Controllable Mismatched Ligation for Bioluminescence Screening of

Jan 12, 2016 - The mismatches locating on the 3′-side of the nick cannot be ligated efficiently by E. coli ligase, whereas all mismatches locating o...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/ac

Controllable Mismatched Ligation for Bioluminescence Screening of Known and Unknown Mutations Qinfeng Xu,‡,† Si-qiang Huang,‡,† Fei Ma,§,† Bo Tang,*,§ and Chun-yang Zhang*,§,‡ §

College of Chemistry, Chemical Engineering and Materials Science, Collaborative Innovation Center of Functionalized Probes for Chemical Imaging in Universities of Shandong, Key Laboratory of Molecular and Nano Probes, Ministry of Education, Shandong Provincial Key Laboratory of Clean Production of Fine Chemicals, Shandong Normal University, Jinan, Shandong 250014, China ‡ Single-Molecule Detection and Imaging Laboratory, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen, Guangdong 518055, China S Supporting Information *

ABSTRACT: Single-nucleotide polymorphisms (SNPs) are closely related to human diseases and individual drug responses, and the accurate detection of SNPs is crucial to both clinical diagnosis and development of personalized medicine. Among various SNPs detection methods, ligase detection reaction (LDR) has shown great potential due to its low detection limit and excellent specificity. However, frequent involvement of expensive labels increases the experimental cost and compromises the assay efficiency, and the requirement of careful predesigned probes limits it to only known SNPs assays. In this research, we develop a controllable mismatched ligation for bioluminescence screening of both known and unknown mutations. Especially, the ligation specificity of E. coli ligase is tunable under different experimental conditions. The mismatches locating on the 3′-side of the nick cannot be ligated efficiently by E. coli ligase, whereas all mismatches locating on the 5′-side of the nick can be ligated efficiently by E. coli ligase. We design a 3′-discriminating probe (3′-probe) for the discrimination of known mutation and introduce a T7 Endo I for the detection of unknown mutation. With the integration of bioluminescence monitoring of ligation byproduct adenosine 5'-monophosphate (AMP), both known and unknown SNPs can be easily detected without the involvement of any expensive labels and labor-intensive separation. This method is simple, homogeneous, label-free, and cost-effective and may provide a valuable complement to current sequencing technologies for disease diagnostics, personalized medicine, and biomedical research.

S

single-strand conformation polymorphism (SSCP),20 denaturing gradient gel electrophoresis (DGGE),21 denaturing highperformance liquid chromatography (DHPLC),22 high-resolution melting analysis,23 and electrophoresis/enzymatic analysis of heteroduplex,24−26 have been developed for the screening of unknown SNPs. Once SNPs in a specific DNA sequence have been defined, unique DNA probes can be predesigned for repeat genotyping of known SNPs.27 Among nonsequencing methods, the ligase-based genotyping approach, named as ligase detection reaction (LDR), is widely employed due to its excellent specificity, robustness, and multiplex capabilities.28 To improve the detection specificity29,30 and sensitivity,31−33 LDR has been combined with various detection approaches including colorimetric,34−36 fluorescent,37−41 chemiluminescent,42 electrochemical,43 and Raman scattering methods.44 Nevertheless, frequent involvement of fluorescent and other labels increases the experimental cost and compromises the

ingle-nucleotide polymorphisms (SNPs), defined as a single base mutation at a specific locus, are among the most abundant DNA variations in human genomes.1,2 SNPs are widely used as genetic/physical markers in the population and evolutionary studies.3−5 A growing body of evidence demonstrates that SNPs are closely linked to a number of human diseases, including Alzheimer disease,6 Parkinson’s disease,7 coronary artery disease,8 Crohn’s disease,9 and cancers,10−12 and SNPs have emerged as important disease biomarkers. Moreover, pharmacogenetic studies indicate that SNPs are responsible for variable drug response among individual patients.13,14 Consequently, accurate detection of SNPs is essential to disease diagnosis and development of personalized medicine as well as biomedical research.15 Conventional methods for SNPs assay diverge into two distinct camps: screening of unknown SNPs and repeat genotyping of already characterized mutations.16,17 DNA sequencing is an ultimate way for unknown SNPs screening and is regarded as the gold standard for characterization of SNPs.18,19 However, DNA sequencing is very expensive and usually requires several days to complete the experiment. To solve these issues, a variety of nonsequencing methods, such as © XXXX American Chemical Society

Received: November 30, 2015 Accepted: January 12, 2016

A

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry Scheme 1. Bioluminescence Monitoring of Known SNPs Based on the Ligation Detection Reactiona

a

(A) Schematic representation of a typical ligase detection reaction. (B) Bioluminescence monitoring of known mutations based on ligase detection reaction. Inset shows the structure of NAD+.

Scheme 2. Bioluminescence Monitoring of Unknown SNPs Based on LDR with the Assistance of T7 Endo Ia

a (A) Both the matched and mismatched 5′-probe can be ligated by E. coli ligase. (B) After the cleavage of mutant target by T7 Endo I, the nick site can be ligated by E. coli ligase for the generation of a bioluminescence signal.

assay efficiency. Moreover, these LDR-based screening strategies are usually mediated by 3′-discriminating ligation of two carefully designed probes that perfectly match the mutant target and are only suitable for known SNPs assays. So far, the use of LDR for unknown SNPs assays still remains a great challenge. Previous research has demonstrated that DNA ligases are more sensitive toward base mismatches on the 3′-side of the nick than those on the 5′-side of the nick.45,46 In this research, we expand the discriminating capability of E. coli ligase to two extremes by simply controlling the experimental conditions: (1) to specifically ligate only perfectly matched base-pairs on the 3′-side of the nick (Scheme 1A) and (2) to indiscriminatingly ligate both the matched and mismatched base-pairs on the 5′-side of the nick (Scheme 2A). This controllable ligation reaction may enable the detection of known SNPs (Scheme 1B) and the screening of unknown mutation with the assistance of mismatch cleavage enzyme T7 Endo I (Scheme 2B).

