Covalent Conjugation of Peptide Antigen to Mesoporous Silica Rods

Dec 11, 2017 - ABSTRACT: Short peptides are the minimal modality of antigen recognized by cellular immunity and are therefore considered a safe and hi...
47 downloads 10 Views 4MB Size
Download PDF
Article pubs.acs.org/bc

Cite This: Bioconjugate Chem. XXXX, XXX, XXX−XXX

Covalent Conjugation of Peptide Antigen to Mesoporous Silica Rods to Enhance Cellular Responses Maxence O. Dellacherie,*,#,†,‡ Aileen W. Li,#,†,‡ Beverly Y. Lu,†,‡ and David J. Mooney†,‡ †

John A Paulson School of Engineering and Applied Sciences, Harvard University, Cambridge, Massachusetts 02138, United States Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts 02115, United States

‡

S Supporting Information *

ABSTRACT: Short peptides are the minimal modality of antigen recognized by cellular immunity and are therefore considered a safe and highly specific source of antigen for vaccination. Nevertheless, successful peptide immunotherapy is limited by the short half-life of peptide antigens in vivo as well as their weak immunogenicity. We recently reported a vaccine strategy based on dendritic cell-recruiting Mesoporous Silica Rod (MSR) scaffolds to enhance T-cell responses against subunit antigen. In this study, we investigated the effect of covalently conjugating peptide antigens to MSRs to increase their retention in the scaffolds. Using both stable thioether and reducible disulfide linkages, peptide conjugation greatly increased peptide loading compared to passive adsorption. In vitro, Bone Marrow derived Dendritic Cells (BMDCs) could present Ovalbumin (OVA)-derived peptides conjugated to MSRs and induce antigen-specific T-cell proliferation. Stable conjugation decreased presentation in vitro while reducible conjugation maintained levels of presentation as high as soluble peptide. Compared to soluble peptide, in vitro, expansion of OT-II T-cells was not affected by adsorption or stable conjugation to MSRs but was enhanced with reversible conjugation to MSRs. Both conjugation schemes increased peptide residence time in MSR scaffolds in vivo compared to standard bolus injections or a simple adsorption method. When MSR scaffolds loaded with GM-CSF and CpG-ODN were injected subcutaneously, recruited dendritic cells could present antigen in situ with the stable conjugation increasing presentation capacity. Overall, this simple conjugation approach could serve as a versatile platform to efficiently incorporate peptide antigens in MSR vaccines and potentiate cellular responses.

■

also likely required to induce protective immunity.11,12 This is particularly important for therapeutic cancer vaccines where target cells are heterogeneous and capable of immune evasion.13,14 An ideal vaccine should thus be able to reliably incorporate multiple peptides with different physicochemical properties. Overall, the success of peptide-based immunotherapy likely will depend on improved delivery and enhanced adjuvanticity. Engineered biomaterial systems that can controllably deliver antigens and adjuvants to APCs have shown great potential to stimulate adaptive immunity.15−19 Biomaterials-based scaffolds that locally recruit host dendritic cells (DCs) are promising platforms for in situ delivery of antigen in an immunogenic context.20,21 We’ve recently described an injectable scaffold vaccine consisting of mesoporous silica microrods (MSRs).22 Following subcutaneous injection, the random stacking of high aspect ratio MSRs promoted the assembly of a 3D environment. The macropores formed by the spaces between individual microrods enabled immune cell infiltration and interaction with the material.

INTRODUCTION Vaccination seeks to stimulate the adaptive immune system to protect the host against harmful pathogens or uncontrolled tumor masses. Strong and persistent CD8 and CD4 T-cell responses are especially important to exert this protective effect. T-cells recognize antigen in the form of small peptides on MHC molecules at the surface of antigen-presenting cells (APCs).1,2 Because short peptide epitopes only activate specific T-cell clones, they offer a unique safety profile compared to other antigen sources. For example, live-attenuated vaccines pose the risk of reversing to virulence following strain mutation.3 Irradiated cells and tumor lysate have been used in cancer vaccines to provide a variety of tumor antigens.4−7 However, these formulations also contain self-antigens which can promote the development of autoimmunity.8,9 Whole protein antigens can circumvent these safety issues but their production using recombinant technology can be cumbersome and require optimization for every antigen.10 Small peptides can be chemically synthesized rapidly, making them easy to produce on a large scale. In addition, synthetic peptides have good chemical stability, facilitating handling and storage.2 Despite their advantages, peptide antigens typically generate weak cellular responses.2,11 This is likely due to their short halflife in vivo and inability to stimulate “danger” innate immune pathways in APCs. Vaccination against multiple peptide epitopes is © XXXX American Chemical Society

Special Issue: Bioconjugate Materials in Vaccines and Immunotherapies Received: October 26, 2017 Revised: December 11, 2017

A

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry The large surface area of mesoporous silica can be used to adsorb and release immunomodulatory biomolecules.23,24 GM-CSF and CpG-loaded MSRs scaffolds were demonstrated to recruit and activate large numbers of host dendritic cells and greatly improved cellular responses against a model protein antigen.22 Here, we explored the use of covalent conjugation to improve loading and retention of peptides on MSRs. Specifically, we used stable thioeter and reversible disulfide linkages to conjugate model CD4 and CD8 OVA peptides to the MSRs. To explore if these coupling strategies could be feasible in a vaccine context, we used Bone Marrow derived Dendritic Cells (BMDCs) to probe the effect of peptide conjugation on antigen presentation and T-cell proliferation.

