Article pubs.acs.org/JAFC
Cite This: J. Agric. Food Chem. 2018, 66, 9952−9959
Creatine Monohydrate and Guanidinoacetic Acid Supplementation Affects the Growth Performance, Meat Quality, and Creatine Metabolism of Finishing Pigs Jiaolong Li,† Lin Zhang,† Yanan Fu,† Yanjiao Li,† Yun Jiang,‡ Guanghong Zhou,† and Feng Gao*,†
J. Agric. Food Chem. 2018.66:9952-9959. Downloaded from pubs.acs.org by UNIV OF LOUISIANA AT LAFAYETTE on 09/26/18. For personal use only.
†
College of Animal Science and Technology, Key Laboratory of Animal Origin Food Production and Safety Guarantee of Jiangsu Province, Key Laboratory of Gastrointestinal Nutrition and Animal Health of Jiangsu Province, and Jiangsu Collaborative Innovation Center of Meat Production and Processing, Quality and Safety Control, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China ‡ Ginling College, Nanjing Normal University, Nanjing, Jiangsu 210024, People’s Republic of China ABSTRACT: This study aimed to investigate the effects of creatine monohydrate (CMH) and guanidinoacetic acid (GAA) supplementation on the growth performance, meat quality, and creatine metabolism of finishing pigs. The pigs were randomly allocated to three treatment groups: the control group, CMH group, and GAA group. In comparison to the control group, CMH treatment increased average daily feed intake and GAA treatment increased average daily feed intake and average daily gain of pigs. In addition, CMH and GAA treatment increased pH45 min, myofibrillar protein solubility, and calpain 1 mRNA expression level and decreased the drip loss and shear force value in longissimus dorsi or semitendinosus muscle. Moreover, CMH and GAA supplementation increased the concentrations of creatine and phosphocreatine and the mRNA expressions of guanidinoacetate N-methyltransferase and creatine transporter in longissimus dorsi muscle, semitendinosus muscle, liver, or kidneys and decreased the mRNA expressions of arginine:glycine amidinotransferase in kidneys. In conclusion, CMH and GAA supplementation could improve the growth performance and meat quality and alter creatine metabolism of finishing pigs. KEYWORDS: creatine monohydrate, guanidinoacetic acid, growth performance, meat quality, creatine metabolism, finishing pigs
■
INTRODUCTION The creatine/creatine kinase system is an energy metabolic pathway to provide adenosine triphosphate (ATP) for cellular function.1 About 95% of creatine is mainly located in skeletal muscle, and the remaining 5% is stored in the brain, liver, kidneys, and testes. Meanwhile, most of the energy is consumed by these organs and tissues.2 Creatine is synthesized endogenously by a two-step process from glycine, arginine, and methionine.3−5 In the first step, the amidino group in arginine is transferred to glycine to form ornithine and guanidinoacetic acid (GAA), which is catalyzed by arginine:glycine amidinotransferase (AGAT). This process mainly takes place in the kidneys and pancreas. With regard to the second step, the methyl group from S-adenosylmethionine is transferred to GAA to form creatine and S-adenosylhomocysteine. This process is mainly catalyzed by guanidinoacetate N-methyltransferase (GAMT) and occurs in the kidneys and liver. Then, creatine enters the bloodstream and is subsequently transported to cells and tissues for energy supply. Once entering the cell, creatine is phosphorylated to phosphocreatine by creatine kinase and functions to buffer changes in ATP during the altered energy status.6 Finally, creatine is spontaneously converted to creatinine and excreted in urine. It has been reported that the meat quality is related to the energy status in muscle.7 After slaughter, with the stop of blood circulation, the metabolic pathway of skeletal muscle turns into glycolysis and lactic fermentation, resulting in the accumulation of lactic acid and a concomitant decrease in the pH value. Several studies reported that dietary creatine or creatine © 2018 American Chemical Society
monohydrate (CMH) supplementation could increase the concentrations of creatine and phosphocreatine,8,9 decrease the rate of post-mortem glycolysis, and then improve the meat quality of pigs.10−13 GAA is the immediate precursor for creatine synthesis in animals and has functions similar to CMH. Given that GAA is less expensive, more chemically stable, and more bioavailable than creatine,14 we presume that it might be an alternative for CMH supplementation. In several studies, dietary GAA increased total muscle creatine and phosphocreatine levels.15,16 In addition, supplementation with GAA has also been reported to increase the muscle pH, improve the color, and decrease the drip loss and shear force value of meat in pigs.15,17 There are extensive reports on the effects of CMH and GAA supplementation on meat quality; however, there is limited information regarding the effects of dietary supplementation with CMH and GAA on the creatine metabolism of finishing pigs. This study was carried out to investigate the effects of CMH and GAA supplementation on the growth performance, meat quality, and creatine metabolism of finishing pigs.