Importantly, with the integration of bioluminescence monitoring of ligation byproduct adenosine 5'-monophosphate (AMP),47,48 we develop a simple and homogeneous LDRbased platform for label-free detection of both known and unknown SNPs.

■

EXPERIMENTAL SECTION Materials. All oligonucleotides (Table 1) were synthesized and HPLC purified by Sangon Biotechnology Co. Ltd. (Shanghai, China). E. coli DNA ligase and dCTP and DNA markers (20bp DNA ladder and DL 2000 marker) were purchased from Takara Biotechnology Co., Ltd. (Dalian, China). Taq DNA ligase, Q5 High-Fidelity DNA Polymerase, dNTPs (10 mM), 10× Cutsmart buffer, and T7 endonuclease I (T7 Endo I) were obtained from New England Biolabs (Beverly, MA, USA). Phospho(enol)pyruvic acid monosodium salt hydrate (PEP), pyruvate kinase from rabbit muscle (PK), and adenylate kinase (AK) from chicken muscle were

B

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry Table 1. Sequences of Synthesized Oligonucleotidesa note

sequence (5′−3′)

Template-T Template-G Template-A Template-C 3′-probe-A 3′-probe-G 3′-probe-T 3′-probe-C 5′-probe-A 5′-probe-G 5′-probe-T 5′-probe-C K-ras-Fw K-ras-Rv Probe-A Probe-G Probe-T Probe-C

TCGTCAAGGCACTCTTGCCTACGCCATCAGCTCCAACTACCACAAGTTTATATT TCGTCAAGGCACTCTTGCCTACGCCAGCAGCTCCAACTACCACAAGTTTATATT TCGTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTACCACAAGTTTATATT TCGTCAAGGCACTCTTGCCTACGCCACCAGCTCCAACTACCACAAGTTTATATT ACTTGTGGTAGTTGGAGCTGA TGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTGG TGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTGT TGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTGC TGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTG ATGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTG GTGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTG TTGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTG CTGGCGTAGGCAAGAGTGCCT GCCTGCTGAAAATGACTGAA AGAATGGTCCTGCACCAGTA ACTTGTGGTAGTTGGAGCTGATGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTGTTGGCGTAGGCAAGAGTGCCT ACTTGTGGTAGTTGGAGCTGCTGGCGTAGGCAAGAGTGCCT

a The underlined bases within the templates indicate known sites of SNPs. The bold italic bases within the probes indicate the allele-specific site complement with the mutation site of corresponding templates. K-ras-Fw and K-ras-Rv are PCR primers used for amplifying K-ras in genomic DNA.

in 25.0 μL of 1× Q5 high-fidelity polymerase reaction buffer. All reaction components were mixed on ice and then quickly transferred to a Bio-Rad CFX ConnectTM thermocycler which was preheated to the denaturation temperature of 98 °C. After a 3 min denaturation step, the amplification was performed by thermally cycling for 35 cycles at 98 °C for 10 s, at 64 °C for 20 s, at 72 °C for 15 s, and at 72 °C for 2 min for a final extension, and then, the melting curve was analyzed. The PCR products were purified by a SanPrep Column PCR Product Purification Kit (Sangon Biotechnology) and redissolved in 20 μL of deionized water. Ligation reaction was slightly modified for genotyping target fragment. Briefly, 2.0 μL of purification product was mixed with 1 μM detection probes in ligation buffer without NAD+, and then, the mixture was heated at 95 °C for 5 min, followed by annealing to room temperature. After the addition of E. coli DNA ligase (0.05 U/μL) and NAD+ (0.15 μM), the ligation reaction was performed at room temperature for another 20 min. After denaturing the enzyme, the ligation products were analyzed by bioluminescence measurement. Meanwhile, the PCR products were sequenced by Sanger-sequencing (BGI, Shenzhen) to confirm the results. Bioluminescence Measurement of Unknown Mutation in T7 Endo I-Treated Heteroduplex. Both homoduplexes and heteroduplexes were prepared by mixing the probes and the templates (Table 1) in 1× Cutsmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, and 10 mM magnesium acetate). The mixture was annealed in a thermocycle system at 95 °C for 3 min, followed by decreasing to 25 °C at a rate of 0.1 °C/s. After the annealing, 0.5 μL of T7 endonuclease I (10 U/μL) was added to 10.0 μL of homoduplex/heteroduplex solution (100 nM) and incubated at 37 °C for 1 h. For gel electrophoresis, the T7 Endo I cleavage products were directly loaded on a 10% polyacrylamide gel and electrophoresed in 1× TBE buffer at a 100 V constant voltage for 50 min. For bioluminescence measurement, extra E. coli ligase (0.5 U) and 0.25 μL of NAD+ (30 μM) were added simultaneously during the treatment of heteroduplexes with T7 Endo I. The bioluminescence signal was