■

RESULTS AND DISCUSSION Peptide Conjugation onto Mesoporous Silica Rods (MSRs). To covalently conjugate antigen peptide to MSRs, amine (NH2) to sulfhydryl (SH) chemistry was utilized. The general conjugation schemes are described in Figure 1. MSRs were synthesized and modified with 3-aminopropylethoxysilane (APTES) using methods we described previously.23,25 Mesoporous Silica Rods were high aspect ratio particles of 88 μm × 4.5 μm in average23 with aligned and opened mesopores between 8 and 14 nm in diameter.23,25 The extent of modification was assessed with fluorescamine, and the amine-modified MSRs (NH2-MSRs) had 0.13 μmol of APTES per mg of MSRs (Figure S1).25 These NH2-MSRs were used for subsequent peptide conjugation. Model peptides consisting of ovalbumin-derived minimal CD8 (OVA257−264) and CD4 (OVA323−339) epitopes with an extra cysteine at the N-terminus (COVA257−264 and COVA323−339) (Figure 2), to provide reactive sulfhydryl groups, were synthesized and combined with the MSRs. A bifunctional succinimidyl 4-(Nmaleimidomethyl)cyclohexane-1-carboxylate (SMCC) cross-linker was utilized to stably and efficiently conjugate COVA257−264 (103 ± 21%) and COVA323−339 (96 ± 15%) to the MSRs. A similarly high efficiency of conjugation was noted via disulfide bonds (SPDP) for both COVA257−264 (78 ± 4%) and COVA323−339 (80 ± 2%). In contrast, only 29.2 ± 0.1% (COVA257−264) and 36 ± 3%

Figure 2. Characterization of efficiency of OVA peptide conjugation to MSRs. (a) Name and sequence of ovalbumin-derived peptides used for conjugation. (b) Conjugation efficiencies of OVA peptides (left), and adsorption efficiency (right) on MSRs. Data represents mean and SD (n = 3). One-way ANOVA with post-hoc Tukey’s multiple comparisons test. *, p < 0.05; ***, p < 0.001; ***, p < 0.0001.

(COVA323−339) of loaded peptide was retained on MSRs with passive adsorption. Interestingly, with decreasing ratios of NH2 groups available on MSRs to the quantity of peptide, the conjugation efficiency of COVA357−364 peptide (via SMCC cross-linker) did not decrease for -NH2 to -SH molar ratios down to 1.28 (Figure S3). In comparison, ∼50 nmol of peptide could be conjugated to 500 μg MSRs (Figure S3) while only ∼18 nmol effectively adsorbed to 2.5 mg MSRs (Figure 2). This represents

Figure 1. Schematics of peptide conjugation to Mesoporous Silica Rods (MSRs). Peptide are directly loaded on the surface of unmodified MSRs through passive adsorption (1) or covalently conjugated (2),(3). For covalent conjugation, the surface of Mesoporous Silica Rods (OH-MSR) is first modified with amine using aminopropylethoxysilane (APTES). Amine modified MSRs (NH2-MSRs) are then functionalized with amine-reactive cross-linkers Sulfo-SMCC or LC-SPDP to yield maleimide-activated MSRs or pyridyldithiol-activated MSRs, respectively. Cysteine containing peptides (SH-peptide) are covalently conjugated to sulfhydryl-reactive MSRs via stable (2) or reducible bonds (3). B

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry

presentation. To confirm that a reducing environment releases SPDP-conjugated peptide from MSRs, the conjugates were treated with a reducing agent and the supernatant exposed to BMDCs. The supernatant from SPDP but not SMCC coupled peptides led to BMDC presentation of the peptide, as expected (Figure 3b). Fluorescence microscopy showed that soluble Rhodamine-labeled COVA257−264 could be seen in the cytosol of BMDCs after only 1 h incubation (Figure 4). Conversely, when the peptide was SPDP-conjugated to MSRs, cytosolic peptide could not be detected at this time and fluorescence was confined to the particles. However, after 12 h, both MSRassociated and MSR-free fluorescence was seen in the cytosol of BMDCs. Likely, the reductive environment of the early endosome triggers peptide release following SPDP-particle uptake making it available for loading onto MHC I.29 Together, these findings indicate that SPDP-MSRs potentiate antigen presentation and that the effect is mediated by the intracellular reducing environment. The finding that reducible conjugation to MSR improves antigen presentation agrees with other studies where disulfide linkage of antigen to a material carrier improved presentation by DCs.30,31 T-Cell Expansion Induced by Peptide Conjugation to MSRs. Next, peptide-MSR conjugates were tested for their ability to induce T-cell expansion in vitro. MHC II restricted COVA323−339 peptide was coupled to MSRs, and the division of

about 14-fold more peptide/particle mass than results from adsorption. The ability of covalent conjugation to efficiently incorporate various peptide antigens could be particularly important for cancer vaccines that use tumor-specific peptides as an antigen source. The sequences of those neoantigens need to be tailored to the tumor mutatome of each patient,26 which results in pools of peptide candidates with variable physicochemical properties. Protein and peptide adsorption to silica is highly dependent on their net charge and hydrophobicity,27,28 but the use of covalent schemes described here could help increase the breadth of peptides that can be controllably and efficiently incorporated in this vaccine platform. Peptide Presentation by Bone Marrow-Derived Dendritic Cells. To investigate if peptide antigen covalently conjugated to MSRs could be presented by dendritic cells, the MHC I restricted COVA257−264 peptide was conjugated to MSRs, and MSRs were cultured with BMDCs. MSR-conjugated COVA257−264 was presented by BMDCs (Figure 3), but SMCC conjugation significantly decreased its presentation relative to that of soluble peptide. In contrast, SPDP-MSR formulations maintained high presentation levels even at low peptide doses. Although reduced, presentation of stably conjugated peptide was not fully abrogated. Stable thioether linkages induced by SMCC cross-linkers can be partially cleaved by thiol exchange.32,33 Therefore, partial degradation of the linker is likely to allow peptide release and

