Controlling the Adsorption and Reactivity of DNA on Gold - Langmuir

Nov 8, 2003 - Due to its coding nature, the many chemical and enzymatic manipulations that it can undergo, and its relative stability, DNA is being us...
0 downloads 13 Views 261KB Size
Download PDF
Langmuir 2003, 19, 10573-10580

10573

Controlling the Adsorption and Reactivity of DNA on Gold T. Aqua,† R. Naaman,*,† and S. S. Daube‡ Department of Chemical Physics and Chemical Research Support, Weizmann Institute, Rehovot 76100, Israel Received June 24, 2003. In Final Form: September 23, 2003 Due to its coding nature, the many chemical and enzymatic manipulations that it can undergo, and its relative stability, DNA is being used as a scaffold and a building block outside the cellular context. The mode by which the DNA is connected to a solid surface is in the heart of technological advancements, such as DNA chips and biosensors. The desire is to connect the DNA to a given surface in a predesigned manner, tailored to any device specifications. In this work, DNA molecules were adsorbed specifically on gold surfaces. The specificity of the adsorption was controlled by a novel approach, in which the gold surface was first blocked with a hydrophobic layer (C18-SH) to various extents, followed by the adsorption of thiolated DNA. The technique was applied both for short and for long strands of DNA. We show that the reactivity of the thiolated short DNA in a ligation reaction is enhanced by more than an order of magnitude by the presence of the alkylthiol layer. Due to the hydrophobic and insulating nature of the C18-SH layer, this blocking method is advantageous for electronic measurements.

Introduction In the past decade it has become clear that DNA should no longer be viewed as solely the carrier of genetic information. Rather, due to its coding nature (i.e., the complementarity of its two strands), the many chemical and enzymatic manipulations that it can undergo, and its relative stability; researchers have learned to appreciate the enormous potential in utilizing DNA as a scaffold and a building block outside the cellular context. This realization has brought to the development of new technologies such as DNA microarrays and biosensors.1-7 In the heart of these technological advancements lies the connection of DNA to a solid surface. The desire is to connect the DNA to a given surface in a predesigned manner, tailored to the specification of the device. DNA adsorption on surfaces has therefore been characterized extensively by various surface techniques.8-15 Numerous studies have * To whom correspondence may be addressed. E-mail: [email protected]. Fax: 972-8-9344123. † Department of Chemical Physics. ‡ Chemical Research Support. (1) Jung, A. Anal. Bioanal. Chem. 2002, 372, 41-42. (2) Willner, I.; Willner, B.; Katz, E. Rev. Mol. Biotechnol. 2002, 82, 325-355. (3) Lemieux, B.; Aharoni, A.; Schena, M. Mol. Breed. 1998, 4, 277289. (4) Cheung, V. G.; Morley, M.; Aguilar, F.; Massimi, A.; Kucherlapati, R.; Childs, G. Nat. Genet., Suppl. 1999, 21, 15-19. (5) Wink, T.; Zuilen, S. J.; Bult, A.; van Bennekom, W. P. Analyst 1997, 122, 43R-50R. (6) Wang, J. Chem. Eur. J. 1999, 5, 1681-1685. (7) Hartwich, G.; Caruana, D. J.; de Lumley-Woodyear, T.; Wu, Y.; Campbell, C. N.; Heller, A. J. Am. Chem. Soc. 1999, 121, 10803-10812. (8) Strother, T.; Cai, W.; Zhao, X. S.; Hamers, R. J.; Smith, L. M. J. Am. Chem. Soc. 2000, 122, 1205-1209. (9) Singhal, P.; Kuhr, W. G. Anal. Chem. 1997, 69, 4828-4832. (10) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Anal. Chem. 1998, 70, 4670-4677. (11) Herne, T. M.; Tarlov, M. J. J. Am. Chem. Soc. 1997, 119, 89168920. (12) Csa´ki, A.; Mo¨ller, R.; Straube, W.; Ko¨hler, J. M.; Fritzsche, W. Nucl. Acids Res. 2001, 29, e81. (13) Caruso, F.; Rodda, E.; Furlong, D. N. Anal. Chem. 1997, 69, 2043-2049. (14) Demers, L. M.; Mirkin, C. A.; Mucic, R. C.; Reynolds, R. A., III; Letsinger, R. L.; Elghanian, R.; Viswanadham, G. Anal. Chem. 2000, 72, 5535-5541. (15) Mourougou-Candoni, N.; Naud, C.; Thibaudau, F. Langmuir 2003, 19, 682-686.