purchased from Sigma-Aldrich, Inc. (St. Louis, MO, USA). The ATP determination kit was obtained from Invitrogen (Carlsbad, CA, USA). The 96-well white microplate was purchased from Fisher Scientific (Pittsburgh, PA, USA). Bioluminescence Measurement and Gel Electrophoresis Analysis of Ligation. Unless noted otherwise, 0.05 U/ μL E. coli DNA ligase was first mixed with 100 nM templates and probes, and then incubated at 26 °C for 10 min in ligation buffer (30 mM Tris-HCl, pH 8.0, 4 mM MgCl2, 1 mM DTT, 0.75 μM NAD+, and 50 μg/mL BSA) in a total volume of 10.0 μL. The experimental conditions were optimized as indicated in the main text. After ligation, E. coli DNA ligase was denatured at 75 °C for 10 min, and then, the products were analyzed by bioluminescence measurement and gel electrophoresis. For bioluminescence measurement, 9.0 μL of ligation products was added into 40.0 μL of the ATP detection system which contained 4.0 μL of 10 × ligation buffer, 4.0 μL of AMP-toATP conversion buffer (1.0 μL of 1 U/μL AK, 1.0 μL of 1 U/ μL PK, 1.0 μL of 10 mM dCTP, and 1.0 μL of 4.8 mM PEP), and 5 μL of ATP detection buffer (0.5 mM D-luciferin, 1.25 μg/ mL firefly luciferase, 25 mM Tricine buffer (pH 7.8), 5 mM MgSO4, 100 μM EDTA, and 1 mM DTT). The bioluminescence signal was measured with a Glomax 96-well luminometer (Promega, Madison, WI, USA) at room temperature. For gel electrophoresis, FAM-labeled 3′-probe was used in the ligation reaction. The 2.0 μL of ligation buffer was mixed with 2.0 μL of 6× loading buffer and 8.0 μL of 100% formamide. The samples were denatured at 95 °C for 10 min and then rapidly chilled on ice, followed by loading into 8 M urea-15% polyacrylamide gel and electrophoresed in 1× TBE buffer (89 mM Tris-Boric acid, 2 mM EDTA, pH 8.0) at a 110 V constant voltage for 60 min. The gel was scanned by a Kodak Image Station 4000 MM (Rochester, NY, USA). Detection of Known Mutation in Human Genomic DNA. Human genomic DNA was extracted from HeLa cells (∼106) by using Universal Genomic DNA Extraction Kit Ver. 5.0 (TaKaRa). The 200 μM dNTPs, 500 nM forward and reverse primers (Table 1), 1× SYBR Gold, 0.5 units polymerase, and about 100 ng of genomic DNA were mixed C

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry collected by using the same procedures for the known mutation assay.

■

RESULTS AND DISCUSSION Bioluminescence Monitoring of Known SNPs. The principle for the known SNPs assays combines target-specific ligase detection reaction (LDR) with bioluminescence monitoring of LDR byproduct AMP. As shown in Scheme 1A, in a typical LDR, the allele-specific 3′-probe is used to recognize the target template and only the perfectly matched 3′-probe can be ligated by E. coli ligase. This selective LDR enables the detection of known SNPs (Scheme 1B). Notably, the lengths of DNA probes are designed to be ∼20 nt long so that they may specifically hybridize to the unique position of the human genome,49 and the DNA templates are designed to be 54 nt long to mimic the real genomic samples because the noncomplementary ssDNA tails may influence the thermodynamics of DNA hybridization.50 In the presence of mutant target, the specific 3′-probe may perfectly match the mutant target, triggering the LDR with the assistance of E. coli ligase. The LDR reaction releases the byproduct AMP which can be converted to ATP through the combination of the enzymatic reactions of adenylate kinase (AK) and pyruvate kinase (PK) in the presence of dCTP and PEP. Subsequently, ATP may initiate the classical firefly luciferase−luciferin system to generate a distinct bioluminescence signal (Scheme 1B).47 In contrast, in the absence of mutant target, the mismatched base pair between the 3′-probe and the template cannot be ligated by E. coli ligase, and no bioluminescence signal is observed. Validation of Assay. To evaluate the activity of E. coli ligase, we employed the bioluminescence to monitor the ligation byproduct AMP of E. coli ligase-catalyzed ligation reaction47 and investigated the quantitative relationship between the released AMP and the ligated DNA as well (Figure 1). We first used the gel electrophoresis to analyze the ligated DNAs. As shown in Figure 1A, the band intensity of ligated DNA increases with time for the matched base pair of T:A (Figure 1A, top part), suggesting the improvement of ligation efficiency as a function of time. However, long incubation time may induce the nonspecific ligation of a mismatched base pair of T:G (Figure 1A, bottom part). We then used the bioluminescence to monitor the released AMP and compared the results of bioluminescence measurement with those of gel electrophoresis which quantified the ligated DNA directly. Interestingly, the time-course of AMP agrees well with that of ligated DNA (Figure 1B). The calculated mole ratio of AMP to DNA is 0.98, indicating the release of one AMP in each ligation reaction, consistent with the previous report that the linkage formation of the phosphodiester bond is stoichiometric with the release of AMP in E. coli ligasecatalyzed DNA ligation.51 These results demonstrate that the bioluminescence monitoring of AMP may be used to quantify the ligation reaction accurately. In comparison with the colorimetric,34−36 fluorescent,37−41 electrochemical,43 and Raman scattering methods,44 the bioluminescent method may provide a simple, homogeneous, and label-free approach for real-time monitoring of the byproduct AMP of the ligation reaction. Optimization of Experimental Conditions. We designed two DNA probes with a T base on the 3′-side (defined as 3′probe) and on the 5′-side of the nick (defined as 5′-probe). We also designed four DNA templates with A, T, G, and C base pairing to the T base of DNA probes, respectively. We