Figure 3. Effect of covalent conjugation on antigen presentation. (a) Percent of CD11c+ cells presenting SIINFEKL on H2Kb after incubation of BMDCs for 18 h with 100 nM (left) or 10 nM (right) MHC I COVA257−264 peptide in soluble form (Soluble), adsorbed on MSRs (ADS), stably conjugated to MSRs (SMCC), or coupled via reducible conjugation (SPDP). (b) Percent of CD11c+ cells presenting SIINFEKL on H-2Kb after incubation of BMDCs for 18 h with 50 nM MHC I COVA257−264 peptide in soluble form (Soluble), conjugated to MSRs (Peptide on MSRs) or the corresponding volume of supernatant from pelleted MSRs 2 h after incubation with PBS (Untreated supernatant) or reducing agent TCEP (TCEP treated supernatant). Data represents mean and SD (n = 3); **, p < 0.05; ****, p < 0.0001; ns, nonsignificant; One-Way ANOVA with Tukey’s multiple comparisons test. C

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry

Figure 4. Fluorescence microscopy of Rhodamine-labeled COVA257−264 conjugated to MSR. Left: Columns from left to right: bright field, rhodamine channel, and merged channels. Pictures show representative image of BMDCs pulsed with MSR with SPDP-conjugated Rhodamine peptide at different time points. White arrows indicate MSRs and MSR debris. Scale bar represents 20 μm. Right: Representative image of BMDCs pulsed with fluorescent peptide in soluble form (merged channels).

Figure 5. Effect of covalent conjugation on T-cell proliferation. (a) Representative flow cytometry histogram showing CFSE fluorescence of OT-II cells (gated on CD3+CD4+ cells). The blue line shows signal after 3 days of coculture with BMDCs pulsed with 100 nM MHC II COVA323−339 peptide. Signal from unstimulated cells is shown in red (no peptide). Gating of individual cell generation peaks is shown in green. (b) Left: Percent of CD4+CD3+ OT-II T-cells having undergone one or more divisions, as a function of antigen dose. Right: Calculated average fold expansion of OT-II T-cells. Data represents mean and SD (n = 3). *, p < 0.05; **, p < 0.01; ***, p < 0.001. One-way ANOVA with post-hoc Tukey’s multiple comparisons test.

OT-II T-cells, which express the transgenic OVA323−339-specific TCR, was analyzed after 3 days of coculture with BMDCs pulsed

with various peptide formulations (Figure 5). The reducible conjugation (SPDP) induced significantly more cell division than D

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry

Figure 6. Effect of covalent conjugation on peptide retention in vivo. (a) Top: Representative IVIS imaging of mice injected with Rhodamine-labeled MHC I COVA257−264 peptide in soluble form (Bol), adsorbed on MSRs (ADS), stably conjugated to MSRs (SMCC), or conjugated to MSRs via reducible conjugation (SPDP). Bottom: Quantification of Rhodamine fluorescence at injection site over time. Data represents mean and SD (n = 3). *, p < 0.05 relative to Bolus group. a, p < 0.05 relative to ADS group, sm, p < 0.05 relative to SMCC group. One-way ANOVA with post-hoc Tukey’s multiple comparisons test. (b) Left: Representative IVIS imaging of explanted MSR scaffolds 13 days after injection. Right: Quantification of Rhodamine-labeled fluorescence of explanted scaffolds.

followed by lysosomal disruption, which activates the inflammasome. Since COVA323−339 gets quickly released from the MSRs when it is not conjugated (Figure S2), adsorbed peptide could be taken up by BMDCs in the absence of MSR internalization, minimizing the impact of the material on T-cell expansion. Indeed, numerous studies have reported that carriers delivering both the antigen and a danger signal to the same APC can enhance T-cell proliferation and functionality.37−41 For example, immunization of mice with a construct consisting of the TLR-9 agonist CpG ODN covalently conjugated to OVA was shown to improve antigen-specific T-cell function over coinjection of the individual compounds.37 Similarly mice immunized with PLGA microspheres coencapsulating OVA and the TLR-7 agonist poly:IC, or CpG adjuvant induced higher numbers of circulating OVA-specific CD8 T-cells compared to a mixture of microsphere individually containing only OVA or the adjuvant.41 Future studies looking at dendritic cell activation markers alongside antigen presentation would help determine if the effect of covalent conjugation on T-cell proliferation is mediated by increased codelivery. In Vivo Retention and Presentation of Conjugated Peptide in MSR Scaffolds. Finally, we investigated the effect of covalent conjugation on peptide availability in vivo. Rhodaminelabeled COVA357−364 was adsorbed or conjugated to MSRs and