also demonstrated the ability to perform enzymatic manipulations on DNA, such as polymerase chain reaction, DNA ligation, and restriction enzyme digestion, on a surface platform.16-21 When binding to gold surfaces is desired, the DNA is modified at one of its ends with a thiol group that possesses an intrinsically high affinity to gold surfaces.5,22,23 The challenge is to connect the DNA solely via the thiol group while keeping the DNA molecule itself oriented above the surface, available for chemical modifications. That is, the desire is to reduce as much as possible nonspecific interactions of the bases and phosphates of the DNA to the gold. In this ideal scenario, most of the DNA molecules should be prone to hybridization. Two factors have been shown to increase hybridization efficiency by controlling the conformation of the DNA on the gold surface: extension of the linker connecting between the thiol group and the DNA,24 and increasing the length of the DNA oligo adsorbed to the surface.25,26 Tarlov et al.11,27,28 developed a widely used scheme to diminish nonspecific interactions by adsorbing short alkylthiol chains (mercaptohexanol, MCH) after the adsorption of a short DNA oligo has been completed. The (16) Gerry, N. P.; Witowski, N. E.; Day, J.; Hammer, R. P.; Barany, G.; Barany, F. J. Mol. Biol. 1999, 292, 251-262. (17) Kim, J. H.; Hong, J.-A.; Yoon, M.; Yoon, M. Y.; Jeong, H.-S.; Hwang, H. J. J. Biotechnol. 2002, 96, 213-221. (18) Pen˜a, S. R. N.; Raina, S.; Goodrich, G. P.; Fedroff, N. V.; Keating, C. D. J. Am. Chem. Soc. 2002, 124, 7314-7323. (19) Frutos, A. G.; Smith, L. M.; Corn, R. M. J. Am. Chem. Soc. 1998, 120, 10277-10282. (20) Bamdad, C. Biophys. J. 1998, 75, 1997-2003. (21) O’Brien, J. C.; Stickney, J. T.; Porter, M. D. J. Am. Chem. Soc. 2000, 122, 5004-5005. (22) Hegner, M.; Wagner, P.; Semenza, G. FEBS Lett. 1993, 336, 452-456. (23) Medalia, O.; Englander, J.; Gucenberger, R.; Sperling, J. Ultramicroscopy 2002, 90, 103-112. (24) Shchepinov, M. S.; Case-Green, S. C.; Southern, E. M. Nucl. Acids Res. 1997, 25, 1155-1161. (25) Southern, E.; Mir, K.; Shchepinov, M. Nat. Genet., Suppl. 1999, 21, 5-9. (26) Steel, A. B.; Levicky, R. L.; Herne, T. M.; Tarlov, M. J. Biophys. J. 2000, 79, 975-981. (27) Levicky, R.; Herne, T. M.; Tarlov, M. J.; Satija, S. K. J. Am. Chem. Soc. 1998, 120, 9787-9792. (28) Petrovykh, D. Y.; Kimura-Suda, H.; Whitman, L. J.; Tarlov, M. J. J. Am. Chem. Soc. 2003, 125, 5219-5226.

10.1021/la035116y CCC: $25.00 © 2003 American Chemical Society Published on Web 11/08/2003

10574

Langmuir, Vol. 19, No. 25, 2003

MCH molecules compete with the weaker nonspecific interactions, while keeping the covalent bond between the thiol at the end of the DNA to the gold. In addition to extending the conformation of the DNA molecule away from the gold surface, this latter MCH treatment blocks the surface and prevents the target molecules from binding nonspecifically to the surface, thereby increasing the selectivity of hybridization. Furthermore, increasing the spacing between the probe DNA molecules on the surface increases the accessibility of target molecule to the surface probes. Controlling the conformation of long double-stranded DNA molecules (on the order of hundreds and thousands of base pairs or more) on surfaces is a much greater challenge. Linker extension and MCH posttreatment, the two approaches that have been utilized to change the orientation of short single-stranded DNA (ssDNA) on surfaces, are not likely to be suitable for orienting long DNA. Extending the length of the linker connecting between the thiol and the DNA should have a negligible effect when dealing with DNA on the order of hundreds of base-pairs. In addition, a longer linker may serve as an insulating barrier rendering the DNA unsuitable for electrical measurements. MCH treatment may not be able to compete with a large number of nonspecific cooperative interactions. In addition, this posttreatment does not affect the initial distribution of DNA molecules on the surface, but merely their orientation. Therefore long DNA molecules adsorbed on bare gold surfaces may be close packed and entangled. An additional approach that has been shown to control surface coverage and orientation of short ssDNA molecules employs pretreatment of the gold surface in order to decrease gold reactivity. In this approach either a complete monolayer was formed such that the DNA is attached to this monolayer with no contact to the gold29 or, as shown in one study,30 the gold could be covered with a mixed self-assembled monolayer of two alkylthiols differing in their lengths such that selective desorption of the short alkylthiol created holes in the monolayer. Following this selective desorption process, single-stranded DNA could then be adsorbed in the exposed regions of the gold surface. By monitoring hybridization of a complementary DNA strand by quartz crystal microbalance (QCM), it was shown that this pretreatment of the gold surface with the alkylthiol monolayer increased the hybridization efficiency as compared to hybridization on bare gold surfaces. We envisioned that this approach of treating gold surfaces with alkylthiol monolayers prior to DNA adsorption would be ideal for adsorptions of long double-stranded DNA, especially for the purpose of electrical measurements. We have therefore developed a simple method to prepare gold surfaces covered with alkylthiol monolayers prone to DNA adsorption, avoiding the desorption step included in the original method. We characterized the formation of this monolayer and determined its ability to achieve selective adsorption of either short or long thiolated DNA by sensitive and quantitative radioactive measurements. Most importantly we show that our simple two-step adsorption process not only increases the specificity of DNA adsorption but also increases dramatically the efficiency of enzymatic DNA ligation on the surface. Experimental Section Substrate Preparation. Polished n-type single crystal (111) silicon wafers (Motorola, 10-15 Ω/cm2 resistance) were scribed (29) Huang, E.; Zhou, F.; Deng, L. Langmuir 2000, 16, 3272-3280. (30) Satjapipat, M.; Sanedrin, R.; Zhou, F. Langmuir 2001, 17, 76377644.