■
MATERIALS AND METHODS
Animal Management and Experimental Diets. All pigs were provided and managed by Changzhou Meinong Farming Technology Received: Revised: Accepted: Published: 9952
May 14, 2018 August 18, 2018 September 1, 2018 September 2, 2018 DOI: 10.1021/acs.jafc.8b02534 J. Agric. Food Chem. 2018, 66, 9952−9959
Article
Journal of Agricultural and Food Chemistry Co., Ltd. (Changzhou, China). A total of 180 healthy cross castrated male pigs (Duroc × Landrace × Yorkshire, 90.88 ± 2.91 kg) were individually weighed and randomly allocated to three treatment groups, and each treatment consisted of three replicates (pens) of 20 pigs each. The pigs in three groups were fed with basal diets (control group), basal diets supplemented with 0.8% CMH (CMH group), or basal diets supplemented with 0.1% GAA (GAA group), individually. CMH and GAA were obtained from Tianjin Tiancheng Pharmaceutical Co., Ltd. (Tianjin, China). Feed and water were available ad libitum during the experiment for 15 days. The compositions and nutrient levels of the basal diet are presented in Table 1. At the
further analysis. After 24 h of chilling, samples from the muscles were collected and stored at −80 °C for protein solubility measurement. Meat Quality Measurement. The pH values of the longissimus dorsi and semitendinosus muscle were measured at 45 min (pH45 min) and 24 h (pHu) post-mortem using a pH meter (HI9125, HANNA Instrument, Italy). Each sample was tested 3 times at different locations, and the average values were used. The meat color was measured with a CR410 chroma meter (Konica Minolta Sensing, Inc., Japan) at 24 h post-mortem, and the values were described as CIE L* (lightness), a* (redness), and b* (yellowness). Measurements were performed in triplicate for each sample, and the values were averaged. Drip loss was measured by the method of Li et al.,13 with minor modifications. Approximately 20 g of sample of the longissimus dorsi and semitendinosus muscle was cut like a strip parallel to the longitudinal orientation of the myofibers. After the removal of the surface water, the samples were initially weighed and hanged in a plastic bag in a refrigerator at 4 °C for 24 h. Then, the surface water was removed again, and the samples were reweighed to calculate the drip loss percentage. The 72 h post-mortem samples were used to measure the cooking loss and shear force value in accordance with the method described by Li et al.18 About 20 g of sample was weighed, placed in a vacuum bag, and cooked in a water bath at 75 °C until the internal temperature of the sample reached 70 °C. After cooling in the running water, the surface water was removed and the samples were reweighed to calculate the cooking loss percentage. Then, the cooked samples were shaped to a size of 3 × 1 × 1 cm and sheared perpendicular to the muscle fiber direction in triplicate to measure the shear force value using a digital meat tenderness meter (C-LM3B, Northeast Agricultural University, Harbin, China). Protein Solubility Measurement. The total protein solubility (TPS) and sarcoplasmic protein solubility (SPS) of longissimus dorsi and semitendinosus muscle were analyzed as described by Niu et al.19 To measure the TPS, about 0.5 g of muscle sample was homogenized in 10 mL of cooled 1.1 M potassium iodide in 0.1 M phosphate buffer (pH 7.2) for 30 s and about 0.5 g of muscle sample was homogenized in 5 mL of cooled 0.025 M phosphate buffer (pH 7.2) for 30 s to measure the SPS. The homogenates were extracted at 4 °C for 12 h and then centrifuged for 20 min at 1500g and 4 °C to obtain the supernatants, and the protein concentrations in the supernatants were determined using commercial kits by the Bradford method (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Myofibrillar protein solubility (MPS) was calculated by the difference between TPS and SPS. Creatine and Phosphocreatine Determination. The concentrations of creatine and phosphocreatine in the muscle, liver, and kidneys were evaluated by reverse-phase high-performance liquid chromatography (HPLC) according to the method of Liu et al.15