soluble peptide at the 10 nM and 1 nM dose and outperformed the stable conjugation (SMCC) scheme at 1 nM (Figure 5b). Overall, the enhanced capacity of SPDP-MSRs to induce OT-II expansion is likely to stem from a combination of high antigen presentation and the ability to codeliver antigen with immunostimulatory signals to the same cell. Surprisingly, peptide conjugated to MSRs with the SMCC cross-linker induced similar levels of proliferation as soluble peptide. This is in contrast with our observation that antigen-presentation was decreased by stable conjugation. To be efficiently primed, T-cells require engagement of the TCR as well as costimulation by antigenpresenting cells.1,34 It has been shown that mesoporous silica can act as a danger signal both by activating the inflammasome pathway, leading to secretion of the inflammatory cytokine IL1-β both in vitro and in vivo.25,35,36 Moreover, it has previously been shown that MSRs can activate BMDCs in vitro and increase the expression of coactivation molecule CD86.25 Therefore, the immunogenic effect of the MSR material itself may contribute to the ability of SMCC-conjugated peptide to stimulate T-cell proliferation. Nevertheless, COVA323−339 simply adsorbed onto MSRs did not improve OT-II response over soluble peptide (Figure S4), which suggests the immunogenicity of MSRs alone is not sufficient to potentiate T-cell response in this assay. Silicamediated immune activation requires endocytosis of the material E

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry

Figure 7. Presentation of peptide antigen by dendritic cells in MSR scaffold vaccines in vivo. (a) Schematic of MSR vaccine formulation. GM-CSF and CpG ODN were passively loaded by adsorption onto unmodified MSR and peptide was adsorbed or conjugated on amine-modified MSRs. MSRs were then combined and injected subcutaneously. (b) Top: Total number of recruited cells in scaffolds retrieved 5 days after injection. Bottom: Number of CD11b+Cd11c+ myeloid dendritic cells in the scaffolds after 5 days (c) % of CD11b+CD11c+ cells presenting SIINFEKL peptide in MSR scaffolds on day 5. Data represents mean and SD (n = 4). *, One-Way ANOVA with post-hoc Turkey test. *, p < 0.05; ***, p < 0.01.

subcutaneously injected in the left flank of CD1 mice. Conjugation led to lower absolute fluorescence from peptide than soluble peptide (Figure S5), so all in vivo measurements were normalized to the initial fluorescence at each condition. Shortly after the injection, bolus fluorescence decreased drastically, falling to less than 2% of the initial fluorescence after 12 h (Figure 6a). In comparison, all MSR-peptide formulations maintained fluorescence signals at this time ranging from 32% to 43% of the original signal (Figure 6a). MSR with covalently conjugated peptide also showed increased signal over bolus at 24 h, and the reducible conjugation (SPDP) had significantly elevated signal compared to all other conditions from day 2 to 6. After 6 days, less than 10% of the initial fluorescence could still be detected through the skin, and to compare the long-term retention of peptide on MSRs, scaffolds were excised after 13 days and directly imaged (Figure 6b). Peptide could be detected in all scaffolds, and the SMCC and SPDP-groups showed increased

signal over the purely adsorbed COVA357−364. Surprisingly, while the reversible linkage (SPDP) exhibited greater signal at early time points, peptide was present at similar levels to SMCCconjugated peptide at the time of explant. The increased signal from SPDP-conjugated peptides at early time points likely resulted from peptide being released from the MSR early in the reversible but not the stable scheme, as soluble peptide had higher absolute fluorescence than conjugated (Figure S5). Overall, these findings demonstrate that retention of peptide was improved by covalent conjugation. To confirm that peptide conjugated to MSR scaffolds could still be presented by antigen-presenting cells in vivo in the context of immunization, we formulated a COVA257−264 MSR vaccine incorporating the recruiting cytokine GM-CSF and danger signal TLR-9 agonist CpG-ODN (Figure 7a). Five days after injection, scaffolds were retrieved and we compared antigen presentation by recruited cells when peptide was simply adsorbed or conjugated F

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry to the particles. Large numbers of CD11b+CD11c+ myeloid DCs were recruited to the scaffolds in all conditions (Figure 7b) and all MSR vaccines could induce peptide presentation by myeloid DCs (Figure 7c). Interestingly, the total number of myeloid DCs in the scaffold was significantly decreased when peptide was covalently conjugated to the MSRs compared to an adsorbed control (Figure 7b). However, a significantly higher percentage of myeloid DCs presented peptide when conjugated via SMCC than with reducible conjugation or adsorption (Figure 7c). Mesoporous rods have been shown to degrade more slowly in the subcutaneous space in vivo than in media in vitro,42 which may delay particle uptake in vivo and prevent SPDP-conjugated peptide from being exposed to the intracellular reductive environment. By contrast, inflammatory myeloid cells are known to produce reactive oxygen species,43 which can catalyze the degradation of succinimide thioether bonds produced by SMCC conjugation,33 which may increase antigen availability to dendritic cells. The difference in antigen retention (Figure 6) and mechanism of peptide uptake is likely to influence DC trafficking and presentation capacity over time. In future studies, it will be important to characterize the kinetics of dendritic cells recruitment and activation in MSR scaffolds alongside antigen presentation to address these questions. Overall, the high levels of antigen presentation seen in MSR scaffolds demonstrate the feasibility of such conjugation approaches for peptide-based vaccines.