Aqua et al. on the backside with a diamond pen into 1 × 1 cm squares. They were then cleaned in a plasma asher (March, plasmod) for 5 min in an atmosphere of oxygen and argon, at a frequency of 100 Hz. Immediately after being cleaned, the wafers were placed in an electron beam evaporator (Edwards, Auto 306, Turbo) equipped with a thickness monitor (Edwards FTM7). The deposition was carried out at a base pressure of 5 × 10-6 mbar. A 5 nm chromium layer was deposited at a rate of 0.6-0.7 nm/s, and then a 200 nm gold layer was deposited at a deposition rate of 0.6-0.7 nm/s. The wafers were broken into 1 × 1 cm samples. The gold samples were cleaned using a published protocol.31 Briefly, slides were placed for 20 min in an ultraviolet ozone cleaner (Uvocs, model no. T10X10/OES/E), and then immersed for 20 min in absolute ethanol (Merck). Finally, they were rinsed with ethanol and were immersed immediately in the adsorption solution. DNA Preparations. A. Long DNA. A 940 base pairs (bp) long double-stranded (ds) DNA molecule (∼320 nm) was prepared using the polymerase chain reaction (PCR) methodology. Primer 1 (5′-GAAGGGGCGATCGCCGCGGGCC) and Primer 2 (5′GTCGTGTCTTACCGGGTTGG) (each at 1 µM) were incubated with 0.8 ng/µL plasmid pUC18, serving as a template. The reaction, containing 200 µM dNTPs in Taq polymerase reaction buffer (New England Biolabs) was initiated by the addition of Taq polymerase (0.02 u/µL, New England Biolabs). Each 50 µL reaction was placed in a PCR machine (Eppendorf) and incubated for 2 min at 94 °C. The DNA was then amplified by repeating the cycle 25 times: denaturation of 30 s at 94 °C, annealing for 30 s at 50 °C, extension for 1 min at 74 °C, followed by a 5 min extension at 74 °C. Typically 12 PCR reactions were combined, the DNA was precipitated, and the pellet was resuspended in a small volume and loaded on a preperative 1% agarose in order to resolve the desired 940 bp fragment from remaining template molecules and nonspecific PCR products. The desired fragment was extracted from the gel using Qiaquick gel extraction kit (Qiagen). DNA concentration was determined by absorbance measurements at 260 nm. For the preparation of thiolated DNA, the PCR primers were simply replaced with identical primers having C6 thiol linkers (Sigma Genosys) at their 5′ end. B. Short DNA. A 26 nucleotides (nt) long DNA oligomer (oligo I 5′-CATTAATGCTATGCAGAAAATCTTAG) was incubated with its 29 complementary oligomer (oligo II 5′-CTAAGATTTTCTGCATAGCATTAATGAGG) in 25 mM Tris-HCl pH 7.5, 400 mM NaCl. The mixture was incubated at 80 °C for 10 min, after which the reaction was cooled slowly to room temperature. The resulting double-strand DNA has a “sticky” structure in which 26 nt are fully hybridized while 3 nt at the 3′ end of oligo II are left unhybridized. This nonpalindromic sticky overhang possesses the same sequence as the overhang produced by the restriction enzyme PflMI. When thiolated short DNA was required, the same procedure was followed using oligo I with a C3 thiol linker (MetaBion) at its 3′ end. The molar ratio between the thiolated oligo I and oligo II in the hybridization mixture was 1:1.1 to ensure that no thiolated oligo remained as a single strand. Reduction of Thiolated DNA. Short and long thiolated DNA were kept in their oxidized form - (CH2)3-S-S-(CH2)3-OH in order to protect the thiol group from undesired oxidation products or dimerization. Prior to adsorption, the amount of DNA needed for adsorption was incubated with 10 mM of the reducing agent tris(2-carboxyethyl) phosphine (TCEP) in 100 mM Tris-HCl pH 7.5. The mixture was incubated at room temperature for several hours to allow for complete reduction of the disulfide bond. The short or long DNA samples were then loaded on either a BioSpin 6 or BioSpin 30 (Bio Rad), respectively, equilibrated in the adsorption buffer (25mM Tris-HCl pH 7.5, 400 mM NaCl). The high molecular weight DNA molecules were collected in the flow through in adsorption buffer, while small molecular weight species (TCEP and the reduction product HS-(CH2)-OH, the latter may compete with the DNA for binding to the gold) were captured on the spin columns. The flow-through samples were spotted immediately on the clean gold slides. Preparation of Radioactively Labeled DNA. A. Long DNA. The 940 bp fragment was radioactively labeled by (31) Ron, H.; Matlis, S.; Rubinstein, I. Langmuir 1998, 14, 11161121.

