Crystal Structure of Korean Pine (Pinus koraiensis) 7S Seed Storage

Dec 11, 2013 - similar to the structures of other 7S seed storage proteins and consists of an ... KEYWORDS: 7S vicilin, pine nut, allergen, X-ray crys...
1 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/JAFC

Crystal Structure of Korean Pine (Pinus koraiensis) 7S Seed Storage Protein with Copper Ligands Tengchuan Jin,*,†,⊥ Yang Wang,† Yu-Wei Chen,†,# Tong-Jen Fu,‡ Mahendra H. Kothary,§ Tara H. McHugh,∥ and Yuzhu Zhang*,∥ †

Department of Biology, Illinois Institute of Technology, 3101 South Dearborn Street, Chicago, Illinois 60616, United States Center for Food Safety and Applied Nutrition, U.S. Food and Drug Administration, 6502 South Archer Road, Bedford Park, Illinois 60501, United States § Center for Food Safety and Applied Nutrition, U.S. Food and Drug Administration, 8301 Muirkirk Road, Laurel, Maryland 20708, United States ∥ Agricultural Research Service, Western Regional Research Center, U.S. Department of Agriculture, 800 Buchanan Street, Albany, California 94710, United States ‡

S Supporting Information *

ABSTRACT: The prevalence of food allergy has increased in recent years, and Korean pine vicilin is a potential food allergen. We have previously reported the crystallization of Korean pine vicilin purified from raw pine nut. Here we report the isolation of vicilin mRNA and the crystal structure of Korean pine vicilin at 2.40 Å resolution. The overall structure of pine nut vicilin is similar to the structures of other 7S seed storage proteins and consists of an N-terminal domain and a C-terminal domain. Each assumes a cupin fold, and they are symmetrically related about a pseudodyad axis. Three vicilin molecules form a doughnutshaped trimer through head-to-tail association. Structure characterization of Korean pine nut vicilin unexpectedly showed that, in its native trimeric state, the vicilin has three copper ligands. Sequence alignments suggested that the copper-coordinating residues were conserved in winter squash, sesame, tomato, and several tree nuts, while they were not conserved in a number of legumes, including peanut and soybean. Additional studies are needed to assess whether the copper-coordinating property of vicilins has a biological function in the relevant plants. The nutritional value of this copper-coordinating protein in tree nuts and other edible seeds may be worth further investigations. KEYWORDS: 7S vicilin, pine nut, allergen, X-ray crystallography, copper protein

1. INTRODUCTION Food allergies have become a major global health concern.1,2 Most food allergies are triggered by immunoglobulin E (IgE) recognition of food allergens.3 To date, there is no cure for food allergies, although immunotherapy using a very small amount of food, recombinant allergens, and engineered hypoallergenic proteins is considered promising.4−7 Peanut and tree nuts account for the majority of fatal and near-fatal food allergy cases in the United States.8,9 Cross-reactivity exhibited by peanut allergic patients to other tree nuts, legumes, and oil seeds10,11 poses an additional risk to these patients. Pines (family Pinaceae, genus Pinus) are widely distributed around the world and are among the most important forest trees. One single species, the loblolly pine (Pinus taeda L.), provides ∼16% of the world’s annual timber supply.12 Pine woods are also widely used in the pulp and paper industries. The edible seeds of pine trees (pine nuts) have been consumed in Asia and Europe since prehistoric times, and in some regions, people may have survived winters by consuming only pine nuts.13 About 30 species of pine produce seeds that are large enough for harvesting.14 Korean pine nuts are extensively harvested in northeastern China. More than 80% of the pine nuts sold in the United States are imported, primarily from China.15 Pine nuts are considered a delicacy in many of the world’s cultures,14 and they are frequently used in the © 2013 American Chemical Society

preparation of bakery products, vegetable dishes, and other foods.16,17 Pine nuts are also of high nutritional value. Proteins make up as much as 31.6% of the total dry weight of the edible portion of pine nuts.17,18 Pine nuts contain a considerable number of vitamins (e.g., vitamins A, B1, and B2), potassium, magnesium, copper, and other minerals as well as dietary fiber.17,19 Unfortunately, pine nuts, similar to peanuts and other tree nuts, are reported to cause allergic reactions in certain patients,20,21 although no pine proteins have been officially recognized as allergens by the World Health Organization and International Union of Immunological Societies (WHO/IUIS) Allergen Nomenclature Subcommittee. The 7S vicilin type seed storage proteins belong to the cupin protein superfamily, which also includes the 11S legumins. Both the 7S and 11S proteins in peanut, hazelnut, cashew nut, pistachios, and walnuts are known to be allergens.22,23 The crystal structures of a few of these allergens have been reported, including Ara h 324 and Ara h 125,26 from peanut and Pru du 627 from almond. Structural studies on a related protein from Amaranthus hypochondriacus Received: Revised: Accepted: Published: 222

