Correction to High Sensitivity Detection and Quantitation of DNA Copy

This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes.

Addition/Correction pubs.acs.org/ac

Correction to High Sensitivity Detection and Quantitation of DNA Copy Number and Single Nucleotide Variants with Single Color Droplet Digital PCR Laura Miotke, Billy T. Lau, Rowza T. Rumma, and Hanlee P. Ji* Anal. Chem. 2014, 86, 2618−2624. DOI: 10.1021/ac403843j In Table 1. Primer Sequences in the original manuscript, the second row is FLT3 66 GGGATAGGACTCCTGGGTTT GTGAGCAGCCTGCATTACCT It should instead be FLT3 66 GGGATAGGACTCCTGGGTTT ACTCAAGTGTTGGCATGCTG

© XXXX American Chemical Society

A

DOI: 10.1021/acs.analchem.5b00061 Anal. Chem. XXXX, XXX, XXX−XXX