Adsorption and Reactivity of DNA performing a PCR reaction identical to that described above, except that 7.5 µL of R-32P-dCTP (3000 Ci/mmol, NEN) was added to the reaction mixture. Purification of the DNA proceeded through the same steps as nonradioactive DNA, except that prior to loading on the agarose preperative gel, the PCR reaction was purified on a Qiaquick column (Qiagen) to get rid of unincorporated R-32P-dCTP. A few picomoles of this radiolabeled DNA was combined with 2 nmol of the nonlabeled DNA. In this way, the exact concentration of the radioactively labeled DNA does not need to be determined precisely since its amount is negligible compared to the unlabeled DNA. This latter concentration is used in the specific activity calculations (see below). The same procedure was used for the preparation of radiolabeled sticky long DNA used in the ligation experiment (see above). B. Short DNA. To radioactively label the short ds DNA, 200 pmol of oligo I (above) was incubated with 15 units of the enzyme polynucleotide kinase (New England Biolab),12 pmol γ-32P-ATP (3000 Ci/mmol, NEN), 10 mM MgCl2, and 70 mM Tris-HCl pH 7.6, but lacking DTT to prevent thiol reduction. After an incubation of 30 min at 37 °C, the enzyme was heat inactivated for 10 min at 70 °C. The sample was then loaded on a Bio Spin 6 column (Bio Rad) to remove any unincorporated γ-32P-ATP. Purified radiolabeled oligo I was then combined with 5000 pmol of unlabeled oligo I. In this way, the efficiency of the 5′ end labeling reaction and any loses of oligo on the Bio Spin column do not have to be determined since they are all negligible compared to the concentration of the unlabeled oligo. The concentration of the latter (which is known precisely) is then used to calculate the specific activity of the samples (see below). Radiolabeled oligo I was hybridized with oligo II as described for the nonradioactive DNA preparation above. Again, the ratio of radiolabeled oligo I (either thiolated or nonthiolated) to oligo II in the hybridization reaction was 1:1.1 to ensure that all of the radiolabeled oligo is hybridized. The efficiency of hybridization was determined by resolving samples of the single-stranded radiolabeled oligo I and the ds (radiolabeled oligo I hybridized to nonlabeled oligo II) on a 12% polyacrylamide gel in 1x TBE buffer under nondenaturing conditions. Under these conditions the migration of oligo I is retarded when it is hybridized to oligo II. In this approach we determined that 100% of oligo I was hybridized to oligo II (data not shown). Alkylthiol Adsorption. Self-assembled layers of C18-SH (Aldrich) were prepared by immersing the cleaned gold samples in a 0.1 mM solution of C18-SH in ethanol at room temperature for different lengths of time: 0 min, 0.5 min, 1 min, 5 min, 10 min, and overnight. After adsorption, the samples were rinsed with ethanol and dried with nitrogen. DNA Adsorption. We developed a closed adsorption chamber by cutting out Parafilm pieces the size of the gold slides (1 × 1 cm). A slightly smaller square was then cut out of the Parafilm, and the piece was then placed on top of the clean gold slides, covered to different extents with C18-SH. Ten microliter aliquots of each DNA solution were spotted in the center of the Parafilm frame on each gold slide (either bare or blocked by C18-SH, see above). A second gold slide with similar dimensions was then put on top of the DNA drop. This process ensured that even on hydrophobic slides the DNA sample was spread evenly in the entire area of the Parafilm frame due to the weight of the top gold slide. In addition, the Parafilm diminished sample dryness. The two gold slides in this setup were placed in a sealed Petri dish, with humidity, to avoid dryness. After overnight adsorption at room temperature each slide was rinsed in 2 mL of 0.4 M NaCl/25 mM Tris-HCl, pH 7.5, to wash away excess DNA. The slide was then soaked in 2 mL of the same buffer while shaking for 15 min. This wash was then followed by soaking for 15 min in 0.2 M NaCl/25 mM Tris-HCl, pH 7.5, followed by a quick rinse in water to remove remaining salts while avoiding denaturation of the short ds DNA. The slides were then dried (either by a stream of N2 for nonradioacive DNA or in air for radioactive DNA, see below). Monolayer Characterization. Contact angle measurements were carried out using an NRL C.A. goniometer (model no. 10000) and were preformed with water as the liquid wetting the surfaces. Ellipsometric measurements were carried out before adsorption and after every step of adsorption. A Rudolph Research

Langmuir, Vol. 19, No. 25, 2003 10575 Auto-EL 4 ellipsometer with tungsten-halogen light source was used, at an angle of incidence Φ ) 70° and a wavelength λ ) 632.8 nm. Measurements were done at four different points. The thickness of the films was calculated under the assumptions that the films are transparent at 632.8 nm and that the film refractive indices are nf ) 1.50 and kf ) 0. Gold slides adsorbed with radioactive DNA were covered with paper and exposed to a phosphorimaging screen (Fuji). After the appropriate time of exposure, the screen was imaged by a phosphorimage scanner (BAS-2500, Fuji). The amount of pixels at a certain area on each slide was determined using the software Image Gauge, Fuji. The number of pixels per area was converted to the number of picomoles per area using the specific activity. The specific activity of each DNA sample is defined as the amount of radiation produced by a mole of that DNA. This number was determined empirically by spotting 1 µL samples of radioactive DNA with a known concentration on a gold slide. The samples were allowed to air-dry without any washing, followed by phosphorimaging. The amount of pixels at each spot was divided by the amount of picomoles spotted, yielding the specific activity of the samples. This value already takes into account gold enhancement/quenching. DNA Ligations. A 945 bp long DNA fragment was produced by PCR using primers 5′ GTAATGCTCTGCCAGTGTTAC or 5′ GATTATCAATACCATATTTTTGGAAAAGCC as the upstream primer, each with the downstream primer 5′ CTCTGATGTTACATTGCACAAG. Primers were each at 1 µM, and the plasmid SKSL, a derivative of pBlue script II SK(+), stratagene, at 1 ng/µL served as the template. The DNA was amplified by using the same PCR cycles as described above for the preparation of the long DNA. The PCR reaction was purified on a Qiaquick PCR purification column (Qiagen) followed by cleavage with either the restriction enzyme PflMI or BstXI (both from New England Biolabs). Complete cleavage by PflMI produces two fragments: 786 bp and 159 bp long. The 786 bp fragment was purified from a preparative agarose gel, since its overhang is complementary to the overhang of the short sticky DNA. The restriction site for BstXI was designed to be in the PCR primer close to the end of the fragment. After cleavage, the long PCR was also purified from the gel. Each purified DNA (20 nM) was combined with T4 DNA ligase (600/µL units, New England Biolabs) in ligase reaction buffer lacking DTT, 1 mM ATP, and a negligible amount of radioactive DNA that had been produced following the same above steps only with R-32P-dCTP included in the PCR reaction. Since PflMI and BstXI recognize nonpalindromic DNA sequences, they produce overhangs that are nonself-complementary. Therefore, no self-ligation can take place in the reaction mixture. A 20 µL sample of this ligation mixture was placed on gold slides preadsorbed with the short sticky DNA. After overnight incubation, the slides were washed as described above and quantified by phosphorimaging.