September 6, 2013 November 27, 2013 December 11, 2013 December 11, 2013 dx.doi.org/10.1021/jf4039887 | J. Agric. Food Chem. 2014, 62, 222−228

Journal of Agricultural and Food Chemistry

Article

structure solution by PHASER32,33 molecular-replacement calculations have been previously reported.30 Structure refinement was carried out with REFMAC534 implemented in CCP4i35 and with PHENIX36 alternated with model building and model improvement using Coot.37 The final structure was refined with all data to a 2.40 Å resolution, and the final model was checked by PROCHECK38 and MolProbity validation.39 The quality of the structure model was also checked with a shake-and-omit protocol by first introducing random errors up to 0.3 Å to the coordinates of the final refined structure using the program PDSET distributed with CCP4.35 For each region to be checked, the concerned region of the shaken structure was manually omitted and 20 cycles of restrained refinements were carried out using REFMAC5.34 This was followed by inspecting the Fo − Fc map together with the final refined structure. The structure of pine nut vicilin has been submitted to the Protein Data Bank with the accession code 4LEJ. Molecular graphics were prepared using the programs RASMOL,40 MOLSCRIPT,41 Raster3D,42 and Pymol (http://pymol.org/).

were also attempted.28 To understand the allergenicity of the cupin family of proteins, additional information about the structural properties of the 7S and 11S proteins is needed. In this paper, we describe the cloning of Korean pine vicilin and X-ray crystallographic study of the structure of this potential allergen.

2. MATERIALS AND METHODS 2.1. Plasmid Construction. 2.1.1. Total RNA Extraction. The 7S vicilin of Korean pine was first purified from pine nut and identified by aligning its N-terminal peptides with the available sequence of vicilin from loblolly pine.29 To determine the mRNA sequence of Korean pine vicilin, fresh tissues of female flowers and young cones of Korean pine were collected at the Chicago Botanic Garden (Chicago, IL). Total RNA from young Korean pine cones was extracted using the QIAGEN (Valencia, CA) RNeasy Plus Mini Kit according to the manufacturer’s protocol with minor modifications. Briefly, 100 mg of fresh tissues/seeds of young cone were ground in liquid nitrogen and collected in a microcentrifuge tube. As soon as the liquid nitrogen evaporated, 450 μL of buffer RLT was added, and the sample was mixed by inversion. RLT and RW1 and RPE mentioned below are proprietary buffers provided by the kit, and their compositions are not described. After centrifugation, the supernatant was transferred to a gDNA Eliminator Mini Spin column and subjected to centrifugation. The flow-through was mixed with 1/2 volume of ethanol and loaded onto an RNeasy Mini Spin column. The column was washed with 700 μL of RW1 buffer and 500 μL of RPE buffer, and the total RNA was eluted with 50 μL of RNase-free water. Two microliter (80 units) of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen, Carlsbad, CA) was added to the sample immediately after elution. Fresh total RNA was used as a template for reverse transcription (RT). 2.1.2. RT and PCR. An Omniscript Reverse Transcription Kit (QIAGEN, Valencia, CA) was used to synthesize cDNAs from the total RNA of various pine tissues. The RT reaction was carried out using a 20-nucleotide poly-dT primer at a 6 μM concentration and 2 μL of the fresh total RNA as the template in a 20 μL RT mixture. The RT reaction was allowed to proceed for 1 h at 37 °C, and the reverse transcriptase was inactivated by incubation at 95 °C for 5 min. The RT product was either used immediately as a template in PCR or stored at −80 °C for further use. Previously, we reported the purification and biochemical and biophysical characterization of the Korean pine vicilin.29 N-terminal peptide sequencing of the purified protein indicated that it was similar but not identical to that of loblolly pine.29 To isolate the mRNA sequence of Korean pine vicilin, PCR primers (atggcttttgtttctttacttaccattcttc, forward; cgtggagaaactctagt, reverse) were designed on the basis of the loblolly pine vicilin mRNA sequence, and PCR was carried out using Phusion DNA polymerase (New England BioLabs, Ipswich, MA). By blunt end ligation using quick ligase, the PCR product was inserted into a pBluescript SKII vector digested with EcoRV to generate pBlue−vicilin. Two colonies were sent to a commercial vender for sequencing, and the resulting mRNA sequence was deposited in GenBank (access ID KF530834). 2.2. Identification of Metal Ligands. A Varian AA 55B atomic absorption spectrophotometer (Agilent Technologies, Santa Clara, CA) was used to determine and quantify possible metal ligands in Korean pine vicilin. An air/acetylene (oxidant/fuel) mixture was used as the flame source. Standard solutions of Cu, Ni, Zn, Mg, Mn, Ca, Fe, and Al ions were prepared fresh for each measurement according to the spectrophotometer manufacturer’s instructions and were used for the calibration of the instrument. A vicilin sample of 0.161 mM monomer concentration in Milli-Q H2O was used for metal content determination. 2.3. Structure Refinement. Korean pine vicilin was purified from raw pine nut and crystallized by the vapor-diffusion method as described previously.30 X-ray diffraction data were collected at the SER-CAT 22ID beamline at the Advanced Photon Source (APS), Argonne National Laboratory. Data processing with HKL200031 and a