modification. The hydroxyl surface of the particles was modified using 3-aminopropyltethoxysilane (APTES, 99%, Sigma) as described previously.25 Typically, 100 mg of OH-MSR were suspended in 100% ethanol and stirred at room temperature for 18 h with 15 μL (14.13 mg) APTES. The extent of surface modification was determined by fluorescamine (98%, Sigma) assay using APTES as a standard. Peptide Conjugation to MSR. Covalent conjugation: Typically, 2.5 mg of amine-modified MSRs (NH2-MSR) were suspended in 50 mg/mL in PBS, pH 7.4 and mixed with 500 μg (1 mg/mL in 10% DMSO) Sulfo-SMCC (Pierce) or LC-SPDP (Pierce) for 1 h at room temperature. Excess cross-linker was removed with extensive washing by centrifugation (10 min, 10 000 rcf). 50 nmol of peptide was reduced for 1 h with equimolar amounts of TCEP (Pierce) and reacted with the activated MSR at room temperature for 12 to 18 h under high shaking. Adsorption: Typically, 2.5 mg of amine-modified MSRs (NH2MSR) were suspended in PBS, pH 7.4 and 50 nmol of peptides was mixed with MSR and allowed to adsorb for 2 h at 37 °C. Conjugation Efficiency Determination. Stable Conjugation. Peptide-MSR conjugations were retrieved and washed extensively by centrifugation to remove unreacted peptide. MSRs were then dissolved in NaOH (10 mg/mL) for 2 h at 37 °C. The obtained solution containing the conjugated peptide was diluted with 3× volume PBS and neutralized using concentrated HCl. The concentration of antigen was determined by microBCA assay (Pierce) using unconjugated peptide as a standard. Remaining peptide after washing for adsorbed controls was measured using the same method. Reducible Conjugation. Peptide conjugation was monitored by measuring the concentration of reaction byproduct pyridylthiol moiety as per manufacturer’s recommendation. Supernatant from the reducible conjugation reaction was collected by centrifugation and absorbance at 343 nm was measured. Measurements were compared to a reduced LC-SPDP standard that had been previously treated with 10-fold molar excess of TCEP (Pierce) for 2 h at 37 °C. Release of Adsorbed Peptide from MSR. Release was carried out in PBS and supernatants were collected by centrifugation at indicated time points. Peptide concentration in supernatant was measured using micro-BCA assay (Pierce) using the peptide as standard. Bone Marrow Derived Dendritic Cells Isolation and Culture. Bone Marrow Derived Dendritic Cells (BMDCs) were derived using standard techniques.44 In brief, bone marrow cells were isolated from female C57Bl/6J mice (Jackson Laboratories) and cultured in RPMI based media (Lonza) supplemented with 10% heat inactivated FBS (Sigma-Aldrich), 1% penicillin/streptomycin, 50 M β-mercaptoethanol, and 20 ng/mL GM-CSF (Peprotech). Dendritic cells were harvested and used for experiments between days 7 and 9 of differentiation. Differentiation was confirmed using CD11c, CD11b, and MHC-II surface markers. BMDC Antigen Presentation Assays. Typically, 5 × 105 BMDCs were seeded per well in a 12-well plate using BMDC culture media without β-mercaptoethanol. Peptide and MSRconstructs were added for 3 to 18 h. Cells were then collected and resuspended in staining buffer (1% BSA, 0.1% sodium azide in PBS). Presentation levels were analyzed by flow cytometry after staining with antimouse CD11c (APC, eBioscience) as a DC marker and antimouse H-2Kb-OVA257−264 (PE or PE-Cy7, eBioscience) that recognizes the SIINFEKL epitope bound to MHC I. Samples were analyzed using an LSR II or Fortessa Cell analyzer (BD Bioscience) and data was analyzed using

■

CONCLUSIONS Simple approaches to covalently attach small peptide antigens on the surface of MSRs were developed using amine-functionalized silica and cysteine-bearing peptides. Conjugation of OVA peptides to the MSRs greatly increased their loading capacity compared to simple adsorption. A stable thioether linkage decreased antigen-presentation by BMDCs in vitro, but not their ability to stimulate OT-II T-cell expansion. In contrast, a reversible disulfide linkage maximized both antigen presentation and T-cell expansion. Covalently conjugated peptides persisted in subcutaneous tissue for longer times, effectively increasing peptide half-life in vivo. Conjugated peptide could be presented by dendritic cells infiltrating the MSR scaffolds in vivo. These conjugation schemes could serve as versatile platforms for the formulation of multiepitope MSR peptide vaccines for cancer immunotherapy and infectious diseases. In the future, this approach will be tested for its ability to stimulate cellular responses in vivo.

■

EXPERIMENTAL PROCEDURES Peptides. Peptides were all synthesized by Peptide2.0 Inc. (Chantilly, VA) and had >95% purity. The following sequences were used: OVA357−364 − SIINFEKL, COVA357−364 − CSIINFEKL, COVA323−339 − CISQVHAAHAEINEAGR. Rhodamine-labeled peptide sequence was CSIINFEKLK with rhodamine conjugated to C-terminal Lysine (Lys10). Mesoporous Silica Particle Synthesis and Amine Modification. High aspect ratio MSRs (88 μm × 4.5 μm) were synthesized as described previously.22,23,25 Briefly, 4 g of P123 surfactant (average Mn 5800, Aldrich) was dissolved in 150 mL of 1.6 M HCl solution and stirred with 8.6 g of tetraethyl orthosilicate (TEOS, 98%, Aldrich) at 40 °C for 20 h, followed by aging at 100 °C for 24 h. To extract the surfactant, the as-synthesized particles were refluxed for 18 h in 1% HCl in ethanol. Pristine particles (OH-MSRs) were used for surface G