Results The Specificity of Long DNA Adsorption on Gold Surfaces. Controlling the orientation, distribution, and covalent attachment of long DNA molecules on gold surfaces is a technical challenge. Long double-strand DNA molecules contain a large number of phosphate groups (double the number of base pairs per molecule) that can interact with the surface. In addition, local denaturation of regions of the DNA may expose the bases, making them available for surface interactions.32,33 Since the phosphates and bases are part of a polymeric chain, they bind cooperatively to the surface. Therefore these strong cooperative nonspecific interactions dominate surface adsorption. We have formulated an adsorption scheme that would allow us to obtain better control over the positioning of long DNA molecules containing thiol end groups on gold (32) Zhang, R.-Y.; Pang, D.-W.; Zhang, Z.-L.; Yan, J.-W.; Yao, J.-L.; Tian, Z.-Q.; Mao, B.-W.; Sun, S.-G. J. Phys. Chem. B 2002, 106, 1123311239. (33) Michalet, X. Nano Lett. 2001, 1, 341-343.

10576

Langmuir, Vol. 19, No. 25, 2003

Aqua et al.

Figure 1. Schematic representation of the adsorption process: (A) bare gold; (B) DNA adsorption on bare gold surface; (C) alkylthiol blocking gold surface; (D) DNA adsorption on a blocked gold surface.

surfaces. The DNA molecule used in our adsorption scheme was a 940 bp long DNA PCR fragment containing C6-SH linker at each 5′ end of the DNA (experimental). The specificity of adsorption was evaluated by comparing the adsorption of this thiolated DNA fragment to an identical DNA molecule lacking the thiol linkers. Our adsorption strategy (outlined in Figure 1) was to cover the gold surfaces with C18-SH molecules that are known to form self-assembled monolayers on gold surfaces.34 This coverage should diminish the reactivity of the gold slides such that the strong binding thiol group would dominate the binding. To that end, some exposed regions on the gold surface should be left available for thiol binding (Figure 1C). Previously it was shown that at a concentration range of 0.1 mM C18-SH and short immersion times, the formed C18-SH monolayers have pinholes whose sizes and distances between them are dependent on the immersion time in the C18-SH solution.35,36 On the basis of this initial report, we have determined the ideal coverage conditions that would subsequently lead to the most thiol-specific DNA adsorption. This was achieved by varying the adsorption time. Figure 2A shows that the average contact angle of the C18-SH layer increased with blocking time until it reached saturation. The value obtained even at the long blocking time was only 93°, suggesting that an incomplete monolayer was formed. The same samples whose contact angles were measured (Figure 2A) were also analyzed by ellipsometry. Figure 2B shows that the average thickness of the C18-SH layer increased with blocking time until it reached saturation. This is an indication that the amount of C18-SH adsorbed on the surface increased. The value obtained at saturation (20 Å, Figure 2B) suggests that a fairly complete monolayer was formed. Each slide that had undergone contact angle and ellipsometry characterization was subsequently subjected to adsorption of either the thiolated or nonthiolated 940 bp long DNA fragment. Following that, contact angle and ellipsometry measurements were again carried out. As can be seen in Figure 2A the contact angle of the organic layer (DNA together with C18-SH) was lower with respect to the initial C18-SH layer for each blocking time, whether the DNA was thiolated or nonthiolated, indicating that indeed the hydrophilic DNA was adsorbed on the surface. (34) Ulman A. An Introduction to ultrathin organic films from langmuir-blodgett to self-assembly; Academic press: San Diego, 1991. (35) Diao, P.; Guo, M.; Tong, R. J. Electroanal. Chem. 2001, 495, 98-105. (36) Xu, S.; Cruchon-Dupeyrat, S. J. N.; Garno, J. C.; Liu, G.-Y. J. Chem. Phys. 1998, 108, 5002-5012.

Figure 2. Long DNA: (A) contact angle vs blocking time; (B) average thickness vs blocking time. The squares represent the measurements on the C18-SH layer, and the dots and the triangles represent the average thickness of C18-SH together with thiolated with nonthiolated long DNA layer, respectively.

