Crystal Structures and Inhibitor Interactions of Mouse and Dog MTH1

Subscriber access provided by the University of Exeter

Article

Crystal Structures and Inhibitor Interactions of Mouse and Dog MTH1 Reveal Species-Specific Differences in Affinity Mohit Narwal, Ann-Sofie Jemth, Robert Gustafsson, Ingrid Almlöf, Ulrika Warpman Berglund, Thomas Helleday, and Pål Stenmark Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b01163 • Publication Date (Web): 27 Dec 2017 Downloaded from http://pubs.acs.org on December 30, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Crystal Structures and Inhibitor Interactions of Mouse and Dog MTH1 Reveal Species-Specific Differences in Affinity Mohit Narwal1#€, Ann-Sofie Jemth2#, Robert Gustafsson1, Ingrid Almlöf 2, Ulrika Warpman Berglund2, Thomas Helleday2*, Pål Stenmark1*

1Department

2Science

of Biochemistry and Biophysics, Stockholm University, S-106 91, Stockholm, Sweden

for Life Laboratory, Division of Translational Medicine and Chemical Biology, Department

of Medical Biochemistry and Biophysics, Karolinska Institutet, S-171 21 Stockholm, Sweden.

#

Authors contributed equally to this work

Running title: Crystal structures of Mouse and Dog MTH1

1 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT

MTH1 hydrolyzes oxidized nucleoside triphosphates, thereby sanitizing the nucleotide pool from oxidative damage. This prevents incorporation of damaged nucleotides into DNA, which otherwise would lead to mutations and cell death. The high level of reactive oxygen species in cancer cells leads to a higher level of oxidized nucleotides in cancer cells compared to non-malignant cells making cancer cells more dependent on MTH1 for survival. The possibility to specifically target cancer cells by inhibiting MTH1 has highlighted MTH1 as a promising cancer target. Progression of MTH1 inhibitors into the clinic requires animal studies and knowledge about species differences in potency of inhibitors are of vital importance. We here show that the human MTH1 inhibitor TH588 is approximately twenty fold less potent for inhibition of mouse MTH1 compared to human, rat, pig, and dog MTH1. We present the crystal structures of mouse MTH1 in complex with TH588 and dog MTH1 and elucidate the structural and sequence basis for the observed difference in affinity for TH588. We identify amino acid residue 116 in MTH1 as an important determinant for TH588 affinity. Furthermore, we present the structure of mouse MTH1 in complex with the substrate 8oxo-dGTP. The crystal structures provide insight into the high degree of structural conservation between MTH1 from different organisms and provide a detailed view of interactions between MTH1 and the inhibitor, revealing that minute structural differences can have a large impact on affinity and specificity.

Keywords MTH1, MutT, Cancer biology, NUDT1, Inhibitor, TH588, 8-oxo-dGTP, oxidative stress, hydrolase, nucleoside/nucleotide analogue INTRODUCTION


Page 2 of 47

Page 3 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

The MutT homolog 1 (MTH1) belongs to the superfamily of Nudix hydrolases, which is found in all classes of organisms.(1) The Nudix hydrolase superfamily is characterized by a conserved 23residue sequence segment (GX5EX7REUXEEXGU), where U is isoleucine, leucine, or valine and X could be any amino acid residue. Members of the Nudix family of proteins catalyze the hydrolysis of a variety of substrates such as nucleoside di- and triphosphates, dinucleoside and diphosphoinositol polyphosphates, nucleotide sugars and RNA caps.(2-4) MTH1 is found in the nucleus and cytoplasm as well as in mitochondria and its main function is believed to be to sanitize the oxidized dNTP pool.(5, 6) For example, MTH1 converts 8-oxo-dGTP and 2-OH-dATP to 8-oxodGMP and 2-OH-dAMP, respectively (Figure 1A). Other known substrates of MTH1 are 2-OH-ATP and 8-oxo-dATP.(7-9) Free nucleotides have been reported to be approximately 13,000 times more susceptible to modifications compared to when present in DNA.(10, 11) If incorporated into DNA, oxidized nucleotides can cause mutations and cell death highlighting the importance of their removal from the nucleotide pool through MTH1 catalyzed hydrolysis.(12-14) Compared to normal cells, cancer cells are known to have dysfunctional redox balance, which increases the levels of oxidized nucleotides. MTH1 has been shown to be required for the survival of cancer cells,(15-20) although some recent reports are questioning this assertion.(21-23) However, we have recently shown that increasing oxidative stress in non-cancerous cells can increase their sensitivity to MTH1 inhibition.(24) This suggests that MTH1 could be targeted, in general, to treat cancers characterized by redox imbalance. Potent MTH1 inhibitors have been developed and we have previously solved the crystal structure of human MTH1 (hsMTH1) in complex with the inhibitors TH588 and TH287.(15) To avoid pitfalls during the continued optimization of MTH1 inhibitors it is of great value to have detailed knowledge about similarities and differences between MTH1 proteins of potential model organisms and the hsMTH1 protein and we therefore worked towards expanding the panel of