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry FlowJo software (Tree StarInc.). Presentation levels represent %H-2Kb/SIINFEKL+ cells gated on CD11c+ cells. Ex Vivo DC:OT-II T-Cell Coculture. Coculture Medium. RPMI based media supplemented with 10% heat inactivated FBS, 1% penicillin/streptomycin, and 50 M β-mercaptoethanol. Procedure. 5 × 104 day 7 BMDCs were seeded in a tissue culture treated U-bottom 96-well plate and incubated with peptide or peptide constructs for 6 h at 37 °C, 5% CO2. The spleen of 6−8-week-old female OT-II mice (Jackson Laboratories) was harvested and CD4+ T-cells were isolated from splenocytes using mouse CD4+ T-cell isolation magnetic beads (Miltenyi Biotech). Isolated cells were labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE, Life Technologies) with a final dye concentration of 1 μM and washed extensively to remove excess CFSE. 5 × 104 labeled T-cells were then added to each well to a final volume of 200 μL. Cocultures were subsequently carried out for 3 days. On day 3, cells were harvested and stained with anti-mouse CD3 and CD4 antibodies (eBioscience) and analyzed by flow cytometry on a LSR Fortessa Cell analyzer (BD Bioscience) to assess CFSE dilution as a marker for cell division. Data Analysis. Data was analyzed using FlowJo software (TreeStar Inc.). Cells were first gated on CD3+CD4+ and populations of cells having undergone 0, 1, 2, 3, 4, or 5+ divisions (M0, M1, M2, M3, M4, or M5) were gated. % divided cells reported corresponds to 100 − M0 %. Expansion index represents

■

*E-mail: [email protected]. ORCID

David J. Mooney: 0000-0001-6299-1194 Author Contributions #

Maxence O. Dellacherie and Aileen W. Li contributed equally to the work. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was funded by the National Institute of Health (R01 EB015498), the Wyss Institute for Biologically Inspired Engineering and the National Science Foundation Graduate Research Fellowship. The authors would like to thank Dr. Luo Gu and Dr. Catia Verbeke for helpful discussions.

■

∑i = 0 Mi 5

∑i = 0 Mi / 2i 357−364

REFERENCES

(1) Vyas, J. M., Van der Veen, A. G., and Ploegh, H. L. (2008) The known unknowns of antigen processing and presentation. Nat. Rev. Immunol. 8, 607−618. (2) Purcell, A. W., McCluskey, J., and Rossjohn, J. (2007) More than one reason to rethink the use of peptides in vaccine design. Nat. Rev. Drug Discovery 6, 404−414. (3) Lauring, A. S., Jones, J. O., and Andino, R. (2010) Rationalizing the development of live attenuated virus vaccines. Nat. Biotechnol. 28, 573−579. (4) Dranoff, G., Jaffee, E., Lazenby, A., Golumbek, P., Levitsky, H., Brose, K., Jackson, V., Hamada, H., Pardoll, D., and Mulligan, R. C. (1993) Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci. U. S. A. 90, 3539−3543. (5) Soiffer, R., Lynch, T., Mihm, M., Jung, K., Rhuda, C., Schmollinger, J. C., Hodi, F. S., Liebster, L., Lam, P., Mentzer, S., et al. (1998) Vaccination with irradiated autologous melanoma cells engineered to secrete human granulocyte-macrophage colonystimulating factor generates potent antitumor immunity in patients with metastatic melanoma. Proc. Natl. Acad. Sci. U. S. A. 95, 13141− 13146. (6) Salcedo, M., Bercovici, N., Taylor, R., Vereecken, P., Massicard, S., Duriau, D., Vernel-Pauillac, F., Boyer, A., Baron-Bodo, V., Mallard, E., et al. (2006) Vaccination of melanoma patients using dendritic cells loaded with an allogeneic tumor cell lysate. Cancer Immunol. Immunother. 55, 819−829. (7) Bercovici, N., Haicheur, N., Massicard, S., Vernel-Pauillac, F., Adotevi, O., Landais, D., Gorin, I., Robert, C., Prince, H. M., Grob, J.J., et al. (2008) Analysis and characterization of antitumor T-cell response after administration of dendritic cells loaded with allogeneic tumor lysate to metastatic melanoma patients. J. Immunother. 31, 101− 112. (8) Finn, O. J. (2003) Cancer vaccines: between the idea and the reality. Nat. Rev. Immunol. 3, 630−641. (9) van Elsas, A., Sutmuller, R. P. M., Hurwitz, A. A., Ziskin, J., Villasenor, J., Medema, J.-P., Overwijk, W. W., Restifo, N. P., Melief, C. J. M., Offringa, R., et al. (2001) Elucidating the Autoimmune and Antitumor Effector Mechanisms of a Treatment Based on Cytotoxic T Lymphocyte Antigen-4 Blockade in Combination with a B16