Table 1. Composition and Nutrient Level of the Basal Diet composition
%
nutrient level
%
maize soybean meal corn starch rice bran soybean oil premixa
61 20 10 4 1 4
digestible energy (MJ/kg) crude protein calcium total phosphorus lysine methionine cystine threonine tryptophan
14.05 14.54 0.50 0.44 0.71 0.22 0.23 0.54 0.16
total
100
a
The premix provided the diet per kilogram as follows: 4200 mg of calcium, 900 mg of phosphorus, 100 mg of iron, 100 mg of zinc, 30 mg of manganese, 10 mg of copper, 0.3 mg of selenium, 0.5 mg of iodine, 5000 IU of retinyl acetate, 1000 IU of cholecalciferol, 20 IU of DL-α-tocopheryl acetate, 3.0 mg of menadione sodium bisulfite, 2.0 mg of thiamin mononitrate, 6.0 mg of riboflavin, 3.0 mg of pyridoxine hydrochloride, 30 μg of cyanocobalamin, 20 mg of nicotinic acid, 8 mg of calcium pantothenate, 0.5 mg of folic acid, and 300 mg of choline. beginning and end of the experiment, the body weight and feed intake of each replicate pen were recorded to measure the average daily feed intake (ADFI), average daily gain (ADG), and feed/gain ratio (F/G). The experimental design and procedures were approved by the Animal Care and Use Committee of Nanjing Agricultural University. Sample Collection. After 15 days of dietary treatment, three pigs per pen with a similar average body weight of the pen (27 in total) were selected and transported to the slaughterhouse for slaughter with bleeding after electrical stunning after 12 h of fasting. After evisceration, the samples from the longissimus dorsi muscle at the last rib and semitendinosus muscle were placed in vacuum bags at 4 °C to measure meat quality traits. Meanwhile, samples from the longissimus dorsi muscle, semitendinosus muscle, liver, and kidneys were immediately frozen in liquid nitrogen and stored at −80 °C for
Table 2. Primer Sequences for Real-Time Quantitative PCR Analysisa gene
prime sequence (5′ → 3′)
product size (bp)
GenBank number
CAPN1
forward: GCTCATCATCACCCGCTACT reverse: TCAAAGGTCACAACTCCATCC forward: GCCGTCTCTGAAGTGGTTTC reverse: ATCCAGGGCATCGTCAAGT forward: TCTCGCTCCTGACTACCG reverse: GGCATCCACCATAACACG forward: GCCATCGCAGCCACTAAG reverse: TTCAGCAGGCGGAAAGCA forward: CTGGTCTGGCTTTCATCGC reverse: CCCTCTGGAAACGGAAGTAG forward: ATGCTTCTAGACGGACTGCG reverse: GTTTCAGGAGGCTGGCATGA
138
NM-213972
105
NM-214067
271
NM-001128 442.1 XM-003353 976.2 NM-001177 327.1 XM-003357 928
CAST AGAT GAMT CreaT β-actin
269 186 130
a
CAPN1, calpain 1; CAST, calpastatin; AGAT, arginine:glycine amidinotransferase; GAMT, guanidinoacetate N-methyltransferase; and CreaT, creatine transporter. 9953
DOI: 10.1021/acs.jafc.8b02534 J. Agric. Food Chem. 2018, 66, 9952−9959
Article
Journal of Agricultural and Food Chemistry Briefly, about 300 mg of sample was homogenized in 2 mL of ice-cold 0.5% perchloric acid for 1 min and extracted at 4 °C for 15 min. Then, the supernatants of homogenates were obtained by centrifugation for 10 min at 8500g and 4 °C. After that, the supernatants were transferred to a new centrifuge tube, neutralized with 900 μL of 0.8 M K2CO3 for 10 min, then recentrifuged for 10 min at 8500g and 4 °C. The supernatant was filtered through a 0.45 μm filtration membrane before injection into the Waters 2695 Alliance HPLC system (Waters Corporation, Milford, MA, U.S.A.). The chromatographic