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

purified MTH1 proteins and MTH1 structures of these model organisms and solved the structure of mouse MTH1 (mmMTH1) and dog MTH1 (clMTH1). In addition, since progression of MTH1 inhibitors into clinical trials requires animal studies it is important to understand if there are any differences of hsMTH1 inhibitors in inhibiting MTH1 from different species. This is especially important when using animal models to establish a safe starting dose and when evaluating possible side effects. Furthermore, differences in inhibitory potency of MTH1 inhibitors between species are of crucial importance in the use of MTH1 inhibitors in different animal cancer models. For that reason we set out to investigate the potency of the hsMTH1 inhibitor TH588 (Figure 1B) to inhibit MTH1 from dog, mouse, rat, zebrafish, pig and human. TH588 were found to display a similar potency towards MTH1 from human, dog, rat, pig and zebrafish while the IC50 value of TH588 for mmMTH1 was found to be 20-fold higher as compared to the human enzyme. To unravel the basis for the observed species difference in TH588 affinity for MTH1 we crystallized mmMTH1 in complex with TH588 and solved the crystal structure to get detailed information about protein inhibitor interactions. We made use of the recently reported crystal structure of zebrafish MTH1 (drMTH1) in complex with TH588(24), which together with the mouse and dog MTH1 structures presented herein allowed for comparison of MTH1 structures and made it possible to elucidate the structural and sequence basis for the difference in inhibitory potency of TH588 between species. We used mutational and structural analysis of wild-type and mutant mmMTH1 to identify the amino acid residue in position 116 to be an important determinant in affecting the affinity for TH588, although not being an active site residue. We also present the crystal structure of mmMTH1 in complex with the substrate 8-oxo-dGTP.

Analysis of the crystal structures show a high degree of structural conservation between MTH1 proteins of different species and provide a detailed picture of interactions between MTH1 and the


Page 4 of 47

Page 5 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

inhibitor, revealing that minute structural differences can have a large impact on affinity and specificity.

Figure 1.

Figure 1: (A) Enzymatic reaction catalyzed by MTH1. (B) Chemical structure of the inhibitor TH588.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

MATERIALS AND METHODS

Production of MTH1 proteins. cDNAs encoding MTH1 from dog (Canis lupus familiaris; cl, clMTH1, Uniprot ID: F1P963), mouse (Mus musculus; mm, mmMTH1, Uniprot ID: P53368), pig (Sus scrofa; ss, ssMTH1, Uniprot ID: I3LKZ3) and rat (Rattus norvegicus; rn, rnMTH1, Uniprot ID: P53369) were purchased as codon optimized for E. coli expression from Eurofins or GeneArt (ThermoFisher SCIENTIFIC) and subcloned into pET28a(+) (Novagen) using NdeI and NotI. Expression plasmids were transformed into E.coli BL21 (DE3) R3 pRARE2 (clMTH1, ssMTH1 and rnMTH1) or BL21 (DE3) T1R pRARE2 (mmMTH1). Overnight cultures in Terrific Broth (TB) media (Formedium) with 34 µg/mL chloramphenicol and 50 µg/mL kanamycin was used to inoculate TB media supplemented with 8 g/L glycerol and the same antibiotics. Cultures were incubated at 37 °C in LEX system until OD600 reached 2. Temperature was lowered to 18 °C and expression was induced with 0.5 mM IPTG. After expression for 16 hours bacteria were harvested using centrifugation. Bacteria were lysed in lysis buffer (100 mM HEPES, pH 8, 500 mM NaCl, 10 mM Imidazole, 10% (v/v) glycerol, 0.5 mM TCEP) supplemented with 250 U benzonase (Sigma-Aldrich), and EDTA-free protease inhibitor (Roche) using pulsed sonication. Lysate was cleared using centrifugation and was after filtering loaded on a HisTrap HP column (GE Healthcare) pre-equilibrated with binding buffer (20 mM HEPES pH 7.5, 500 mM NaCl, 10% (v/v) glycerol, 10 mM imidazole, 0.5 mM TCEP) at 4 °C. The column was washed with wash buffer (30 mM HEPES pH 7.5, 500 mM NaCl, 10% (v/v) glycerol, 50 mM imidazole, and 0.5 mM TCEP) and protein was eluted with the same buffer containing 500 mM imidazole. Protein was further purified on a HiLoad 16/60 Superdex 75 prep grade column using gel filtration buffer (20 mM HEPES pH 7.5, 300 mM NaCl, 10% (v/v) glycerol, 0.5 mM TCEP). Fractions were analyzed using SDS-PAGE and fractions containing the target proteins were pooled and TCEP was added to a final concentration of 2 mM. The proteins were concentrated using Vivaspin concentration filters (Vivascience, 10kDa cut-off). Protein