3. RESULTS 3.1. Isolation of Korean Pine Vicilin cDNA. To allow characterization of the physicochemical, structural, and immunological properties of Korean pine vicilin, the availability of purified protein is needed. Toward this end, we sought to isolate the vicilin gene and deduce its peptide sequence. The coding sequence of Korean pine vicilin was cloned, sequenced, and deposited in GenBank (KF530834). The coding sequence of vicilin as well as its encoded peptide sequence is shown in the Supporting Information (Figure S1). The signal peptide was determined by comparing the predicted pro-protein with the result of N-terminal sequencing of the native protein purified from mature seeds.29 The isolation of the coding sequence of pine nut vicilin and production of the recombinant protein can be used in future studies to investigate pine nut allergy and the allergenicity of this protein. 3.2. Structure of Pine Nut Vicilin. The translated peptide sequence from the newly cloned Korean pine vicilin was used for structure refinement. The refined structure gave R/Rfree values of 0.1924/0.2414 for all data to 2.40 Å (Figure 1 and

Figure 1. Structure of pine vicilin. A vicilin molecule in one asymmetric unit is shown in a ribbon diagram with a rainbow coloring scheme (N-terminal, blue; C-terminal, red). A copper ligand of the protein is shown as a bronze sphere, and the side chains of copperbinding residues are shown as sticks with the CPK coloring scheme.

Table 1). The RMSDs from ideal empirical values43 were 0.004 Å for the bond lengths and 0.80° for the bond angles, with no main-chain bond length deviating more than 0.05 Å or mainchain bond angle deviating more than 10° from the “ideal” small-molecule values. On the Ramachandran plot calculated with MolProbity validation,39 all residues were in allowed 223

dx.doi.org/10.1021/jf4039887 | J. Agric. Food Chem. 2014, 62, 222−228

Journal of Agricultural and Food Chemistry

Article

Table 1. X-ray Crystallographic Statistics and Refinement Data Collection space group unit cell (a, b, c) (Å) wavelength (Å) resolution (last shell) (Å) no. of reflns (total/unique) completeness (last shell) (%) Wilson B-factor redundancy (last shell) I/σ(I) (last shell) Rmerge (last shell)a Rpim (last shell)b

I213 148.78, 148.78, 148.78 1.0 50.00−2.40 (2.48−2.40) 153081/21278 98.9 (100.00) 58.65 7.2 (7.3) 10.46 (4.51) 0.105 (0.660) 0.044 (0.263)

Refinement total no. of atoms no. of protein atoms no. of ligand atoms no. of solvent atoms av B-factor (Å2) RMSD(bond lengths) (Å) RMSD(bond angles) (deg) Rworkc Rfreed Ramachandran plot favored/disallowed (%)

2874 2832 12 30 71.95 0.004 0.80 0.1924 0.2414 96.3/0.0

Figure 2. Trimeric structure of pine vicilin. The trimeric vicilins are shown in a ribbon diagram with the monomers colored in cyan, green, and magenta. The trimer is shown in two orthogonal views and with the copper atoms in all three monomers shown in space-fill and colored in bronze.

On the basis of patient serum recognition and LC/MS/MS sequencing of peptides resulting from protease digestion of a 50 kDa protein, Pinus pinea (stone pine) vicilin was suggested to be a pine nut allergen.44 The three peptides identified in that study (ASSEAGEIR, QFLAGK, and FGVPSGHTFY) can be separately aligned with Korean pine vicilin isolated in this study with 100% identity, except for the second peptide, which would align with a sequence of EFLAGK, with one amino acid residue not identical (data not shown). A total of 23 linear IgE epitopes in peanut allergen Ara h 1 were identified, and the smallest IgEbinding sequence was determined to contain six amino acids.45 When pine vicilin isolated in this study was aligned with Ara h 1 (data not shown), the longest stretch of exact matches contained six residues but did not reside in any of the known linear epitopes of Ara h 1. The second longest match only contained less than 6 amino acids. To date, the allergenicity of food proteins is still poorly understood, and the reliability of using sequence comparison alone to predict protein allergenicity may be questionable. Structural properties may provide clues that contribute to the understanding of the allergenicity of these proteins. Unfortunately, very little information is available regarding conformational IgE epitopes of known allergens. The availability of three-dimensional structures of additional food allergens may help the understanding and mitigation of the allergenicity of food proteins in the future when more information about conformational epitopes is obtained. 3.3. Copper Center in Pine Nut Vicilin. The copper center of pine nut vicilin consists of a cysteine (C338), a tyrosine (Y67), and two histidines (H340 and H379). The sulfur of C338, the ND1 of H340, and the NE2 of H379 form a trigonal planar structure with the copper ion in the center, but slightly away from the plane. The hydroxyl group of Y67 provides the fourth, axial ligand with a longer coordinating distance (Figure 3). On the basis of the structural and spectroscopic properties of copper proteins, their Cu centers are classified into different types (types I, II, III, CuA, CuB, and CuZ).46 Modification of the Cu center by protein engineering has also generated a so-called type I and half copper site.47 Type I copper proteins are also called blue copper proteins because of their strong absorbance at about 600 nm, and they function in electron transfer.48 This type of Cu center is typically coordinated by two His residues