Figure 1. Comparison of E. coli ligase-catalyzed ligation toward the matched base pair of T:A and the mismatched base pair of T:G. (A) Gel electrophoresis analysis of ligation product DNA and (B) comparison of bioluminescence monitoring of the ligated byproduct AMP (blue symbols) with the gel electrophoresis analysis (black symbols). The base pair of 3′-T:A and 3′-T:G indicate the X:Y base pair on the 3′-side of the nick as shown in Scheme 1A.

employed these two DNA probes and four DNA templates to investigate the differences of ligation efficiency in response to the matched (T:A) and mismatched (T:G, T:T, and T:C) ligation. As shown in Figure 2A, no matter whether the T base locates on the 3′-side or on the 5′-side of the nick, the perfectly matched (T:A) ligation generates a higher bioluminescence signal than the mismatched (T:G, T:T, and T:C) ligation. Moreover, in the mismatched (T:G, T:T, and T:C) ligation, the 5′-probe generates a higher bioluminescence signal than the 3′probe, especially for the T:T and T:C ligations. These results demonstrate that the 3′-probe possesses higher discriminating capability than the 5′-probe. Thus, the 3′-probe is used for the detection of known SNPs. We then employed the 3′-probe and two DNA templates with A and G base pairing to the T base of DNA probe, respectively, to optimize the experimental conditions including the ligation temperature, ligase concentration, and ionic strength. As shown in Figure 2B, for both matched (T:A) and mismatched (T:G) ligation, the bioluminescence signal increases with the increasing temperature from 4 to 26 °C and levels off from 26 to 37 °C, followed by decreasing beyond 45 °C due to the heating-induced inactivation of thermolabile enzyme. The discrimination efficiency of ligase may be quantitatively evaluated by the ratio of the bioluminescence signal in response to the matched (T:A) ligation to the bioluminescence signal in response to the mismatched (T:G) ligation. The highest discrimination efficiency is obtained at 26 °C (Figure 2B), and thus, the ligation is performed at 26 °C in the subsequent research. D

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 2. (A) Bioluminescence monitoring of the matched (T:A) and mismatched (T:G, T:T, and T:C) ligation using 3′-probe/5′-probe as shown in Scheme 1A. The defined base pair indicates the X:Y base pair, respectively. (B−D) Bioluminescence monitoring of the matched and mismatched ligation using the 3′-probe under different experimental conditions: ligation temperature (B), ligase concentrations (C), and KCl concentrations (D). The base pair of T:A and T:G indicates the X:Y base pair on the 3′-side of the nick as shown in Scheme 1A. Error bars show the standard deviation of three independent experiments.

Figure 3. Detection of known SNP in K-ras oncogene using 3′-probe. (A) Bioluminescence signal in response to the targets with perfectly matched base (marked by red color) and single mismatched base (marked by black color). The defined base pair indicates the X:Y base pair on the 3′-side of the nick as shown in Scheme 1A. (B) Variation of bioluminescence signal with the variant frequency. The total concentration of MT and WT target is 50 nM. Inset: linear relationship between the bioluminescence signal and the concentration of MT target. (C−D) Bioluminescence measurement (C) and DNA sequencing analysis (D) of PCR-amplified K-ras oncogene samples. Error bars show the standard deviation of three independent experiments.

μL and levels off beyond 0.05 U/μL. However, for the mismatched (T:G) ligation, the bioluminescence signal keeps increasing with the increase of ligase concentration from 0.01 to 0.2 U/μL. These results demonstrate that the low ligase

We further investigated the influence of ligase concentration upon the ligation efficiency (Figure 2C). For the perfectly matched (T:A) ligation, the bioluminescence signal improves with the increase of ligase concentration from 0.01 to 0.05 U/ E

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 4. Detection of unknown mutations through the undiscriminating ligation of both matches and mismatches at the 5′-nick site by E. coli ligase. (A) Bioluminescence signal in response to the ligations of both matches (marked by red color) and mismatches (marked by black color) at the 5′nick site. The defined base pair indicates the X:Y base pair on the 5′-side of the nick as shown in Scheme 2A. Bioluminescence (B) and gel electrophoresis analysis (C) of the cleavage of various DNA homoduplexes and heteroduplexes by T7 Endo I. The matched base-pairs indicate the DNA homoduplexes, whereas the mismatched base-pairs indicate the heteroduplexes. (D) Variance of bioluminescence signal as a function of homoduplex-to-heteroduplex ratios. The two homoduplexes and two heteroduplexes are mixed at equal mole ratios. Error bars show the standard deviation of three independent experiments.

concentration may improve the ligation specificity52 while the high ligase concentration may facilitate the mismatched ligation. Since high salt may suppress the T4 ligase-catalyzed ligation of DNA nick with the mismatched base pairing,52,53 we further investigated whether an appropriate ionic strength may enable E. coli DNA ligase to ligate the mismatched base pairing indiscriminatingly. We studied three kinds of monovalent cations including sodium, potassium, and ammonium ions. The measured bioluminescence signals are corrected using the control sample without DNA template under the same experimental conditions to eliminate the interference of ionic strength.48 Our results demonstrate that up to 100 mM Na+ has no significant effect upon the perfectly matched (T:A) ligation, but with an obvious inhibition upon the mismatched (T:G) ligation (see Figure S1A). Interestingly, up to 200 mM K+ does not influence the perfectly matched (T:A) ligation, but the mismatched (T:G) ligation increases with the increasing K+ concentration from 0 to 50 mM and decreases beyond the concentration of 50 mM (Figure 2D). Similar to K+, up to 100 mM NH4+ does not influence the perfectly matched (T:A) ligation, but the mismatched (T:G) ligation increases with the increasing NH4+ concentration from 0 to 10 mM and decreases beyond the concentration of 10 mM (see Figure S1B). We also investigated the effect of K+ and NH4+ on the mismatched ligation using the 5′-probe (see Figure S2). Our results demonstrate that an extremely high salt concentration may enhance the ligation specificity due to the inhibition of 5′adenylate formation (the second reaction step of enzymatic DNA ligation) which may reduce the mismatched ligation.53 Notably, the low-concentration NH4+ and K+ may stimulate the joining reaction of E. coli DNA ligase, whereas Na+ has no such