In Vivo Imaging. 100 μg Rhodamine-labeled COVA was adsorbed or conjugated to 2.5 mg MSR as described. The resulting MSR were combined with 2.5 mg OH-MSR and injected subcutaneously in the right flank of female CD1 mice (Jackson laboratories) in a total volume of 150 μL. Fluorescence images of mice were obtained on a Xenogen IVIS Spectrum system (Caliper Life Sciences). Analysis of scaffold fluorescence was made with LivingImage software (Xenogen). On Day 13 after injections, mice were euthanized and the area around the scaffold was excised and imaged on a Xenogen IVIS Spectrum system (Caliper Life Sciences). In Vivo Antigen Presentation in MSR Scaffolds. 1 μg of murine GM-CSF (Peprotech) and 100 μg murine class B CpG-ODN (sequence TCCATGACGTTCCTGACGTT, IDT, 10 mg/mL working solution in dH2O) were adsorbed on 2.5 mg OH-MSR for 1 h at 37 °C. 100 μg COVA357−364 was adsorbed or conjugated to 2.5 mg NH2-MSR as described. GM-CSF/CpG loaded MSRs were then combined with COVA-conjugated MSRS and injected in the right flank of 6-week-old female C57B16/J mice (Jackson laboratories). Five days after injection, mice were sacrificed and scaffolds retrieved. They were then processed through mechanical disruption and digested for 30 min at 37 °C in 250 U/mL Collagenase IV in RPMI. The resulting cell suspension was then filtered through a 40 μm cell strainer to isolate the cells from the larger sized MSRs. The cells and small remaining MSR particles were pelleted, washed with cold PBS, and counted manually using a hemacytometer. Presentation levels were analyzed by flow cytometry after staining with antimouse CD11b (FITC, eBioscience), CD11c (APC, eBioscience), and anti-mouse H-2Kb-OVA257−264 (PE-Cy7, eBioscience).

■

AUTHOR INFORMATION

Corresponding Author

5

total fold expansion of culture and corresponds to

Quantification of amine modification of MSR, peptide release profiles from MSR, conjugation efficiency titration, OT-II T-cell proliferation for adsorbed peptide, and in vivo tracking of peptide in MSR scaffolds (PDF)

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.bioconjchem.7b00656. H

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry Melanoma Vaccine: Comparison of Prophylaxis and Therapy. J. Exp. Med. 194, 481−490. (10) Chu, L., and Robinson, D. K. (2001) Industrial choices for protein production by large-scale cell culture. Curr. Opin. Biotechnol. 12, 180−187. (11) Kumai, T., Kobayashi, H., Harabuchi, Y., and Celis, E. (2017) Peptide vaccines in cancerold concept revisited. Curr. Opin. Immunol. 45, 1−7. (12) Slingluff, C. L. (2011) The Present and Future of Peptide Vaccines for Cancer: Single or Multiple, Long or Short, Alone or in Combination? Cancer J. 17, 343−350. (13) Dunn, G. P., Old, L. J., and Schreiber, R. D. (2004) The three Es of cancer immunoediting. Annu. Rev. Immunol. 22, 329−360. (14) van der Burg, S. H., Arens, R., Ossendorp, F., van Hall, T., and Melief, C. J. M. (2016) Vaccines for established cancer: overcoming the challenges posed by immune evasion. Nat. Rev. Cancer 16, 219− 233. (15) Hubbell, J. A., Thomas, S. N., and Swartz, M. A. (2009) Materials engineering for immunomodulation. Nature 462, 449−460. (16) Moon, J. J., Suh, H., Bershteyn, A., Stephan, M. T., Liu, H., Huang, B., Sohail, M., Luo, S., Ho Um, S., Khant, H., et al. (2011) Interbilayer-crosslinked multilamellar vesicles as synthetic vaccines for potent humoral and cellular immune responses. Nat. Mater. 10, 243− 251. (17) de Titta, A., Ballester, M., Julier, Z., Nembrini, C., Jeanbart, L., van der Vlies, A. J., Swartz, M. A., and Hubbell, J. A. (2013) Nanoparticle conjugation of CpG enhances adjuvancy for cellular immunity and memory recall at low dose. Proc. Natl. Acad. Sci. U. S. A. 110, 19902−19907. (18) Kuai, R., Ochyl, L. J., Bahjat, K. S., Schwendeman, A., and Moon, J. J. (2016) Designer vaccine nanodiscs for personalized cancer immunotherapy. Nat. Mater. 16, 489−496. (19) Huebsch, N., and Mooney, D. J. (2009) Inspiration and application in the evolution of biomaterials. Nature 462, 426−432. (20) Ali, O. A., Huebsch, N., Cao, L., Dranoff, G., and Mooney, D. J. (2009) Infection-Mimicking Materials to Program Dendritic Cells In Situ. Nat. Mater. 8, 151−158. (21) Bencherif, S. A., Sands, R. W., Ali, O. A., Li, W. A., Lewin, S. A., Braschler, T. M., Shih, T.-Y., Verbeke, C. S., Bhatta, D., Dranoff, G., et al. (2015) Injectable cryogel-based whole-cell cancer vaccines. Nat. Commun. 6, 7556. (22) Kim, J., Li, W. A., Choi, Y., Lewin, S. A., Verbeke, C. S., Dranoff, G., and Mooney, D. J. (2014) Injectable, spontaneously assembling, inorganic scaffolds modulate immune cells in vivo and increase vaccine efficacy. Nat. Biotechnol. 33, 64−72. (23) Hoffmann, F., Cornelius, M., Morell, J., and Fröba, M. (2006) Silica-Based Mesoporous Organic−Inorganic Hybrid Materials. Angew. Chem., Int. Ed. 45, 3216−3251. (24) Tang, F., Li, L., and Chen, D. (2012) Mesoporous Silica Nanoparticles: Synthesis, Biocompatibility and Drug Delivery. Adv. Mater. 24, 1504−1534. (25) Li, W. A., Lu, B. Y., Gu, L., Choi, Y., Kim, J., and Mooney, D. J. (2016) The effect of surface modification of mesoporous silica microrod scaffold on immune cell activation and infiltration. Biomaterials 83, 249−256. (26) Bobisse, S., Foukas, P. G., Coukos, G., and Harari, A. (2016) Neoantigen-based cancer immunotherapy. Ann. Transl Med. 4, 262. (27) Tarasevich, Y. I., and Monakhova, L. I. (2002) Interaction between Globular Proteins and Silica Surfaces. Colloid J. 64, 482−487. (28) Puddu, V., and Perry, C. C. (2014) Interactions at the Silica− Peptide Interface: The Influence of Particle Size and Surface Functionality. Langmuir 30, 227−233. (29) Ackerman, A. L., and Cresswell, P. (2004) Cellular mechanisms governing cross-presentation of exogenous antigens. Nat. Immunol. 5, 678−684. (30) Hirosue, S., Kourtis, I. C., van der Vlies, A. J., Hubbell, J. A., and Swartz, M. A. (2010) Antigen delivery to dendritic cells by poly(propylene sulfide) nanoparticles with disulfide conjugated