As the blocking time increased, the contact angle of the organic layer in both cases (thiolated and nonthiolated long DNA) increased. Namely, less DNA adsorbed on the surface. Interestingly, when the nonthiolated DNA was adsorbed on the mostly blocked surface (Figure 2A), almost no difference in the value of the contact angle before and after DNA adsorption could be detected. This suggests that nonthiolated long DNA molecules were barely adsorbed. Ellipsometry analysis confirmed the contact angle characterization by showing that the averaged thickness of the layer on the gold surface increased following DNA adsorption (Figure 2B). The total thickness of the organic layer decreased with blocking time, implying that fewer DNA molecules were adsorbed on the surface as the blocking time increased. These measurements were also consistent with the contact angle results for nonthiolated DNA, showing little difference in thickness before and after DNA adsorption when the gold was blocked effectively (Figure 2B). The average thickness of the thiolated long DNA layer on bare gold was 16 ( 1 Å (Figure 2B). A similar value was obtain for the nonthiolated long DNA layer on bare gold (13 ( 1 Å, Figure 2B). These values are consistent with an incomplete layer of doublestranded DNA (whose theoretical diameter is 20 Å) lying on the surface. A close examination of the ellipsometry measurements revealed a different pattern of adsorption between the thiolated and nonthiolated DNA. For short blocking times (t e 1 min) there was no significant difference between the apparent thickness of the organic layer in the case of the thiolated and the nonthiolated DNA. However, at longer blocking times, the average thickness of the thiolated DNA was found to be significantly greater than that of the nonthiolated DNA. Hence, for these levels of blocking of the gold surface, nonspecific adsorption was

Adsorption and Reactivity of DNA

Langmuir, Vol. 19, No. 25, 2003 10577

Figure 3. Long DNA. Number of molecules per unit area (pmol/ mm2) vs blocking time. The gray and black bars represent the thiolated and nonthiolated long DNA, respectively.

by far less effective than the specific adsorption. This trend could not be observed by the contact angle analysis (Figure 2A), where the contact angle values of the thiolated and nonthiolated DNA layers were almost indistinguishable. This is most likely due to the lower sensitivity of this latter analytical method. To quantify DNA adsorption with a more direct and sensitive method, radioactive DNA was prepared and its adsorption was quantified. The amount of DNA remaining on the surface was calculated using the specific activity of the DNA. As shown in Figure 3, the number of thiolated DNA molecules per unit area was almost identical to that of nonthiolated DNA on bare gold, confirming the qualitative contact and ellipsometry results. This implies that the adsorption of the long DNA on bare gold was not affected by the existence of the thiol groups. Hence, the adsorption of long DNA on bare gold is nonspecific. However, when the gold surface was blocked with C18SH, the adsorption became more specific. This can be seen by comparing the amount of thiolated and nonthiolated DNA adsorbed at each blocking time. Although the overall adsorption decreases with blocking time for both types of molecules, fewer nonthiolated than thiolated DNA adsorbed (Figure 3) indicating that the adsorption was more specific. The Specificity of Short DNA Adsorption. Our results thus far revealed that by blocking the surface by an alkylthiol layer, we can increase the specificity of adsorption of long DNA molecules. To gain more insight into the mechanism that governs this controlled binding, we investigated the same processes using short ds DNA molecules (26 bp). Figure 4 shows that the average thickness of the thiolated and nonthiolated short DNA layer on bare gold was 22 ( 2 and 12 ( 2 Å, respectively. These values are significantly different, implying that the molecules are organized differently on the surface. The marked difference between adsorptions of short and long DNA can be seen on bare gold (blocking time equals to 0). While for the long DNA specificity was observed only for blocked gold surfaces, for short DNA some specificity was detected even on bare gold (compare Figure 4 to Figure 2). In addition, for all blocking times, the amount of short DNA on the surface was not sufficient to allow characterization both by contact angle and by ellipsometry measurements, since all values, except for the bare gold, do not seem to be significantly different. A radioactive analysis demonstrated that indeed short DNA adsorbed to bare gold with some specificity (Figure 5). Here, the specificity increased as a function of blocking time in a more dramatic way than in the case of long DNA (note the logarithmic scale in Figure 5). The specificity

Figure 4. Short DNA: (A) contact angle vs blocking time; (B) average thickness vs blocking time. The squares represent the measurements on C18-SH layer, and the dots and the triangles represent the C18-SH together with thiolated and with nonthiolated short DNA layer, respectively.

Figure 5. Short DNA: Number of molecules per unit area (pmol/mm2) vs blocking time (note the logarithmic scale). The gray and black bars represent the thiolated and the nonthiolated short DNA, respectively.

ratio was calculated by dividing the number of thiolated and nonthiolated DNA molecules, as extracted from Figures 3 and 5, for long and short DNA, respectively, and plotted as a function of blocking time (Figure 6). Clearly for both long and short DNA the specificity increased with blocking time. However, the effect was much more dramatic for the short DNA. DNA Ligation on Gold Surfaces. Our results above show that a more pronounced specificity of adsorption is achieved with a short DNA molecule than with a long one. Since our initial goal was to bind specifically long DNA molecules, we decided to achieve this goal by exploiting the ability of our short DNA to be elongated by a DNA joining enzyme. That is, the specificity and therefore the orientation of the DNA could be obtained by adsorption of the short DNA on blocked surfaces, while a subsequent DNA ligation reaction could produce a long DNA

10578

Langmuir, Vol. 19, No. 25, 2003

Aqua et al.

