses and possibly megaviruses.

■

METHODS Cells and Viruses. S. cerevisiae strain VL6−48N (MAT alpha, his3-Δ200, trp1-Δ1, ura3-Δ1, lys2, ade2−101, met14), E. coli strain EPI300 carrying an inducible trfA gene, and TAR cloning vector pGF were obtained from the Laboratory of Virus Biochemistry of the Wuhan Institute of Virology, China Academy of Science.25 AcMNPV-WT, obtained from the Microorganisms & Viruses Culture Collection Center, Wuhan Institute of Virology, Chinese Academy of Sciences (storage no. IVCAS1.0315), was used as parental virus for the synthesis of AcMNPV-WIV-Syn1. AcBac-egfp-ph, a recombinant AcMNPV previously constructed by traditional Bac-to-Bac system35 was used as a positive control for the bioactivity in cell culture. The Sf9 insect cell line, originally generated from the fall armyworm S. frugiperda37 was maintained at 27 °C in Grace’s medium supplemented with 10% fetal bovine serum (Gibco). Synthesis and Construction of the AcMNPV-WIV-Syn1 Genome. Two TAR cloning vectors were used for reconstructing the synthetic baculovirus genome. Previously, a TAR cloning vector pGF was constructed and showed to be able to assemble ∼30 kb DNA in yeast.25 To facilitate detection of the rescued synthetic virus in insect cells, a modified vector pGF-egf p was derived from pGF where the LacZ gene of pGF was replaced with egfp gene. This was conducted by TAR in yeast as outlined in Figure 5a. First, the vector pGF was amplified and two ends were added by PCR with primers pGFegfp-F and pGF-egf p-R. Primer pGF-egfp-F contained the last 40 nucleotide (nt) sequence of SV40 polyA (pA) signal followed by 25 nts of the pGF-egfp region including BamHI and its downstream sequence, while pGF-egf p-R contained the first 40 nts complementary to that of the hsp70 promoter (phsp70) and followed by 32 nts complementary to the pGFH

DOI: 10.1021/acssynbio.7b00028 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology was pGF-F-A16 and pGF-R-A1, and the input fragments for assembly were B1, B2 and B3 (Figure 5b). Similarly, C2 and C3 were generated in step 3. In step 4, pGF-egpf vector was linearized with BamHI and amplified with primers pGF-F-A32 and pGF-egfp-R-A33 (Table 3). Similar to step 2 and step 3, the entire genome with the pGF-egf p vector was assembled with C1, C2 and C3 to generate the synthetic genome AcMNPV-WIV-Syn1, which had a total length of 145 299 bp. Quality control was performed throughout the process. All PCR (A1-A45) products of step 1 were confirmed by Sanger sequencing. The plasmids produced in step 2 (pGF-B1 ∼ B9) and step 3 (pGF-C1 ∼ C3) were identified by PCR to ensure they contained all the input fragments. Finally, PCR, restriction enzyme analysis and 454 sequencing were carried out on the synthetic genome AcMNPV-WIV-Syn1 to ensure that the synthetic genome was correct. Transfection and Infection Assays. AcMNPV-WIV-Syn1 DNA was isolated from E. coli by methods developed for large plasmids (the Instruction Manual of Bac-to-Bac System/Life Technologies). Sf9 insect cells were transfected with 5 μg of AcMNPV-WIV-Syn1 DNA or AcBac-egf p-ph DNA35 by the use of Cellfectin (Invitrogen). The cells were observed in a fluorescence microscope at different times post transfection and images were taken at 24 and 72 hpt. Supernatant fluids from the transfections were collected at 120 hpt and used to infect Sf9 cells. One-Step Growth Curve. Sf9 cells were infected with either AcMNPV-WIV-Syn1 or AcMNPV-WT at a multiplicity of infection (MOI) of 5. Supernatant fluids were collected at 0, 12, 24, 48, and 72 hpi and progeny virus was titrated by EPDA. Each experiment was carried out in triplicates. Student t test was taken for significant difference analysis between the titers of the two viruses at each time point using the computer program SPSS v16.38 Bioassays. After one round of replication in S. exigua larvae, OBs of AcMNPV-WIV-Syn1 and AcMNPV-WT were purified and inoculated into fourth instar S. exigua larvae with 3 × 107, 1 × 107, 3 × 106, 1 × 105 and 3 × 105 OBs/mL using the droplet feeding method,39 with 24 larvae for each dilution. Larvae were checked daily for mortality and the assays were performed in duplicate. LC50 values were calculated and compared with a standard lethal concentration ratio comparison using the computer program SPSS v16.38 Electron Microscopy. Purified OBs of AcMNPV-WIVSyn1 and AcMNPV-WT were used for electron microscopy. For SEM, the OBs suspension (5 × 108 OBs/mL) was dripped onto silver paper and left to dry at 37 °C for 10 h. The samples were then sputter-coated with gold and observed with a scanning electron microscope SU8010 (Hitachi, Tokyo, Japan) at an acceleration voltage of 10 kV. For TEM, OBs were fixed with 5% glutaraldehyde overnight, with 2% sucrose (pH 7.3) for 4 h, and treated with 1% osmic acid for 1 h, followed by dehydration in a graded series of ethanol, embedded in 618 epoxy resin and manufacture of ultrathin sections. Ultrathin sections were observed with a FEI Tecnai G2 20 TWIN electron microscope at an accelerating voltage of 200 kV.