Rmerge = ∑h∑i|Ii(h) − ⟨I(h)⟩|/∑h∑iIi(h), where Ii(h) and ⟨I(h)⟩ are the ith and mean measurements of the intensity of reflection h. bRpim = ∑h[(1/n − 1)1/2]∑i|Ii(h) − ⟨I(h)⟩|/∑h∑iIi(h), where Ii(h) and ⟨I(h)⟩ are the ith and mean measurements of the intensity of reflection h and n is the redundancy of reflection h and was calculated with unmerged intensities using PHENIX merging statistic utilities. cRwork = ∑h∥Fo(h)| − |Fc(h)∥/∑h|Fo(h)|, where Fo(h) and Fc(h) are the observed and calculated structure factors, respectively. No I/σ cutoff was applied. dRfree was calculated from 5% of the total data set randomly selected that was not used in the refinement. a

regions, and 96.3% of all residues were in favored regions (Table 1). In the final refined structure, there was one vicilin molecule in the crystallographic asymmetric unit with 355 protein residues located in the electron density map. Eight residues at the N-terminal and nine residues at the C-terminal of the mature protein could not be located in the electron density map and were not included in the refined structure. Two flexible loop regions (residues N241−A261 and G342− H355) were also not located in the structure. In addition, the final structure included 30 water molecules, 1 glycerol molecule, 1 phosphate ion, and 1 metal ligand. Flame atomic absorption spectrometry was used to determine the identity of the metal ligand of vicilin. The results indicated that there was one copper ion in each vicilin molecule. No Ni, Zn, Mg, Mn, Ca, Fe, or Al ions could be detected in the sample (data not shown). The overall structure of pine nut vicilin consists of an Nterminal domain and a C-terminal domain. Each assumes a cupin fold, and the two domains are symmetrically related about a pseudodyad axis. Three vicilin molecules form a doughnut-shaped trimer through head-to-tail association (Figure 2). The structures of several 7S seed storage proteins from other plants have been reported, including adzuki bean (PDB 2EAA), mung bean (PDB 2CV6), soybean (PDB 1UIK and 1IPK), kidney bean (PDB 2PHL), jack bean (PDB 2CAU), and peanut (PDB 3S7I and 3SMH). All these previously reported structures, however, were from legumes, and they did not contain any metal ligands. 224

dx.doi.org/10.1021/jf4039887 | J. Agric. Food Chem. 2014, 62, 222−228

Journal of Agricultural and Food Chemistry

Article

and a Cys residue in a trigonal planar arrangement with an additional axial Met coordinated, distorting the geometry toward tetrahedral. Type II Cu centers lack the strong, distinctive absorbance at 600 nm and have no evident color. The amino acid coordination and geometries of type II Cu centers are diverse.49 A typical type II Cu center is coordinated with four His residues in a square pyramidal geometry and is generally considered not to have a Cys ligand.50 The Cu center in pine nut vicilin has features of both type I and type II Cu sites. Its ligands include the side chain sulfur of a Cys residue, but it was colorless and the absorbance spectra of the protein were featureless in the visible region (data not shown). Unlike in type I proteins where both the His residues bind to the Cu ion through ND1,51 H379 in Korean pine vicilin interacts with the Cu ion through its NE2. In addition, the distance between the sulfur of C338 and the Cu ion (2.36 Å) is longer than its counterpart in a typical type I copper protein.52 Thus, it does not fit a type I copper protein, and for now, we will group it in the more divergent type II category. 3.4. Possible Copper Binding in Other Vicilin Orthologues. Free copper ions in the cell can be toxic even at low concentrations, so the ability of certain proteins to bind copper might provide a mechanism to detoxify the cell. It is unclear whether the existence of a copper ligand of the 7S protein is unique to Korean pine. It is also unclear whether this copper center of the vicilin protein has an important biological

Figure 3. Type II copper center in pine nut vicilin. (a) Ball-and-stick representation of copper coordination in vicilin. The distances (Å) are shown next to the dotted lines between the copper ion and its coordinating residues. Atom colors are gray, red, blue, yellow, and bronze for C, O, N, S, and Cu, respectively. (b) Coordination geometry parameters about the copper. The lines between the copper ion and its coordinating atoms are shown in the same orientation as in (a). The angles formed by two distances connecting the Cu and two of its coordination atoms are shown in degrees.