effect;54 consequently, NH4+ and K+ may reduce the specificity of E. coli DNA ligase and aggravate the mismatched ligation.55 In particular, E. coli DNA ligase exhibits poor specificity in the presence of low-concentration K+ and NH4+, which may provide a simple and effective way for the ligation of mismatched base pairing. Detection of SNPs in K-ras. We used high discriminating 3′-probes to detect the known SNPs under the optimized experimental conditions (low ligase concentration without K+). To demonstrate the discrimination of perfectly matched base from the single mismatched base, we designed four different 3′probes to detect four targets with all possible variations in the middle base of codon 12 of K-ras (Figure 3A). On the basis of Scheme 1B, only the perfectly matched ligation (T:A and C:G) may generate high bioluminescence signal. As shown in Figure 3A, a distinct bioluminescence signal is observed when 3′-probe perfectly matches the target (Figure 3A, red-marked bases). In contrast, no significant bioluminescence signal is observed when there is a point mutation in the target (Figure 3A, blackmarked bases). These results clearly demonstrate that this method can be applied for accurate detection of known SNPs. We then evaluated the detection sensitivity using the mutant target (MT) with different concentrations. As shown in inset of Figure 3B, the bioluminescence signal (B) improves with the increase of MT concentration (C), and the bioluminescence signal shows a linear correlation with the MT concentration in the range from 32 pM to 100 nM. The correlation equation is B = 0.781 + 0.716C (R2 = 0.996), and the detection limit is calculated to be 20.6 pM on the basis of three times standard deviation over the blank signal. We further investigated the feasibility of the proposed method for quantitative analysis of allele frequency. We prepared the mixtures containing mutantF

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

account the difficulty of E. coli DNA ligase to ligate the bluntend,64 we treated the heteroduplexes simultaneously with T7 Endo I and E. coli DNA ligase. As shown in Figure 4B, the bioluminescence signals obtained in most heteroduplexes (especially the mismatches with C base) are much higher than those obtained in the homoduplexes. These results are consistent with the fact that T7 Endo I is able to recognize and cleave the DNA hybrids with the mismatched base pairs,25,56−58 further confirming the feasibility of the proposed method for the detection of unknown SNPs. It should be noted that the bioluminescence signal varies from the mismatch to the mismatch (Figure 4B). This may result from the different cleavage efficiency of T7 Endo I toward different mismatched targets. We further used the gel electrophoresis to analyze the cleavage product of T7 Endo I (Figure 4C). Our results indicate that the amount of cleaved fragments correlates well with the bioluminescence measurement which shows higher bioluminescence signals obtained in the heteroduplexes (especially the mismatches with C base) than those obtained in the homoduplexes (Figure 4B). This may be explained by the relative higher cleavage efficiencies of T7 Endo I toward pyrimidines than purines, consistent with a previous report about the cleavage of the mismatches by T4 endonuclease VII.62 To demonstrate the feasibility of the proposed method for real sample analysis, we mixed two homoduplexes and two heteroduplexes at equal mole ratios to mimic the real samples. As shown in Figure 4D, only weak bioluminescence signals are observed in the homoduplexes (0% heteroduplex ratio). In contrast, relative high bioluminescence signals are observed in the heteroduplexes. Moreover, the bioluminescence signal increases as a function of homoduplex-to-heteroduplex ratio. These results clearly demonstrate the potential of the proposed method for real sample analysis.