parameters were set as follows: the injection volume was 10 μL; the column temperature was 25 °C; the flow rate was kept at 1.0 mL/min; the ultraviolet detection was 210 nm; the mobile phases were methyl cyanide and 29.4 mM KH2PO4 buffer; and the volume radio was 2:98. Real-Time Quantitative Polymerase Chain Reaction (PCR) Analysis. Total RNA were extracted from the frozen muscle, liver, or kidney samples using Trizol reagent (TaKaRa Biotechnology Co., Ltd., Dalian, China) in accordance with the instructions of the manufacturer. The purity and concentration of total RNA were measured using a Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, MA, U.S.A.). After that, the RNA was reversed to cDNA using commercial kits (TaKaRa Biotechnology Co., Ltd., Dalian, China). Then, real-time PCR was performed in optical 96-well plates using the 7500 quantitative PCR StepOnePlus system (Applied Biosystems, Foster City, CA, U.S.A.) with SYBR Premix Ex Taq kits (TaKaRa Biotechnology Co., Ltd., Dalian, China) according to the instructions of the manufacturer. The primers used for mRNA expression were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), and the sequences of target genes and housekeeping genes are exhibited in Table 2. The reaction system volume of real-time PCR was 20 μL, and each sample was repeated in triplicate. The program was as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s, and 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. The relative gene expression was calculated using the 2−ΔΔCT method according to Livak and Schmittgen.20 Statistical Analyses. Data analysis was carried out using one-way analysis of variance (ANOVA) with the SPSS statistical software (version 20.0 for Windows, SPSS Institute, Inc., Chicago, IL, U.S.A.), and Tukey’s test was performed. All data were analyzed using a pen as the experimental unit (n = 3). Data were shown as the mean value and standard error of the mean (SEM), and the result with p < 0.05 was considered statistically significant.
Table 4. Effect of CMH and GAA Supplementation on the Meat Quality of Longissimus Dorsi and Semitendinosus Muscle in Finishing Pigsa item pH45 min pHu L* a* b* drip loss (%) cooking loss (%) shear force (N) pH45 min pHu L* a* b* drip loss (%) cooking loss (%) shear force (N)
CMH
GAA
SEM
p value
2140 a 729 a 2.94
2218 a 767 ab 2.89
2558 b 865 b 2.96
80.11 25.87 0.05
0.025 0.018 0.291
Longissimus Dorsi Muscle 6.06 a 6.22 b 6.28 5.62 5.71 5.66 47.40 46.52 47.05 6.85 7.53 7.14 1.32 1.46 1.98 3.60 b 2.12 a 2.14 16.74 15.27 14.39 43.39 b 32.64 a 35.21 Semitendinosus Muscle 6.14 a 6.30 b 6.34 5.59 5.67 5.67 47.06 46.79 46.79 8.13 8.26 8.25 1.19 1.85 1.12 1.92 b 1.22 a 1.48 16.93 15.23 15.23 34.68 32.28 30.63
b
a ab b
ab
SEM
p value
0.04 0.04 0.58 0.23 0.15 0.25 0.72 1.51
0.034 0.667 0.871 0.526 0.131 0.006 0.373 0.002
0.03 0.02 0.50 0.16 0.29 0.11 0.44 1.42
0.029 0.159 0.972 0.939 0.361 0.022 0.214 0.537
longissimus dorsi muscle (p < 0.05). Meanwhile, CMH supplementation decreased the shear force value in longissimus dorsi muscle compared to the control group (p < 0.05). There were no differences in pHu, L*, a*, b*, and cooking loss among three groups (p > 0.05). Similar to the longissimus dorsi muscle, the pigs fed with CMH had higher pH45 min and lower drip loss in the semitendinosus muscle (p < 0.05) and dietary GAA reduced the drip loss compared to the control group (p < 0.05). There were no significant treatment effects on pHu, L*, a*, b*, cooking loss, and shear force in semitendinosus muscle (p > 0.05). In addition, dietary CMH supplementation increased the MPS of semitendinosus muscle compared to the control group (p < 0.05; Table 5). Moreover, in comparison to the control