Figure 4. Multiple sequence alignments of vicilins from different species. The sequence of Korean pine vicilin isolated in this study was aligned with those of other species identified by a BLAST search of the nonredundant protein sequence (NR) database at NCBI (see the text). The coppercoordinating residues in pine nut vicilin, and the corresponding conserved residues in other vicilins, are shown in red. Only the alignments around the copper-coordinating residues are shown. (a) Vicilins with conserved copper-coordinating residues and a possible copper center. (b) Vicilins without the copper-coordinating residues conserved. These include the 7S proteins for which the crystal structures were reported previously (and for whose structures were solved the PDB access codes were also used to label the sequences). 225

dx.doi.org/10.1021/jf4039887 | J. Agric. Food Chem. 2014, 62, 222−228

Journal of Agricultural and Food Chemistry

■

function. To assess whether the copper-binding property is shared by vicilins from other species, ClustalW was used to align available vicilin sequences from different species. The copper-coordinating residues in pine nut are conserved in the 7S seed storage proteins of Picea glauca (white spruce, NR accession number CAA44873), Juglans nigra (black walnut, AAM54366), Juglans regia (English walnut, AAF18269), Carya illinoinensis (pecan, ABV49593), Pistacia vera (pistachio, ABO36677), Anacardium occidentale (cashew, AAM73730), Corylus avellana (hazelnut, AAL86739), Cucurbita maxima (winter squash, BAA34056), Sesamum indicum (sesame, AAK15089), and Solanum lycopersicum (tomato, CAP69670). On the other hand, the copper-coordinating residues are not universally conserved in the 7S storage proteins in a number of legumes. These include the 7S proteins in Vigna angulariz (adzuki bean, 2EAA_A), Vigna radiata var. radiata (mung bean, 2CV6_A), Glycine max (soybean, 1UIK_A (conglycinin α) and 1IPK_A (conglycinin β)), Phaseolus vulgaris (kidney bean, 2PHL_A), Canavalia ensiformis (jack bean, 2CAU_A), and Arachis hypogaea (peanut, P43238). These residues are also not conserved in the extensively studied model plant Arabidopsis thaliana (thale cress, NP_566714). Regardless of whether the copper-coordinating residues are presented or not, many of these vicilins have been identified as food allergens, including Ara h 1 in peanut, Gly m 5 in soybean, Vig r 2 in mung bean, Ses I 3 in sesame, Cor a 11 in hazelnut, Ana o 1 in cashew, Pis v 3 in pistachio, Jug r 2 in English walnut, and Jug n 2 in black walnut. Thus, the presence of a copper center is unlikely to be related to the allergenicity of the 7S proteins. Multiple sequence alignments of pine nut vicilin and its orthologues with and without the conserved copper coordination residues are shown in parts a and b, respectively, of Figure 4. The alignment of the full sequences of these 7S proteins is shown in the Supporting Information (Figure S2). Coppercoordinating residues are conserved in a large number of seed plants, including conifers and a subset of flowering plants, suggesting that copper is a ligand of vicilin in these species. Copper is an essential trace element in nearly all organisms.53 As a seed storage protein, besides preserving nitrogen, carbon, and sulfur for the development of young plants, no other biological function for vicilin is known. The identification of pine nut vicilin as a copper protein indicates that it may have a function in copper reservation. The biological roles of copper include transportation of dioxygen and iron, electron transfer, oxidation of organic substrates and metal ions, and reduction of nitrite, nitrous oxide, an dioxygen.54 The diverse category of proteins with a type II Cu center also includes peptidylglycine α-hydroxylating monooxygenase whose function requires two copper centers55 and galactose oxidase whose activity involves a covalently modified tyrosine.56 To our knowledge, the 7S seed storage protein has not been reported to contain a copper center. The copper center of pine vicilin does not readily reveal a possible biological function. As the copper ion binds to residues from both the N- and C-terminal domains of the protein, it may contribute to the stability of the protein. Future investigations are needed to unveil whether the presence of a copper ligand is required by an unknown catalytic activity of vicilin in pine and other plants. Further studies on whether copper centers exist in the vicilins from other species may result in valuable information and provide insights into the molecular evolution of this seed storage protein and reveal the nutritional value of this type of abundant copper-binding protein in seeds.