type (MT) target and wild-type (WT) target at the ratio of 0%, 1%, 5%, 10%, 50%, and 100%, respectively. The total concentration of target DNA is 50 nM. As shown in Figure 3B, the bioluminescence signal enhances with the increasing MT-to-WT ratio. Notably, even as low as 1% allele frequency can be sensitively detected. These results demonstrate that the proposed method can be used for quantitative analysis of allele frequency, holding great promise for further application in the analysis of pooled DNA samples.37 Real Sample Analysis. To investigate the feasibility of the proposed method for real sample analysis, we used the PCR product of genomic DNA from Hela cells as a model. We designed four specific 3′-probes (Table 1) for the analysis of high-quality DNA products (see Figure S3) which contain codon 12 of K-ras. As shown in Figure 3C, a distinct bioluminescence signal is obtained only in the presence of 3′probe-G instead of the other three probes including 3′-probe-A, 3′-probe-C, and 3′-probe-T. These results are further confirmed by DNA sequencing (Figure 3D) which shows the existence of C-base in the middle of codon 12 of K-ras. Therefore, our proposed method can be applied for the identification of known mutation in real sample, holding great potential in early diagnosis of SNP-related human diseases. Bioluminescence Monitoring of Unknown SNPs. Figure 2A shows that the mismatches on the 5′-side of the nick have no significant effect on the ligation efficiency of E. coli ligase; i.e., both the matched and mismatched base pairing on the 5′-side of the nick can be ligated (Scheme 2A). In theory, this feature is not good for the detection of a known mutation, but it may be beneficial for the detection of unknown SNPs with the assistance of T7 Endo I. We selected T7 Endo I in this research, because T7 Endo I can preferentially cleave the DNA backbone of the heteroduplex on the 5′-side of the mismatched base pair25,56−58 whereas the other mismatch cleavage enzymes can only cleave on the 3′-side of the mismatches.26,59−61 T7 Endo I-induced cleavage reaction may generate a nick/break site with a 5′ PO4 group and a 3′ OH group, which can be efficiently ligated by E. coli ligase (E. coli ligase shows undiscriminating cleavage capability toward the mismatches on the 5′-side of the nick). Consequently, the mutant doublestranded with a mismatched pair can be cleaved by T7 Endo I to generate a nick site which can be further ligated by E. coli ligase, producing a distinct bioluminescence signal (Scheme 2B). Figures 2D and S2 show the maximum mismatched ligation can be obtained in the presence of 50 mM K+. In this research, we investigated the ligations of DNA substrates with all possible matched and mismatched base-pairs at the 5′-nick site in the presence of 50 mM K+. As shown in Figure 4A, the ligation of mismatches is effective just like that of matches and no significant difference is observed between them. Among the ligation of mismatches, the minimum ligation is observed in the mismatched pair of A:G (76.7%) and the maximum ligation is observed in the mismatched pair of T:G (101.6%). The average ligation efficiency of mismatches is 91.1%. These results indicate that both the matched and mismatched base-pairs at the 5′-nick site can be ligated by E. coli ligase under the experimental condition of 50 mM K+. We further investigated the bioluminescence monitoring of the heteroduplexes (mutant targets with the mismatched bases) and the homoduplexes (wild-type targets with the perfect matched bases). Notably, T7 Endo I may break DNA in a stepwise fashion with nick and counter-nick.62,63 Taking into

■

CONCLUSIONS In conclusion, we have developed a simple method for sensitive detection of both unknown and known SNPs based on bioluminescence monitoring of LDR without relying on any expensive labels and labor-intensive separation. The core principle is the tunable specificity of E. coli DNA ligase, which enables the controlled ligation of either 3′-matches alone or all 5′-mismatches on the nick junction with the assistance of T7 Endo I. We design a 3′-probe for the discrimination of known mutation and introduce a T7 Endo I for the detection of unknown mutation. With the integration of bioluminescence monitoring of ligation byproduct AMP, both known and unknown SNPs can be easily detected. This nonsequencing platform is simple, homogeneous, label-free, and cost-effective and may provide a valuable complement to current sequencing technologies for disease diagnostics, personalized medicine, and biomedical research such as the assay of mutations induced by environmental factors and work-related hazards.65−68

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.analchem.5b04540. Supplementary Figures S1−S3. (PDF) G