Page 6 of 47

Page 7 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

concentration was measured using nanodrop (Saveen Werner) and protein was flash-frozen in liquid nitrogen and stored in aliquots at -80 °C. Zebrafish MTH1 (danio rerio, drMTH1, Uniprot ID: Q7ZWC3) and human MTH1 (homo sapiens, hsMTH1, Uniprot ID: P36639) were produced as described earlier.(9, 15, 24) IC50-value determination. IC50 values were essentially determined as previously described.(15) Briefly, TH588 was serially diluted in a 1:3 dilution series. The assay buffer consisted of 100 mM Tris-acetate pH 8.0, 40 mM NaCl, 10 mM MgAcetate, 1 mM DTT and 0.005% (v/v) Tween 20. Final concentration of all MTH1 proteins and dGTP was 4.75 nM and 100 μM, respectively. Inorganic pyrophosphatase (Sigma Aldrich) was added to a final well volume of 100 µL at a concentration of 0.2 U/mL. Controls lacking enzyme or inhibitor were included on the assay plate. The reaction mixture was incubated with shaking at 22° C for 20 minutes (hsMTH1, ssMTH1), 30 minutes (drMTH1) and 200 min (rnMTH1, mmMTH1 and clMTH1) followed by addition of 25 µL malachite green assay reagent and incubation with shaking for 15 minutes at 22° C.(25) The absorbance at 630 nm was measured using a Hidex plate reader. IC50 values were determined by fitting the equation log [inhibitor] vs response - variable slope using nonlinear regression, to the inhibition data using the GraphPad Prism Software. For comparison, IC50 values were also determined for TH1579 for hsMTH1, ssMTH1, rnMTH1, mmMTH1 and clMTH1 as described for TH588 above. Specific activity measurements of MTH1 protein with 8-oxodGTP and dGTP. Specific activity of MTH1 proteins from human, dog, pig, rat and mouse was determined with 8-oxo-dGTP and dGTP. For this experiment, 100 µM 8-oxo-dGTP was incubated with 0.95 nM enzyme and 100 µM dGTP was incubated with 9.5 nM enzyme in assay buffer fortified with pyrophosphatase (0.2U/mL) at 22 °C for 30 minutes. Produced Pi was measured using the malachite green based assay as described above. Data points were recorded in triplicate.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 47

Crystallization of mmMTH1 with TH588. Crystals were obtained using sitting-drop vapor diffusion method in a 96-well plate. Protein solution was mixed with 2 mM TH588 and 2 mM TCEP and was incubated for 30 minutes at room temperature. 0.1 µL of protein solution (16.54 mg/mL) was mixed with 0.1 µL of well solution consisting of 0.2 M potassium thiocyanate and 20% (w/v) PEG 3350. The plate was incubated at 20 °C, and crystals grew within 1 week. Crystals were picked up with a loop, submerged into cryo solution (0.2 M potassium thiocyanate, 20% (w/v) PEG 3350, 20% (v/v) ethylene glycol, and 2 mM TH588) and were flash frozen in liquid nitrogen. Crystallization of mmMTH1 with 8-oxodGTP. Protein crystallization was performed using sitting-drop vapor diffusion method in a 96-well plate. Protein solution was mixed with 6 mM MgCl2, 2 mM TCEP and 10 mM 8-oxo-dGTP and was incubated for 30 minutes on ice. 0.15 µL of protein solution (16.54 mg/mL) was mixed with 0.05 µL of well solution consisting of 0.2 M ammonium nitrate, 34% (w/v) PEG 3350 and 0.01 M copper (II) chloride dihydrate. The plate was incubated at 20 °C, and crystals were formed within 1 week. Crystals were soaked in soaking solution containing 10 mM 8-oxo-dGTP. Crystals were put into cryo solution supplemented with 20 % (v/v) ethylene glycol and were flash frozen in liquid nitrogen. Production of mmMTH1L116M and hsMTH1M116L. mmMTH1 was found to have a lot lower affinity for TH588 compared to hsMTH1. Analysis of the structures showed no differences in the active site. However, mmMTH1 has a Leucine in position 116 where hsMTH1 and other analyzed species have a Methionine. In order to understand the impact of this residue on binding to TH588 the M116L mutation was introduced into hsMTH1 and the L116M mutation was introduced into mmMTH1. This was performed using the method described by Li and coworkers(26) and the oligos: mmMTH1L116MFor