group, CMH and GAA treatments showed significant upregulation of CAPN1 mRNA expression levels (p < 0.05; Figure 1A) while exerting no effect on CAST mRNA expression levels in the longissimus dorsi muscle (p > 0.05; Figure 1A). A similar tendency was found with the mRNA expressions of CAPN1 and CAST in the semitendinosus muscle (Figure 1B). As shown in Table 6, the concentrations of creatine were elevated in longissimus dorsi muscle and liver by CMH and GAA supplementation compared to the control group (p < 0.05) as well as the concentrations of phosphocreatine in longissimus dorsi and semitendinosus muscle (p < 0.05). Neither the concentrations of creatine nor phosphocreatine in kidney were altered by CMH or GAA supplementation (p > 0.05). Meanwhile, in comparison to the control group, CMH and GAA treatment decreased the AGAT mRNA expression levels in kidneys (p < 0.05; Figure 2D). Dietary CMH supplementation showed significant upregulation of GAMT mRNA expression levels in semitendinosus muscle, liver, and kidneys (p < 0.05; panels B, C, and D of Figure 2), and a
Table 3. Effect of CMH and GAA Supplementation on the Growth Performance in Finishing Pigsa control
GAA
Results are represented as the mean value and SEM. The data are the means of three replicates of three pigs per pen (n = 3). Means without a common letter significantly differ (p < 0.05). Control, basal diets; CMH, basal diets with creatine monohydrate supplementation at 0.8%; GAA, basal diets with guanidinoacetic acid supplementation at 0.1%; SEM, standard error of the mean; pH45 min, pH at 45 min postmortem; and pHu, pH at 24 h post-mortem.
RESULTS The growth performance parameters are shown in Table 3. In comparison to the the control group, CMH treatment
item
CMH
a
■
ADFI (g) ADG (g) F/G (g/g)
control
a
Results are represented as the mean value and SEM. The data are the means of three replicates of 20 pigs per pen (n = 3). Means without a common letter significantly differ (p < 0.05). Control, basal diets; CMH, basal diets with creatine monohydrate supplementation at 0.8%; GAA, basal diets with guanidinoacetic acid supplementation at 0.1%; SEM, standard error of the mean; ADFI, average daily feed intake; ADG, average daily gain; and F/G, feed/gain ratio.
increased ADFI (p < 0.05) and GAA treatment increased ADFI and ADG of finishing pigs (p < 0.05). Dietary CMH and GAA supplementation did not affect F/G of finishing pigs (p > 0.05). As indicated in Table 4, the pigs subjected to CMH and GAA treatments had higher pH45 min and lower drip loss in 9954
DOI: 10.1021/acs.jafc.8b02534 J. Agric. Food Chem. 2018, 66, 9952−9959
Article
Journal of Agricultural and Food Chemistry Table 5. Effect of CMH and GAA Supplementation on the Protein Solubility of Longissimus Dorsi and Semitendinosus Muscle in Finishing Pigsa item total protein solubility (mg/g) sarcoplasmic protein solubility (mg/g) myofibrillar protein solubility (mg/g) total protein solubility (mg/g) sarcoplasmic protein solubility (mg/g) myofibrillar protein solubility (mg/g)
GAA
SEM
p value
Longissimus Dorsi Muscle 158.31 157.44 158.92
3.71
0.988
control
CMH
Table 6. Effect of CMH and GAA Supplementation on the Concentrations of Creatine and Phosphocreatine in the Longissimus Dorsi Muscle, Semitendinosus Muscle, Liver, and Kidneys of Finishing Pigsa item
83.26
75.10
80.31
1.95
0.235
creatine (mg/g) phosphocreatine
75.05
82.34
78.62
3.58
0.779
creatine (mg/g) phosphocreatine
Semitendinosus Muscle 176.69 189.49 183.54
3.61
0.373
117.36
2.77
0.857
1.69
0.002
59.32 b
116.62 72.87 a
120.40 63.14 b
creatine (mg/g) phosphocreatine creatine (mg/g) phosphocreatine
control
CMH
SEM
p value
a a
0.05 0.02
0.035 0.030
a
0.06 0.02
0.382 0.019
0.02