Article

ASSOCIATED CONTENT

S Supporting Information *

Figures showing the coding sequence of Korean pine vicilin and its translated peptide sequence and sequence alignment of 7S proteins. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Authors

*Phone: 301-594 2114. E-mail: [email protected]. *Phone: 510-559-5981. Fax: 510-559-5818. E-mail: yuzhu. [email protected]. Present Addresses ⊥

T.J.: Structural Immunobiology Unit, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, United States. # Y.-W.C.: MERIAL Ltd., Duluth, GA 30601, United States. Funding

Use of the APS was supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Contract W-31-109-Eng-38. This work was partially supported by a fund from the Illinois Institute of Technology and by Cooperative Agreement 5U01FD003801 between the U.S. Food and Drug Administration and Institute for Food Safety and Health, Illinois Institute of Technology. Notes

The authors declare no competing financial interest. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

■

ACKNOWLEDGMENTS X-ray diffraction data were collected at the Southeast Regional Collaborative Access Team (SER-CAT) 22-ID beamline at the Advanced Photon Source (APS), Argonne National Laboratory.

■

REFERENCES

(1) Jackson, K. D.; Howie, L. D.; Akinbani, L. J. Trends in allergic conditions among children: United States, 1997−2011; NCHS Data Brief No. 121, May 2013. http://www.cdc.gov/nchs/data/databriefs/ db121.pdf (accessed Sept 5, 2013). (2) Wang, J.; Sampson, H. A. Food anaphylaxis. Clin. Exp. Allergy 2007, 37, 651−60. (3) Asero, R.; Ballmer-Weber, B. K.; Beyer, K.; Conti, A.; Dubakiene, R.; Fernandez-Rivas, M.; Hoffmann-Sommergruber, K.; Lidholm, J.; Mustakov, T.; Oude Elberink, J. N.; Pumphrey, R. S.; Stahl Skov, P.; van Ree, R.; Vlieg-Boerstra, B. J.; Hiller, R.; Hourihane, J. O.; Kowalski, M.; Papadopoulos, N. G.; Wal, J. M.; Mills, E. N.; Vieths, S. IgE-mediated food allergy diagnosis: Current status and new perspectives. Mol. Nutr. Food Res. 2007, 51, 135−47. (4) Sampson, H. A. Update on food allergy. J. Allergy Clin. Immunol. 2004, 113, 805−19, quiz p 820. (5) Pons, L.; Palmer, K.; Burks, W. Towards immunotherapy for peanut allergy. Curr. Opin. Allergy Clin. Immunol 2005, 5, 558−62. (6) de Leon, M. P.; Rolland, J. M.; O’Hehir R, E. The peanut allergy epidemic: Alergen molecular characterisation and prospects for specific therapy. Expert Rev.Mol.Med. 2007, 9, 1−18. (7) Li, X. M.; Srivastava, K.; Grishin, A.; Huang, C. K.; Schofield, B.; Burks, W.; Sampson, H. A. Persistent protective effect of heat-killed Escherichia coli producing “engineered,” recombinant peanut proteins in a murine model of peanut allergy. J. Allergy Clin. Immunol. 2003, 112, 159−67.