■

■

The genome differences between AcMNPV-WT and AcMNPV-E2 (PDF)

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Tel/Fax: +86-27-87198465. *E-mail: [email protected]. Tel/Fax: +86-27-87197180. ORCID

Zhihong Hu: 0000-0002-1560-0928 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the Strategic Priority Research Program of the Chinese Academy of Sciences (CAS) (Grant No. XDB11030400), grants from the National Natural Science Foundation of China (No. 31621061 and 31130058) and CAS (QYZDJ-SSW-SMC021 and KSCX2-EW-Z-3). The Virology Key Frontier Science Program of the State Key Laboratory of Virology, Wuhan Institute of Virology (Grant No. klv-2016-03) and the National Basic Research Program of China program (973 program, No. 2012CB721102). The authors thank Dr. Xiulian Sun for help with statistical analysis, Ms. Lei Zhang for 454 sequencing, and Ms. Bi-Chao Xu of the Core Facility and Technical Support, Wuhan Institute of Virology for her technical supports with TEM and SEM.

■

REFERENCES

(1) Cello, J., Paul, A. V., and Wimmer, E. (2002) Chemical synthesis of poliovirus cDNA: generation of infectious virus in the absence of natural template. Science 297, 1016−1018. (2) Smith, H. O., Hutchison, C. A. I., Pfannkoch, C., and Venter, J. C. (2003) Generating a synthetic genome by whole genome assembly: phiX174 bacteriophage from synthetic oligonucleotides. Proc. Natl. Acad. Sci. U. S. A. 100, 15440−15445. (3) Tumpey, T. M., Basler, C. F., Aguilar, P. V., Zeng, H., Solorzano, A., Swayne, D. E., Cox, N. J., Katz, J. M., Taubenberger, J. K., Palese, P., and Garcia-Sastre, A. (2005) Characterization of the reconstructed 1918 Spanish influenza pandemic virus. Science 310, 77−80. (4) Lee, Y. N., and Bieniasz, P. D. (2007) Reconstitution of an infectious human endogenous retrovirus. PLoS Pathog. 3, e10. (5) Takehisa, J., Kraus, M. H., Decker, J. M., Li, Y., Keele, B. F., Bibollet-Ruche, F., Zammit, K. P., Weng, Z., Santiago, M. L., Kamenya, S., Wilson, M. L., Pusey, A. E., Bailes, E., Sharp, P. M., Shaw, G. M., and Hahn, B. H. (2007) Generation of infectious molecular clones of simian immunodeficiency virus from fecal consensus sequences of wild chimpanzees. J. Virol. 81, 7463−7475. (6) Becker, M. M., Graham, R. L., Donaldson, E. F., Rockx, B., Sims, A. C., Sheahan, T., Pickles, R. J., Corti, D., Johnston, R. E., Baric, R. S., and Denison, M. R. (2008) Synthetic recombinant bat SARS-like coronavirus is infectious in cultured cells and in mice. Proc. Natl. Acad. Sci. U. S. A. 105, 19944−19949. (7) Nauwelaers, D., Van Houtte, M., Winters, B., Steegen, K., Van Baelen, K., Chi, E., Zhou, M., Steiner, D., Bonesteel, R., Aston, C., and Stuyver, L. J. (2011) A synthetic HIV-1 subtype C backbone generates comparable PR and RT resistance profiles to a subtype B backbone in a recombinant virus assay. PLoS One 6, e19643. (8) Yang, R., Han, Y., Ye, Y., Liu, Y., Jiang, Z., Gui, Y., and Cai, Z. (2011) Chemical synthesis of bacteriophage G4. PLoS One 6, e27062. (9) Munshaw, S., Bailey, J. R., Liu, L., Osburn, W. O., Burke, K. P., Cox, A. L., and Ray, S. C. (2012) Computational reconstruction of Bole1a, a representative synthetic hepatitis C virus subtype 1a genome. J. Virol. 86, 5915−5921. (10) Liu, Y., Han, Y., Huang, W., Duan, Y., Mou, L., Jiang, Z., Fa, P., Xie, J., Diao, R., Chen, Y., Ye, Y., Yang, R., Chen, J., Sun, X., Li, Z.,