TGCCGACATGTGGCCGGATGACAGC,

CGGCCACATGTCGGCAAAGGGGATC

,

TAAAGATCTGTGGCCTGATGATAGCTATTGG,

mmMTH1L116MRev hsMTH1M116LFor hsMTH1M116LRev


Page 9 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

AGGCCACAGATCTTTAAACGGAATCTGATC, Phusion master mix (Thermo Scientific), 10 ng of pET28a(+)mmMTH1 or pET28a(+)hsMTH1 and an annealing temperature of 55 °C. Sequencing verified successful mutagenesis and correctness of the sequence. The mmMTH1 and hsMTH1 mutants were expressed and purified as described for the wild type proteins. Specific activity measurements of mmMTH1WT and hsMTH1WT and mutants with dGTP. mmMTH1 was found to display a lower activity with dGTP relative to 8-oxo-dGTP compared to other tested MTH1 enzymes. Since the amino acid in position 116 was found to influence the affinity to the inhibitor TH588 we hypothesized that it also might affect substrate specificity. In order to understand the role of amino acid residue 116 in activity with dGTP we determined the specific activity of hsMTH1 WT, mmMTH1 WT, hsMTH1 M116L and mmMTH1 L116M with dGTP in parallel. For this experiment, 100 µM dGTP was incubated with 4.75 nM enzyme in assay buffer fortified with pyrophosphatase (0.2U/mL) at 22 °C for 30 minutes. Produced Pi was measured using the malachite green based assay as described above. Data points were recorded in at least quadruplicates. Crystallization of mmMTH1 L116M mutant with TH588. Protein crystallization was performed using sitting-drop vapor diffusion method in a 96-well plate. Protein solution was mixed with 6 mM MgCl2, 2 mM TCEP and 10 mM TH588 and was incubated for 45 minutes on ice. 0.15 µL of protein solution (16.01 mg/mL) was mixed with 0.05 µL of well solution consisting of 0.2 M ammonium nitrate, 34% (w/v) PEG 3350 and 0.01 M copper (II) chloride dihydrate. The plate was incubated at 20 °C, and crystals were formed within 2 weeks. Crystals were placed in cryo solution supplemented with 38% (v/v) glycerol and 10 mM TH588 and were flash frozen in liquid nitrogen. Crystallization of clMTH1. Crystals were obtained using sitting-drop vapor diffusion method in a 96-well plate. Protein was incubated with 6 mM MgCl2, and 2 mM TCEP for 30 minutes on ice before setting up the plate. Crystals were obtained after mixing protein solution (18.74 mg/mL)


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

with well solution (0.1 M Sodium acetate, pH 3.5, 0.2 M Li2SO4, 0.5% (w/v) n-octyl-beta-D-glucoside and 34% (w/v) PEG 6000) in a 3:1 ratio. Plate was incubated at 20 °C and crystals grew in 2 days. Crystals were flash frozen in liquid nitrogen for data collection. mmMTH1 and clMTH1 crystallographic studies. Data collection was performed on beamline 14.1 at BESSY, Berlin, Germany,(27) and on beamline ID30A-3 (MASSIF-3) at ESRF, Grenoble, France(28) at 100 K. Data reduction and processing was carried out, using mosflm and XDS, programs from the CCP4 suite (Collaborative Computational Project 4, 1994).(29-31) The structures were solved via molecular replacement, using the previously solved human MTH1 structure as search model (PDB code: 3ZR1)(9). For the mmMTH1 L116M mutant structure, the mmMTH1 structure solved in this study (5MZG) was used as search model. Refmac was used for refinement and Coot was used for manual building of the model. Data and refinement statistics are shown in Table 3. All structure figures were prepared using PyMOL. The structures have been deposited in the protein data bank with accession codes 5MZE (mmMTH1 in complex with 8-oxodGTP), 5MZF (clMTH1), 5MZG (mmMTH1 in complex with TH588) and 6EHH (mmMTH1 L116M mutant in complex with TH588).