226

dx.doi.org/10.1021/jf4039887 | J. Agric. Food Chem. 2014, 62, 222−228

Journal of Agricultural and Food Chemistry

Article

Korean pine (Pinus koraiensis). J. Agric. Food Chem. 2008, 56, 8159− 8165. (30) Jin, T.; Fu, T.-J.; Kothary, M. H.; Howard, A.; Zhang, Y.-Z. Crystallization and initial crystallographic characterization of a vicilintype seed storage protein from Pinus koraiensis. Acta Crystallogr. 2007, F63, 1041−3. (31) Otwinowski, Z.; Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 1997, 276, 307−326. (32) McCoy, A. J.; Grosse-Kunstleve, R. W.; Storoni, L. C.; Read, R. J. Likelihood-enhanced fast translation functions. Acta Crystallogr. 2005, D61, 458−464. (33) Storoni, L. C.; McCoy, A. J.; Read, R. J. Likelihood-enhanced fast rotation functions. Acta Crystallogr. 2004, D60, 432−438. (34) Vagin, A. A.; Steiner, R. A.; Lebedev, A. A.; Potterton, L.; McNicholas, S.; Long, F.; Murshudov, G. N. REFMAC5 dictionary: Organization of prior chemical knowledge and guidelines for its use. Acta Crystallogr. 2004, D60, 2184−95. (35) Potterton, E.; Briggs, P.; Turkenburg, M.; Dodson, E. A graphical user interface to the CCP4 program suite. Acta Crystallogr. 2003, D59, 1131−1137. (36) Adams, P. D.; Afonine, P. V.; Bunkoczi, G.; Chen, V. B.; Davis, I. W.; Echols, N.; Headd, J. J.; Hung, L. W.; Kapral, G. J.; GrosseKunstleve, R. W.; McCoy, A. J.; Moriarty, N. W.; Oeffner, R.; Read, R. J.; Richardson, D. C.; Richardson, J. S.; Terwilliger, T. C.; Zwart, P. H. PHENIX: A comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. 2010, D66, 213−21. (37) Emsley, P.; Cowtan, K. Coot: Model-building tools for molecular graphics. Acta Crystallogr. 2004, D60, 2126−32. (38) Laskowski, R. A.; MacArthur, M. W.; Moss, D. S.; Thornton, J. M. PROCHECK: A program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 1993, 26, 283−291. (39) Lovell, S. C.; Davis, I. W.; Arendall, W. B., 3rd; de Bakker, P. I.; Word, J. M.; Prisant, M. G.; Richardson, J. S.; Richardson, D. C. Structure validation by Cα geometry: ϕ,ψ and Cβ deviation. Proteins 2003, 50, 437−50. (40) Sayle, R. A.; Milner-White, E. J. RASMOL: Biomolecular graphics for all. Trends Biochem. Sci. 1995, 20, 374. (41) Kraulis, P. J. MOLSCRIPT: A program to produce both detailed and schematic plots of protein structures. J. Appl. Crystallogr. 1991, 24, 946−950. (42) Merritt, E. A.; Murphy, M. E. Raster3D version 2.0. A program for photorealistic molecular graphics. Acta Crystallogr. 1994, D50, 869−73. (43) Engh, R. A.; Huber, R. Accurate bond and angle parameters for X-ray protein structure refinement. Acta Crystallogr. 1991, A47, 392− 400. (44) Cabanillas, B.; Cheng, H.; Grimm, C. C.; Hurlburt, B. K.; Rodriguez, J.; Crespo, J. F.; Maleki, S. J. Pine nut allergy: Clinical features and major allergens characterization. Mol. Nutr. Food Res. 2012, 56, 1884−93. (45) Burks, A. W.; Shin, D.; Cockrell, G.; Stanley, J. S.; Helm, R. M.; Bannon, G. A. Mapping and mutational analysis of the IgE-binding epitopes on Ara h 1, a legume vicilin protein and a major allergen in peanut hypersensitivity. Eur. J. Biochem. 1997, 245, 334−9. (46) Belle, C.; Rammal, W.; Pierre, J. L. Sulfur ligation in copper enzymes and models. J. Inorg. Biochem. 2005, 99, 1929−36. (47) Canters, G. W.; Gilardi, G. Engineering type 1 copper sites in proteins. FEBS Lett. 1993, 325, 39−48. (48) Rubino, J. T.; Franz, K. J. Coordination chemistry of copper proteins: How nature handles a toxic cargo for essential function. J. Inorg. Biochem. 2012, 107, 129−43. (49) MacPherson, I. S.; Murphy, M. E. Type-2 copper-containing enzymes. Cell. Mol. Life Sci. 2007, 64, 2887−99. (50) McGuirl, M. A.; Dooley, D. M. Copper proteins with type 2 sites. Encyclopedia of Inorganic Chemistry; John Wiley & Sons, Ltd.: Hoboken, NJ, 2006. (51) Katz, A. K.; Shimoni-Livny, L.; Navon, O.; Navon, N.; Bock, C. W.; Glusker, J. P. Copper-binding motifs: Structural and theoretical aspects. Helv. Chim. Acta 2003, 86, 1320−1338.