Figure 6. Specificity of adsorption vs blocking time. Specificity is defined as the ratio between the number of adsorbed thiolated and the number of nonthiolated DNA (see text). The dots represent the short DNA, and the triangles represent the long DNA.

Figure 7. Schematic representation of the ligation process: (A) alkylthiol blocking gold surface; (B) DNA adsorption on a blocked gold surface; (C) ligation of long DNA fragment.

To demonstrate that this approach is attainable, we used the procedure outlined in Figure 7. Nonradioactive short thiolated DNA was first adsorbed on gold slides blocked with C18-SH to different extents. After the short DNA overnight adsorption, radioactively labeled long DNA was added together with T4 DNA ligase, an enzyme that can covalently bond two complementary “sticky” ends (see Experimental Section for details). This long DNA fragment contained a short overhang complementary to that of the short DNA on the surface. As a control, a long DNA fragment containing an overhang with a noncomplementary sequence was also added to gold slides that had undergone the same blocking treatment and short thiolated DNA adsorption. The radioactive analysis (Figure 8A) clearly showed that this long DNA was indeed connected to the surface via a covalent bond to the short DNA already present on the surface. This can be deduced by comparing the amount of complementary to noncomplementary DNA remaining on the surface. The attachment of the long DNA is therefore sequence dependent and cannot be attributed to nonspecific interactions. These measurements were repeated by performing ligation reactions on gold slides that had been adsorbed with nonthiolated short DNA. Here, the number of molecules ligated to the short DNA on the surface was much lower than in the case of the thiolated short DNA, for all blocking times. The low levels of ligation could be explained by the low concentration of nonthiolated short DNA on the surface. Alternatively, low levels of ligation to the short nonthiolated DNA might be due to the

Figure 8. DNA ligation. (A) Number of molecules per unit area (pmol/mm2) vs blocking time. The dotted and stripped bars represent ligation of complementary and noncomplementary DNA to thiolated short DNA, respectively. Ligation of complementary and noncomplementary DNA on nonthiolated short DNA are represented by the black and gray bars, respectively. (B) Ligation efficiency of the thiolated short DNA vs blocking time.

conformation of the DNA on the surface. That is, short DNA lacking thiol groups is most likely adsorbed to the surface horizontally, such that a ligation reaction to the “sticky” bases must be sterically less favorable. We define ligation efficiency as the number of long DNA molecules ligated (extracted from Figure 8A) divided by the number of short thiolated DNA adsorbed on the surface (extracted from Figure 5). The results of this calculation were plotted as a function of the blocking time (Figure 8B). The remarkable picture emerging is that the ligation efficiency increased with blocking time. Thus, the more specific the initial adsorption of the thiolated short DNA, the higher the ligation efficiency, that is, not only did the enzymatic reaction occur on a hydrophobic surface but also the mode by which the DNA adsorbed on the surface within the hydrophobic layer increased the reactivity of the DNA (see Discussion). Discussion Our goal in this study was to devise a strategy for binding long ds DNA molecules (on the order of several hundred base pairs) to gold surfaces specifically through the DNA’s thiolated ends, while minimizing the contribution of nonspecific binding. Our strategy was to block the surface with hydrophobic molecules that would partially repel the DNA allowing for only strong thiol-gold covalent interactions to persist. By varying immersion times and using a dilute solution of C18-SH, we were able to reach reproducible control over the extent of surface blocking by C18-SH coverage, as shown by contact angle (Figures 2A and 4A) and ellipsometry measurements (Figures 2B