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.7b00028. I

DOI: 10.1021/acssynbio.7b00028 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology Tang, A., Gui, Y., and Cai, Z. (2012) Whole-genome synthesis and characterization of viable S13-like bacteriophages. PLoS One 7, e41124. (11) Scholte, F. E., Tas, A., Martina, B. E., Cordioli, P., Narayanan, K., Makino, S., Snijder, E. J., and van Hemert, M. J. (2013) Characterization of synthetic Chikungunya viruses based on the consensus sequence of recent E1−226V isolates. PLoS One 8, e71047. (12) Cooper, B. (2014) Proof by synthesis of Tobacco mosaic virus. Genome Biol. 15, R67. (13) Lovato, A., Faoro, F., Gambino, G., Maffi, D., Bracale, M., Polverari, A., and Santi, L. (2014) Construction of a synthetic infectious cDNA clone of Grapevine Algerian latent virus (GALV-Nf) and its biological activity in Nicotiana benthamiana and grapevine plants. Virol. J. 11, 186. (14) Ni, Y. Y., Zhao, Z., Opriessnig, T., Subramaniam, S., Zhou, L., Cao, D., Cao, Q., Yang, H., and Meng, X. J. (2014) Computer-aided codon-pairs deoptimization of the major envelope GP5 gene attenuates porcine reproductive and respiratory syndrome virus. Virology 450−451, 132−139. (15) Vu, H. L., Ma, F., Laegreid, W. W., Pattnaik, A. K., Steffen, D., Doster, A. R., and Osorio, F. A. (2015) A synthetic porcine reproductive and respiratory syndrome virus strain confers unprecedented levels of heterologous protection. J. Virol. 89, 12070−12083. (16) Wimmer, E., Mueller, S., Tumpey, T. M., and Taubenberger, J. K. (2009) Synthetic viruses: a new opportunity to understand and prevent viral disease. Nat. Biotechnol. 27, 1163−1172. (17) Wimmer, E., and Paul, A. V. (2011) Synthetic poliovirus and other designer viruses: what have we learned from them? Annu. Rev. Microbiol. 65, 583−609. (18) Sanders, B. P., Edo-Matas, D., Papic, N., Schuitemaker, H., and Custers, J. H. (2015) Synthetic virus seeds for improved vaccine safety: Genetic reconstruction of poliovirus seeds for a PER.C6 cell based inactivated poliovirus vaccine. Vaccine 33, 5498−5502. (19) Dormitzer, P. R., Suphaphiphat, P., Gibson, D. G., Wentworth, D. E., Stockwell, T. B., Algire, M. A., Alperovich, N., Barro, M., Brown, D. M., Craig, S., Dattilo, B. M., Denisova, E. A., De Souza, I., Eickmann, M., Dugan, V. G., Ferrari, A., Gomila, R. C., Han, L., Judge, C., Mane, S., Matrosovich, M., Merryman, C., Palladino, G., Palmer, G. A., Spencer, T., Strecker, T., Trusheim, H., Uhlendorff, J., Wen, Y., Yee, A. C., Zaveri, J., Zhou, B., Becker, S., Donabedian, A., Mason, P. W., Glass, J. I., Rappuoli, R., and Venter, J. C. (2013) Synthetic generation of influenza vaccine viruses for rapid response to pandemics. Sci. Transl. Med. 5, 185ra168. (20) Pleguezuelos, O., Robinson, S., Fernandez, A., Stoloff, G. A., Mann, A., Gilbert, A., Balaratnam, G., Wilkinson, T., LambkinWilliams, R., Oxford, J., and Caparros-Wanderley, W. (2015) A synthetic influenza virus vaccine induces a cellular immune response that correlates with reduction in symptomatology and virus shedding in a randomized phase Ib live-virus challenge in humans. Clin. Vaccine Immunol. 22, 828−835. (21) Rosario, K., Dayaram, A., Marinov, M., Ware, J., Kraberger, S., Stainton, D., Breitbart, M., and Varsani, A. (2012) Diverse circular ssDNA viruses discovered in dragonflies (Odonata: Epiprocta). J. Gen. Virol. 93, 2668−2681. (22) Philippe, N., Legendre, M., Doutre, G., Coute, Y., Poirot, O., Lescot, M., Arslan, D., Seltzer, V., Bertaux, L., Bruley, C., Garin, J., Claverie, J. M., and Abergel, C. (2013) Pandoraviruses: amoeba viruses with genomes up to 2.5 Mb reaching that of parasitic eukaryotes. Science 341, 281−286. (23) Gibson, D. G., Glass, J. I., Lartigue, C., Noskov, V. N., Chuang, R. Y., Algire, M. A., Benders, G. A., Montague, M. G., Ma, L., Moodie, M. M., Merryman, C., Vashee, S., Krishnakumar, R., Assad-Garcia, N., Andrews-Pfannkoch, C., Denisova, E. A., Young, L., Qi, Z. Q., SegallShapiro, T. H., Calvey, C. H., Parmar, P. P., Hutchison, C. A., Smith, H. O., 3rd, and Venter, J. C. (2010) Creation of a bacterial cell controlled by a chemically synthesized genome. Science 329, 52−56. (24) Chan, L. Y., Kosuri, S., and Endy, D. (2005) Refactoring bacteriophage T7. Mol. Syst. Biol. 1, 0018.