peptides: Cross-presentation and T cell activation. Vaccine 28, 7897−7906. (31) Li, D., Sun, F., Bourajjaj, M., Chen, Y., Pieters, E. H., Chen, J., van den Dikkenberg, J. B., Lou, B., Camps, M. G. M., Ossendorp, F., et al. (2016) Strong in vivo antitumor responses induced by an antigen immobilized in nanogels via reducible bonds. Nanoscale 8, 19592− 19604. (32) Dovgan, I., Kolodych, S., Koniev, O., and Wagner, A. (2016) 2(Maleimidomethyl)-1,3-Dioxanes (MD): a Serum-Stable Self-hydrolysable Hydrophilic Alternative to Classical Maleimide Conjugation. Sci. Rep. 6, 30835. (33) Fishkin, N., Maloney, E. K., Chari, R. V. J., and Singh, R. (2011) A novel pathway for maytansinoid release from thioether linked antibody-drug conjugates (ADCs) under oxidative conditions. Chem. Commun. (Cambridge, U. K.) 47, 10752−10754. (34) Chen, L., and Flies, D. B. (2013) Molecular mechanisms of T cell co-stimulation and co-inhibition. Nat. Rev. Immunol. 13, 227−242. (35) Sharp, F. A., Ruane, D., Claass, B., Creagh, E., Harris, J., Malyala, P., Singh, M., O’Hagan, D. T., Pétrilli, V., Tschopp, J., et al. (2009) Uptake of particulate vaccine adjuvants by dendritic cells activates the NALP3 inflammasome. Proc. Natl. Acad. Sci. U. S. A. 106, 870−875. (36) Hornung, V., Bauernfeind, F., Halle, A., Samstad, E. O., Kono, H., Rock, K. L., Fitzgerald, K. A., and Latz, E. (2008) Silica crystals and aluminum salts activate the NALP3 inflammasome through phagosomal destabilization. Nat. Immunol. 9, 847−856. (37) Cho, H. J., Takabayashi, K., Cheng, P.-M., Nguyen, M.-D., Corr, M., Tuck, S., and Raz, E. (2000) Immunostimulatory DNA-based vaccines induce cytotoxic lymphocyte activity by a T-helper cellindependent mechanism. Nat. Biotechnol. 18, 509−514. (38) Wille-Reece, U., Flynn, B. J., Loré, K., Koup, R. A., Kedl, R. M., Mattapallil, J. J., Weiss, W. R., Roederer, M., and Seder, R. A. (2005) HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates. Proc. Natl. Acad. Sci. U. S. A. 102, 15190−15194. (39) Zom, G. G., Khan, S., Britten, C. M., Sommandas, V., Camps, M. G. M., Loof, N. M., Budden, C. F., Meeuwenoord, N. J., Filippov, D. V., van der Marel, G. A., et al. (2014) Efficient Induction of Antitumor Immunity by Synthetic Toll-like Receptor Ligand−Peptide Conjugates. Cancer Immunol. Res. 2, 756−764. (40) Hamdy, S., Molavi, O., Ma, Z., Haddadi, A., Alshamsan, A., Gobti, Z., Elhasi, S., Samuel, J., and Lavasanifar, A. (2008) Co-delivery of cancer-associated antigen and Toll-like receptor 4 ligand in PLGA nanoparticles induces potent CD8+ T cell-mediated anti-tumor immunity. Vaccine 26, 5046−5057. (41) Schlosser, E., Mueller, M., Fischer, S., Basta, S., Busch, D. H., Gander, B., and Groettrup, M. (2008) TLR ligands and antigen need to be coencapsulated into the same biodegradable microsphere for the generation of potent cytotoxic T lymphocyte responses. Vaccine 26, 1626−1637. (42) Choi, Y., Lee, J. E., Lee, J. H., Jeong, J. H., and Kim, J. (2015) A Biodegradation Study of SBA-15 Microparticles in Simulated Body Fluid and in Vivo. Langmuir 31, 6457−6462. (43) Mittal, M., Siddiqui, M. R., Tran, K., Reddy, S. P., and Malik, A. B. (2014) Reactive Oxygen Species in Inflammation and Tissue Injury. Antioxid. Redox Signaling 20, 1126−1167. (44) Lutz, M. B., Kukutsch, N., Ogilvie, A. L. J., Rößner, S., Koch, F., Romani, N., and Schuler, G. (1999) An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods 223, 77−92.

I

DOI: 10.1021/acs.bioconjchem.7b00656 Bioconjugate Chem. XXXX, XXX, XXX−XXX