Page 10 of 47

Page 11 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

RESULTS Potency of hsMTH1 inhibitors towards MTH1 from different species. We have previously described the development of the potent MTH1 inhibitor TH588 towards hsMTH1.(15) Since further development to progress MTH1 inhibitors into clinical trials will make use of animal studies we decided to investigate the inhibitory potency of TH588 towards MTH1 from other relevant species. We successfully produced MTH1 proteins from dog, mouse, rat, pig, and zebrafish and determined IC50 values of the inhibitor TH588 for these MTH1 enzymes as well as for the human protein (Table 1 and Figure 2A). IC50 values were similar for all species except for mmMTH1 for which TH588 displayed a 20-fold lower potency compared to hsMTH1 (Table 1 and Figure 2A). In order to check if this observed lower potency towards mmMTH1 is unique for TH588 we also determined IC50 values for the TH588 analogue TH1579(32) towards MTH1 of other species including mmMTH1. Like for TH588 the potency of TH1579 towards mmMTH1 was found to be considerably lower compared to the potency for hsMTH1 (60-fold) and MTH1 from the other species tested (Table 2). Residue 116 is in close proximity to the active site and mmMTH1 has a Leucine instead of Methionine as for the other homologues (Figure 2B) and was therefore hypothesized to play a role in the observed selectivity of hsMTH1 inhibitors towards hsMTH1 over mmMTH1.

Figure 2.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2: mmMTH1 is not inhibited by TH588 to the same extent as MTH1 of other species. (A) Inhibition curves of TH588 for MTH1 from human, pig, zebrafish, dog, rat and mouse. Mean and standard error of mean of duplicates is shown. (B) Close up view to highlight the M116L difference in mmMTH1 (blue) compared to hsMTH1 (pink). The structures of mmMTH1 (blue) and hsMTH1 (pink) (PDB code 4N1U)(15) are overlaid. The structures have a Cα-RMSD of 0.48Å over 152 residues calculated by PDBeFOLD.(33) The H-bond between Asp120 of mmMTH1 and TH588 is shown as a dashed line (black).

Specific activity measurements. In order to understand if also differences in MTH1 activity exist between species we determined the specific activity of MTH1 from mouse, rat, dog, pig and human with the substrates 8-oxodGTP and dGTP (Figure 3A and B). Results show that all enzymes are active towards both substrates, indicating that these activities have been conserved through evolution. It is apparent that the relative level of 8-oxo-dGTP activity of the MTH1 enzymes generally is accompanied with a similar relative level of dGTP activity. A distinct exception to this is mmMTH1 that clearly displays a lower activity with dGTP (Figure 3A). However, by mutating


Page 12 of 47

Page 13 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Leucine 116 in mmMTH1 into Methionine the specific activity with dGTP increases and results in a relative specific activity value in the same range as for the hsMTH1 enzyme (Figure 3C). Interestingly, when the same residue in hsMTH1 is mutated from Methionine to Leucine this causes a considerable drop in activity with dGTP showing the importance of residue 116 in influencing the activity towards this substrate (Figure 3C).

Figure 3.

Figure 3: Specific activities of MTH1 from different species. Specific activity of MTH1 with dGTP is influenced by the amino acid residue in position 116. Specific activities of MTH1 from human, dog, pig, rat and mouse were assayed with (A) dGTP and (B) 8-oxo-dGTP. Data shown represents formed [PPi] (µM) per [enzyme] (µM) per second. A630 was converted to [Pi] (µM) using the equation A630=0.01743[Pi] determined from a Pi standard curve. (C) Comparison of the specific activities with dGTP of mmMTH1, mmMTH1 L116M and hsMTH1 M116L relative to hsMTH1.

Sequence alignment of MTH1 proteins. MTH1 proteins from human, dog, mouse, rat and pig have a high degree of sequence similarity. However also small differences in sequence can have a large impact on the active site structure and the potency of inhibitors.(34) The sequence identity


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

compared to hsMTH1 is 90% for dog, 84% for mouse, 89% for pig, 84% for rat and 71% for zebrafish. A structure based sequence alignment is presented in Figure 4. Interestingly, mmMTH1 and rat MTH1 (rnMTH1) have a sequence identity of 96%. In spite of this very high sequence identity we show that there is a large difference in affinity for TH588 between mmMTH1 and rnMTH1 exemplifying the importance of also investigating seemingly small differences between species. All residues within the first coordination sphere of the TH588 are conserved between MTH1 from human, mouse and dog.