(25) Hou, Z., Zhou, Z., Wang, Z., and Xiao, G. (2016) Assembly of long DNA sequences using a new synthetic Escherichia coli-yeast shuttle vector. Virol. Sin. 31, 160−167. (26) Sun, X. (2015) History and current status of development and use of viral insecticides in China. Viruses 7, 306−319. (27) Haase, S., Sciocco-Cap, A., and Romanowski, V. (2015) Baculovirus insecticides in Latin America: historical overview, current status and future perspectives. Viruses 7, 2230−2267. (28) van Oers, M. M., Pijlman, G. P., and Vlak, J. M. (2015) Thirty years of baculovirus-insect cell protein expression: from dark horse to mainstream technology. J. Gen. Virol. 96, 6−23. (29) Kaba, S. A., Salcedo, A. M., Wafula, P. O., Vlak, J. M., and van Oers, M. M. (2004) Development of a Chitinase and v-cathepsin negative bacmid for improved integrity of secreted recombinant proteins. J. Virol. Methods 122, 113−118. (30) Kouprina, N., and Larionov, V. (2006) TAR cloning: insights into gene function, long-range haplotypes and genome structure and evolution. Nat. Rev. Genet. 7, 805−812. (31) Maghodia, A. B., Jarvis, D. L., and Geisler, C. (2014) Complete Genome Sequence of the Autographa californica Multiple Nucleopolyhedrovirus Strain E2. Genome Announc. 2, e01202−14. (32) Zhu, Z., Yin, F., Liu, X., Hou, D., Wang, J., Zhang, L., Arif, B., Wang, H., Deng, F., and Hu, Z. (2014) Genome sequence and analysis of Buzura suppressaria nucleopolyhedrovirus: a group II Alphabaculovirus. PLoS One 9, e86450. (33) Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M., and Possee, R. D. (1994) The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586−605. (34) Carstens, E. B., and Wu, Y. (2007) No single homologous repeat region is essential for DNA replication of the baculovirus Autographa californica multiple nucleopolyhedrovirus. J. Gen. Virol. 88, 114−122. (35) Luckow, V. A., Lee, S. C., Barry, G. F., and Olins, P. O. (1993) Efficient generation of infectious recombinant baculoviruses by sitespecific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J. Virol. 67, 4566−4579. (36) Robertson, J. L., Savin, N. E., Preisler, H. K., and Russell, R. M. (2007) Bioassays with Arthropods, 2nd ed., CRC Press, Boca Raton, FL. (37) Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., and McCawley, P. (1977) The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro 13, 213− 217. (38) SPSS, Inc. (2007) SPSS 16.0 Base User’s Guide, SPSS Inc, Chicago. (39) Hughes, P. R., and Wood, H. A. (1981) A synchronous peroral technique for the bioassay of insect viruses. J. Invertebr. Pathol. 37, 154−159.

J

DOI: 10.1021/acssynbio.7b00028 ACS Synth. Biol. XXXX, XXX, XXX−XXX