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

■

(13) Melton, L. Nature 2003, 422, 917−923. (14) McCarthy, J. J.; Hilfiker, R. Nat. Biotechnol. 2000, 18, 505−508. (15) Shen, W.; Tian, Y.; Ran, T.; Gao, Z. Q. TrAC, Trends Anal. Chem. 2015, 69, 1−13. (16) Cotton, R. G. H. Mutat. Res., Fundam. Mol. Mech. Mutagen. 1993, 285, 125−144. (17) Kirk, B. W.; Feinsod, M.; Favis, R.; Kliman, R. M.; Barany, F. Nucleic Acids Res. 2002, 30, 3295−3311. (18) DePristo, M. A.; Banks, E.; Poplin, R.; Garimella, K. V.; Maguire, J. R.; Hartl, C.; Philippakis, A. A.; del Angel, G.; Rivas, M. A.; Hanna, M.; McKenna, A.; Fennell, T. J.; Kernytsky, A. M.; Sivachenko, A. Y.; Cibulskis, K.; Gabriel, S. B.; Altshuler, D.; Daly, M. J. Nat. Genet. 2011, 43, 491−498. (19) Hacia, J. G. Nat. Genet. 1999, 21, 42−47. (20) Kourkine, I. V.; Hestekin, C. N.; Barron, A. E. Electrophoresis 2002, 23, 1375−1385. (21) Khrapko, K.; Hanekamp, J. S.; Thilly, W. G.; Belenkii, A.; Foret, F.; Karger, B. L. Nucleic Acids Res. 1994, 22, 364−369. (22) Jones, A. C.; Austin, J.; Hansen, N.; Hoogendoorn, B.; Oefner, P. J.; Cheadle, J. P.; O’Donovan, M. C. Clin. Chem. 1999, 45, 1133− 1140. (23) Wittwer, C. T.; Reed, G. H.; Gundry, C. N.; Vandersteen, J. G.; Pryor, R. J. Clin. Chem. 2003, 49, 853−860. (24) Tian, H. J.; Brody, L. C.; Mao, D.; Landers, J. P. Anal. Chem. 2000, 72, 5483−5492. (25) Mashal, R. D.; Koontz, J.; Sklar, J. Nat. Genet. 1995, 9, 177−183. (26) Youil, R.; Kemper, B. W.; Cotton, R. G. H. Proc. Natl. Acad. Sci. U. S. A. 1995, 92, 87−91. (27) Kim, S.; Misra, A. Annu. Rev. Biomed. Eng. 2007, 9, 289−320. (28) Cao, W. G. Trends Biotechnol. 2004, 22, 38−44. (29) Abravaya, K.; Carrino, J. J.; Muldoon, S.; Lee, H. H. Nucleic Acids Res. 1995, 23, 675−682. (30) Luo, J. Y.; Bergstrom, D. E.; Barany, F. Nucleic Acids Res. 1996, 24, 3071−3078. (31) Shen, W.; Deng, H. M.; Gao, Z. Q. J. Am. Chem. Soc. 2012, 134, 14678−14681. (32) Li, J. S.; Zhong, W. W. Anal. Chem. 2007, 79, 9030−9038. (33) Li, J. S.; Deng, T.; Chu, X.; Yang, R. H.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Anal. Chem. 2010, 82, 2811−2816. (34) Li, J. S.; Chu, X.; Liu, Y. L.; Jiang, J. H.; He, Z. M.; Zhang, Z. W.; Shen, G. L.; Yu, R. Q. Nucleic Acids Res. 2005, 33, e168. (35) Toubanaki, D. K.; Christopoulos, T. K.; Ioannou, P. C.; Flordellis, C. S. Anal. Chem. 2009, 81, 218−224. (36) Xue, X. J.; Xu, W.; Wang, F.; Liu, X. G. J. Am. Chem. Soc. 2009, 131, 11668−11669. (37) Cheng, Y. Q.; Du, Q.; Wang, L. Y.; Jia, H. L.; Li, Z. P. Anal. Chem. 2012, 84, 3739−3744. (38) Wang, H.; Li, J. S.; Wang, Y. X.; Jin, J. Y.; Yang, R. H.; Wang, K. M.; Tan, W. H. Anal. Chem. 2010, 82, 7684−7690. (39) Song, Y. K.; Zhang, Y.; Wang, T. H. Small 2013, 9, 1096−1105. (40) Wabuyele, M. B.; Farquar, H.; Stryjewski, W.; Hammer, R. P.; Soper, S. A.; Cheng, Y. W.; Barany, F. J. Am. Chem. Soc. 2003, 125, 6937−6945. (41) Yeh, H. C.; Ho, Y. P.; Shih, I. M.; Wang, T. H. Nucleic Acids Res. 2006, 34, e35. (42) Wang, H. Q.; Liu, W. Y.; Wu, Z.; Tang, L. J.; Xu, X. M.; Yu, R. Q.; Jiang, J. H. Anal. Chem. 2011, 83, 1883−1889. (43) Huang, Y.; Zhang, Y. L.; Xu, X. M.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. J. Am. Chem. Soc. 2009, 131, 2478−2480. (44) Lowe, A. J.; Huh, Y. S.; Strickland, A. D.; Erickson, D.; Batt, C. A. Anal. Chem. 2010, 82, 5810−5814. (45) Liu, P. F.; Burdzy, A.; Sowers, L. C. Nucleic Acids Res. 2004, 32, 4503−4511. (46) Kim, J.; Mrksich, M. Nucleic Acids Res. 2010, 38, e2. (47) Xu, Q. F.; Zhu, G. C.; Zhang, C. Y. Anal. Chem. 2013, 85, 6915−6921. (48) Du, J.; Xu, Q. F.; Lu, X. Q.; Zhang, C. Y. Anal. Chem. 2014, 86, 8481−8488. (49) Barany, F. Proc. Natl. Acad. Sci. U. S. A. 1991, 88, 189−193.

AUTHOR INFORMATION

Corresponding Authors

*Tel.: +86 0531-86186033. Fax: +86 0531-82615258. E-mail: [email protected]. *Tel.: +86 0531-86180010. Fax: +86 0531-86180017. E-mail: [email protected]. Author Contributions †

Q.X., S.H., and F.M. contributed equally.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (Grants 21325523, 21405169, and 21527811), the Award for One Hundred Talent Program of Nanyue of Guangdong Province, the Award for Pengcheng Distinguished Scholars of Shenzhen City, and the Award for Team Leader Program of Taishan Scholars of Shandong Province, China.