(8) Sampson, H. A.; Mendelson, L.; Rosen, J. P. Fatal and near-fatal anaphylactic reactions to food in children and adolescents. N. Engl. J. Med. 1992, 327, 380−4. (9) Yunginger, J. W.; Sweeney, K. G.; Sturner, W. Q.; Giannandrea, L. A.; Teigland, J. D.; Bray, M.; Benson, P. A.; York, J. A.; Biedrzycki, L.; Squillace, D. L.; Helm, R. M. Fatal food-induced anaphylaxis. JAMA, J. Am. Med. Assoc. 1988, 260, 1450−2. (10) Beardslee, T. A.; Zeece, M. G.; Sarath, G.; Markwell, J. P. Soybean glycinin G1 acidic chain shares IgE epitopes with peanut allergen Ara h 3. Int. Arch. Allergy Immunol. 2000, 123, 299−307. (11) de Leon, M. P.; Drew, A. C.; Glaspole, I. N.; Suphioglu, C.; O’Hehir, R. E.; Rolland, J. M. IgE cross-reactivity between the major peanut allergen Ara h 2 and tree nut allergens. Mol. Immunol. 2007, 44, 463−71. (12) Liang, C.; Wang, G.; Liu, L.; Ji, G.; Fang, L.; Liu, Y.; Carter, K.; Webb, J. S.; Dean, J. F. ConiferEST: an integrated bioinformatics system for data reprocessing and mining of conifer expressed sequence tags (ESTs). BMC Genomics 2007, 8, 134. (13) Cordenunsi, B. R.; De Menezes Wenzel, E.; Genovese, M. I.; Colli, C.; De Souza Goncalves, A.; Lajolo, F. M. Chemical composition and glycemic index of Brazilian pine (Araucaria angustifolia) seeds. J. Agric. Food Chem. 2004, 52, 3412−6. (14) FAO. Pine nuts. Non-Wood Forest Products from Conifers; Publications Division, Food and Agriculture Organization (FAO) of the United Nations: Rome, Italy, 1998. (15) Geisler, M.; Huntrods, D. Pine nuts profile. http://www.agmrc. org/commodities__products/nuts/pine-nuts-profile/ (ccessed Sept 5, 2013). (16) Ö zgüven, F.; Vursavuş, K. Some physical, mechanical and aerodynamic properties of pine (Pinus pinea) nuts. J. Food Eng. 2005, 68, 191−196. (17) Nergiz, C.; Dönmez, I. Chemical composition and nutritive value of Pinus pinea L. seeds. Food Chem. 2004, 86, 365−368. (18) Venkatachalam, M.; Sathe, S. K. Chemical composition of selected edible nut seeds. J. Agric. Food Chem. 2006, 54, 4705−14. (19) USDA National Nutrient Database for Standard Reference. http://www.nal.usda.gov/fnic/foodcomp/search/ (accessed Sept 5, 2013). (20) Año,́ M. A.; Maselli, J. P.; Sanz Mf, M. L.; Fernandez-Benitez, M. Allergy to pine nut. Allergol. Immunopathol. 2002, 30, 104−8. (21) Garcia-Menaya, J. M.; Gonzalo-Garijo, M. A.; Moneo, I.; Fernandez, B.; Garcia-Gonzalez, F.; Moreno, F. A 17-kDa allergen detected in pine nuts. Allergy 2000, 55, 291−3. (22) Roux, K. H.; Teuber, S. S.; Sathe, S. K. Tree nut allergens. Int. Arch. Allergy Immunol. 2003, 131, 234−44. (23) Allergen nomenclature. http://www.allergen.org/Allergen.aspx (accessed Sept 5, 2013). (24) Jin, T.; Guo, F.; Chen, Y.-w.; Howard, A.; Zhang, Y.-Z. Crystal structure of Ara h 3, a major allergen in peanut. Mol. Immunol. 2009, 46, 1796−804. (25) Cabanos, C.; Urabe, H.; Tandang-Silvas, M. R.; Utsumi, S.; Mikami, B.; Maruyama, N. Crystal structure of the major peanut allergen Ara h 1. Mol. Immunol. 2011, 49, 115−23. (26) Chruszcz, M.; Maleki, S. J.; Majorek, K. A.; Demas, M.; Bublin, M.; Solberg, R.; Hurlburt, B. K.; Ruan, S.; Mattisohn, C. P.; Breiteneder, H.; Minor, W. Structural and immunologic characterization of Ara h 1, a major peanut allergen. J. Biol. Chem. 2011, 286, 39318−27. (27) Jin, T.; Albillos, S. M.; Guo, F.; Howard, A.; Fu, T. J.; Kothary, M. H.; Zhang, Y. Z. Crystal structure of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin. J. Agric. Food Chem. 2009, 57, 8643−51. (28) Vasco-Mendez, N. L.; Soriano-Garcia, M.; Moreno, A.; Castellanos-Molina, R.; Paredes-Lopez, O. Purification, crystallization, and preliminary X-ray characterization of a 36 kDa amaranth globulin. J. Agric. Food Chem. 1999, 47, 862−6. (29) Jin, T.; Albillos, S. M.; Chen, Y. W.; Kothary, M. H.; Fu, T. J.; Zhang, Y. Z. Purification and characterization of the 7S vicilin from 227

dx.doi.org/10.1021/jf4039887 | J. Agric. Food Chem. 2014, 62, 222−228

Journal of Agricultural and Food Chemistry

Article

(52) Guss, J. M.; Bartunik, H. D.; Freeman, H. C. Accuracy and precision in protein structure analysis: Restrained least-squares refinement of the structure of poplar plastocyanin at 1.33 Å resolution. Acta Crystallogr. 1992, B48, 790−811. (53) Nakamura, K.; Go, N. Function and molecular evolution of multicopper blue proteins. Cell. Mol. Life Sci. 2005, 62, 2050−66. (54) Frausto da Silva, J. J. R.; Williams, R. J. P. The Biological Chemistry of the Elements: The Inorganic Chemistry of Life, 2nd ed.; Oxford University Press: New York, 2001. (55) Siebert, X.; Eipper, B. A.; Mains, R. E.; Prigge, S. T.; Blackburn, N. J.; Amzel, L. M. The catalytic copper of peptidylglycine αhydroxylating monooxygenase also plays a critical structural role. Biophys. J. 2005, 89, 3312−9. (56) Rokhsana, D.; Dooley, D. M.; Szilagyi, R. K. Systematic development of computational models for the catalytic site in galactose oxidase: Impact of outer-sphere residues on the geometric and electronic structures. J. Biol. Inorg. Chem. 2008, 13, 371−83.

228

dx.doi.org/10.1021/jf4039887 | J. Agric. Food Chem. 2014, 62, 222−228