Adsorption and Reactivity of DNA

and 4B). Although contact angle is not a very sensitive method, our results clearly show that it is sufficiently accurate to monitor a complex two-step adsorption. It is therefore a quick and a convenient method that can be used to monitor DNA adsorptions. It is important to note that the success of this method may be attributed to our choice of a hydrophobic C18-SH as blocking molecules. With the more commonly used MCH, which has a similar hydrophilic nature as the DNA, we were not able to monitor the two-step adsorption by contact angle. We believe that at our adsorption conditions we never obtained complete close packed C18-SH monolayer. This result is in agreement with previous characterizations of C18-SH monolayers.35,36 Our results show that the subsequent adsorption of thiolated DNA onto C18-SH monolayers does not displace the C18-SH molecules. This conclusion is based on the inverse correlation between the amounts of DNA adsorbed and the blocking time. Thus DNA most likely binds in the pinholes created in the C18SH monolayers. In fact, such DNA adsorption can be viewed as a confirmation of the existence of these pinholes and a way to characterize their extent. The radioactive measurements allowed us to quantify accurately the DNA coverage on gold. We found on bare gold ∼2.3 × 1011 molecules/cm2 of either thiolated or nonthiolated long DNA. At the maximum C18-SH blocking time we found 1.0 × 1011 thiolated and only 3.5× 1010 molecules/cm2 nonthiolated long DNA. In the case of thiolated short DNA, 4.8 × 1012 molecules/cm2 are adsorbed on bare gold. This number is in close agreement with previous publications where the DNA coverage on gold was determined.10,18,32 The number of nonthiolated short DNA adsorbed on bare gold was found to be 1.5 × 1012 molecules/cm2. At maximum blocking time the number decreased reaching 4.0 × 1010 thiolated short molecules/cm2 (a reduction of 2 orders of magnitude) and only 1.8 × 109 nonthiolated short molecules/cm2 after (a reduction of 3 orders of magnitude). Hence, the C18-SH coverage limits the adsorption of the nonthiolated short DNA more efficiently than the adsorption of the thiolated DNA. These results indicate that for short DNA the sum of the noncovalent interactions through the phosphates per molecule is weak relative to one thiol-gold bond and, therefore, the latter dominates. For long DNA, the sum of all the nonspecific interactions per molecules is greater than the thiol-gold bond. This can be explained simply by comparing the ratio between the number of base pairs (bp) to thiols per molecule, which is ∼26:1 for the short DNA and 940 bp/2 thiols ) 470 for long DNA. If the nonspecific interaction energy is proportional to the number of base pairs (i.e., phosphates), then clearly as their number decreases it is expected that the adsorption will be more specific. Another contribution to the difference in the specificity may rise from the kinetic effect resulting from the difference in residence time near the surface. It is expected that long DNA molecules would have longer residence time on the surface and therefore higher probability to rearrange so that they could adsorbed in a nonspecific way. Short DNA molecules are expected to have short residence time, and therefore the fast thiol-gold binding dominates. By utilizing our ability to form layers of short ds DNA with sticky ends, we performed a ligation reaction on these layers and connected a long DNA molecule with a complementary sticky end. This approach takes advantage of our previous results (Figure 6) showing that the highest specificity in adsorption is achieved for the short DNA, at

Langmuir, Vol. 19, No. 25, 2003 10579

all blocking times. We can therefore obtain initial specific binding by adsorption of short DNA, while later elongating it by performing a ligation reaction. Our results clearly showed that the ligation reaction itself was influenced by the C18-SH layer in that the ligation efficiency increased with blocking time (Figure 8), by more than 1 order of magnitude. It seems that the C18-SH layer reduces undesired interactions with the surface not only for the DNA but also for the enzyme. The picture emerging from our ligation reaction is that the thiolated short DNA is most likely organized on the surface in a different conformation than the nonthiolated short DNA. We suggest that the nonthiolated DNA is physisorbed on the surface whether the gold is blocked. Therefore, the ligation reaction was inefficient at all blocking times. Thiolated short DNA on bare gold may also adsorb on the surface in an orientation which is not fully perpendicular to the surface. However, when the surface is blocked with C18-SH molecules, the thiol group of the DNA is bound to the surface and the rest of the molecule is aligned almost perpendicular to the surface. In this case, the thiolated short DNA molecules are in hydrophobic surroundings. Since ligation is an enzymatic reaction that requires a hydrophilic environment, one could expect that the reactivity of the thiolated DNA would be affected. However, the results prove that the reactivity of the thiolated short DNA is not affected by the presence of the alkylthiol layer. This observation is therefore in agreement with the picture in which the alkylthiol molecules are short relative to the DNA. Hence the region of the DNA participating in the ligation is sticking above the alkylthiol and is available for ligation. It is plausible that such an approach can be used to perform hybridization reactions by adding a probe sequence complementary to the bases of the target further from the surface. Blocking of the surface has been shown previously to be an essential factor contributing to the efficiency of DNA manipulations, such as hybridization.11,26,27,30 However, our approach of using C18-SH layers to block the surface prior to DNA adsorption seems to be superior to other DNA adsorption protocols in two main aspects. Initial blocking of the surface allows control over the distribution of the DNA molecules. That is, the spacing between the DNA molecules on the surface is a key factor in controlling their reactivity. The mode by which we achieve incomplete layers of C18-SH seems to be simpler than an electrochemical desorption, and a more versatile one, i.e., any surface or device can be modified. Second, the highly hydrophobic environment in which the DNA is embedded when blocking the surface with C18-SH molecules provides ideal conditions to perform electrical measurements that are otherwise hampered by the presence of water and electrolytes. Adsorption of C18-SH after DNA adsorption would most likely result in desorption of some or all of the DNA, since C18-SH forms a much better monolayer on gold. In addition, the ethanol, which is the solvent from which the C18-SH is adsorbed, would alter the structure of the adsorbed DNA. Summary In this work, DNA molecules were adsorbed specifically on gold surfaces. The specificity of the adsorption was controlled by a novel approach, in which the gold surface was first blocked with a hydrophobic layer (C18-SH) to various extents, followed by DNA adsorption. As the coverage of C18-SH increased, fewer DNA molecules adsorbed on the surface. In the case of the long DNA, C18-SH coverage reduced the nonspecific adsorption more

10580

Langmuir, Vol. 19, No. 25, 2003

than it reduced the specific adsorption. For short DNA, even on bare gold, the thiol group dominated the adsorption. In addition, the specificity of the adsorption of the short DNA was always larger than that of the long DNA. We show that the reactivity of the thiolated short DNA was enhanced by more than one order of magnitude due to the presence of the alkylthiol layer. Hence, our DNA

Aqua et al.

adsorption approach increases both the specificity and the reactivity of the DNA. In addition, it provides an insulating environment in which electrical measurements can be preformed while biochemical reactions can still be carried out. LA035116Y