■

REFERENCES

(1) Hinds, D. A.; Stuve, L. L.; Nilsen, G. B.; Halperin, E.; Eskin, E.; Ballinger, D. G.; Frazer, K. A.; Cox, D. R. Science 2005, 307, 1072− 1079. (2) Syvänen, A.-C. Nat. Rev. Genet. 2001, 2, 930−942. (3) Brumfield, R. T.; Beerli, P.; Nickerson, D. A.; Edwards, S. V. Trends Ecol. Evol. 2003, 18, 249−256. (4) Filliol, I.; Motiwala, A. S.; Cavatore, M.; Qi, W. H.; Hazbon, M. H.; del Valle, M. B.; Fyfe, J.; Garcia-Garcia, L.; Rastogi, N.; Sola, C.; Zozio, T.; Guerrero, M. I.; Leon, C. I.; Crabtree, J.; Angiuoli, S.; Eisenach, K. D.; Durmaz, R.; Joloba, M. L.; Rendon, A.; SifuentesOsornio, J.; de Leon, A. P.; Cave, M. D.; Fleischmann, R.; Whittam, T. S.; Alland, D. J. Bacteriol. 2006, 188, 759−772. (5) Gray, I. C.; Campbell, D. A.; Spurr, N. K. Hum. Mol. Genet. 2000, 9, 2403−2408. (6) Li, H.; Wetten, S.; Li, L.; Jean, P. L. S.; Upmanyu, R.; Surh, L.; Hosford, D.; Barnes, M. R.; Briley, J. D.; Borrie, M.; Coletta, N.; Delisle, R.; Dhalla, D.; Ehm, M. G.; Feldman, H. H.; Fornazzari, L.; Gauthier, S.; Goodgame, N.; Guzman, D.; Hammond, S.; Hollingworth, P.; Hsiung, G. Y.; Johnson, J.; Kelly, D. D.; Keren, R.; Kertesz, A.; King, K. S.; Lovestone, S.; Loy-English, I.; Matthews, P. M.; Owen, M. J.; Plumpton, M.; Pryse-Phillips, W.; Prinjha, R. K.; Richardson, J. C.; Saunders, A.; Slater, A. J.; George-Hyslop, P. H. S.; Stinnett, S. W.; Swartz, J. E.; Taylor, R. L.; Wherrett, J.; Williams, J.; Yarnall, D. P.; Gibson, R. A.; Irizarry, M. C.; Middleton, L. T.; Roses, A. D. Arch. Neurol. 2008, 65, 45−53. (7) Momose, Y.; Murata, M.; Kobayashi, K.; Tachikawa, M.; Nakabayashi, Y.; Kanazawa, I.; Toda, T. Ann. Neurol. 2002, 51, 133−136. (8) Bacci, S.; Menzaghi, C.; Ercolino, T.; Ma, X. W.; Rauseo, A.; Salvemini, L.; Vigna, C.; Fanelli, R.; Di Mario, U.; Doria, A.; Trischitta, V. Diabetes Care 2004, 27, 2015−2020. (9) Yamazaki, K.; McGovern, D.; Ragoussis, J.; Paolucci, M.; Butler, H.; Jewell, D.; Cardon, L.; Takazoe, M.; Tanaka, T.; Ichimori, T.; Saito, S.; Sekine, A.; Iida, A.; Takahashi, A.; Tsunoda, T.; Lathrop, M.; Nakamura, Y. Hum. Mol. Genet. 2005, 14, 3499−3506. (10) Isla, D.; Sarries, C.; Rosell, R.; Alonso, G.; Domine, M.; Taron, M.; Lopez-Vivanco, G.; Camps, C.; Botia, M.; Nunez, L.; SanchezRonco, M.; Sanchez, J. J.; Lopez-Brea, M.; Barneto, I.; Paredes, A.; Medina, B.; Artal, A.; Lianes, P.; Spanish Lung Canc, G.. Ann. Oncol. 2004, 15, 1194−1203. (11) Försti, A.; Angelini, S.; Festa, F.; Sanyal, S.; Zhang, Z. Z.; Grzybowska, E. W. A.; Pamula, J.; Pekala, W.; Zientek, H.; Hemminki, K.; Kumar, R. Oncol. Rep. 2004, 11, 917−922. (12) Green, H.; Soderkvist, P.; Rosenberg, P.; Horvath, G.; Peterson, C. Clin. Cancer Res. 2006, 12, 854−859. H

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry (50) Di Michele, L.; Mognetti, B. M.; Yanagishima, T.; Varilly, P.; Ruff, Z.; Frenkel, D.; Eiser, E. J. Am. Chem. Soc. 2014, 136, 6538− 6541. (51) Hall, Z. W.; Lehman, I. R. J. Biol. Chem. 1969, 244, 43−47. (52) Landegren, U.; Kaiser, R.; Sanders, J.; Hood, L. Science 1988, 241, 1077−1080. (53) Wu, D. Y.; Wallace, R. B. Gene 1989, 76, 245−254. (54) Modrich, P.; Lehman, I. R. J. Biol. Chem. 1973, 248, 7502−7511. (55) Tong, J.; Cao, W. G.; Barany, F. Nucleic Acids Res. 1999, 27, 788−794. (56) Babon, J. J.; McKenzie, M.; Cotton, R. G. H. Mol. Biotechnol. 2003, 23, 73−81. (57) Tsuji, T.; Niida, Y. Electrophoresis 2008, 29, 1473−1483. (58) Huang, M. C.; Cheong, W. C.; Lim, L. S.; Li, M. H. Electrophoresis 2012, 33, 788−796. (59) Babon, J. J.; McKenzie, M.; Cotton, R. G. H. Electrophoresis 1999, 20, 1162−1170. (60) Huang, J. M.; Lu, J.; Barany, F.; Cao, W. G. Biochemistry 2002, 41, 8342−8350. (61) Oleykowski, C. A.; Mullins, C. R. B.; Godwin, A. K.; Yeung, A. T. Nucleic Acids Res. 1998, 26, 4597−4602. (62) Solaro, P. C.; Birkenkamp, K.; Pfeiffer, P.; Kemper, B. J. Mol. Biol. 1993, 230, 868−877. (63) Pottmeyer, S.; Kemper, B. J. Mol. Biol. 1992, 223, 607−615. (64) Barringer, K. J.; Orgel, L.; Wahl, G.; Gingeras, T. R. Gene 1990, 89, 117−122. (65) Hepel, M.; Stobiecka, M.; Nowicka, A.; Preedy, V.; Patel, V. In Biosensors and Environmental Health; Preedy, V. R., Patel, V., Eds.; CRC Press: Boca Raton, FL, 2012; pp 230−255. (66) Hepel, M.; Stobiecka, M. In Fine Particles in Medicine and Pharmacy; Matijević, E., Ed.; Springer: New York, 2012; pp 241−281. (67) Stobiecka, M. In State of the Art in Biosensors - Environmental and Medical Applications; Rinken, T., Ed.; InTech: Vienna, Austria, 2013; pp 201−222. (68) Hepel, M.; Stobiecka, M.; Peachey, J.; Miller, J. Mutat. Res., Fundam. Mol. Mech. Mutagen. 2012, 735, 1−11.

I

DOI: 10.1021/acs.analchem.5b04540 Anal. Chem. XXXX, XXX, XXX−XXX