Page 14 of 47

Page 15 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 4.

Figure 4: MTH1 proteins from different species are highly similar. Sequence alignment of MTH1 from human, zebrafish, pig, mouse, rat and dog is shown. Red boxes mark conserved residues and white boxes weakly conserved residues.

Binding mode of TH588 in mmMTH1 and clMTH1. We have previously reported the structure of TH588 in complex with hsMTH1 (PDB code 4N1U)(15) and drMTH1 (PDB code 5HZX)(24). Here we have determined the apo crystal structure of clMTH1 and the co-crystal structures of mmMTH1 and mmMTH1 L116M mutant in complex with TH588. The structures were solved at 1.9 Å, 1.85 Å, and 2.4 Å, respectively (Table 3). Structure analysis showed that the amino acid residues making up the


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

active site of clMTH1 and mmMTH1 are identical to hsMTH1. Therefore, TH588 binds to mmMTH1 in a similar fashion as in the hsMTH1-TH588 complex. TH588 is clearly defined in the electron density map. The aminopyrimidine ring of TH588 makes π-π stacking with Trp117 in the active site. The amine and nitrogen of the aminopyrimidine moiety of the compound make hydrogen bonds with Asp119, Asp120 and Asn33 (Figure 5). A disulfide bond is formed between the Cys134 residues of monomer A and B in the asymmetric unit. However, since Cys134 is not conserved and the disulfide bond is distant from the active site this is likely an artifact of the crystallization (Figure 4). In the apo crystal structure of clMTH1, there are 4 protein molecules in the asymmetric unit of the crystal, for clarity only monomer A is described. In clMTH1 all residues of the substrate-binding site are conserved compared to the human protein and an acetate molecule originating from the crystallization buffer is bound at the active site as previously observed in hsMTH1 (PDB id 3ZR1).(9) The His-tag and /or linker is observed in Chain A and chain B of apo clMTH1 protein and chain A of mmMTH1-TH588 complex. However, since it is not close to the active site they do not influence the binding of TH588.


Page 16 of 47

Page 17 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 5.

Figure 5: Crystal structures of MTH1 from different species highlighting key residues for TH588 binding. (A) Crystal structure of hsMTH1 in complex with TH588 (PDB code 4N1U)(15). (B) Apo crystal structure of clMTH1. (C) mmMTH1 and (D) drMTH1 in complex with TH588 (PDB code 5HZX)(24). Residues within 6 Å from TH588 are displayed as lines. Key residues (N33, D119, D120 and W117) and residues that differ between hsMTH1 and drMTH1 within 6 Å from TH588 are shown as sticks. Hydrogen bonds are shown as black dashed lines. The Fo-Fc omit map, contoured at 2.0 σ is shown for TH588 bound to mmMTH1 in C.

Structure analysis explains the lower inhibitory potency of TH588 for mmMTH1. IC50 values for MTH1 proteins from different organisms presented here are similar to IC50 values reported


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

earlier for hsMTH1 and drMTH1.(15, 24) TH588 inhibits MTH1 from human, dog, rat, pig and zebrafish with similar potency (Figure 2 and Table 1). However, the potency towards mmMTH1 was approximately twenty-fold lower. In order to explain the observed lower potency of TH588 towards mmMTH1 compared to MTH1 from human, dog, rat and zebrafish, crystal structures of mmMTH1 and hsMTH1 in complex with TH588 were superimposed (Figure 2B). Analysis of structural differences as well as differences in the interactions with the inhibitor was performed. Although the residues making up the active sites of mmMTH1 and hsMTH1 are identical, amino acid residue 116, neighboring the inhibitor and substrate coordinating Asp120, is a leucine in the mouse enzyme but a methionine in hsMTH1 as well as in MTH1 from rat, zebrafish, pig and dog. We hypothesized that leucine in this position can alter the hydrophobic packing and electrostatic environment around Asp120 that hydrogen bonds to TH588. The changed polarization of Asp120 could lead to a weaker hydrogen bond to the inhibitor that would explain the lower potency of TH588 towards mouse MTH1. To prove our hypothesis, we produced the hsMTH1 M116L and mmMTH1 L116M mutants and performed inhibition studies with TH588. The IC50 value of TH588 of hsMTH1 M116L was determined to be 22.5 nM, which is more than 3-fold higher than the IC50 value for hsMTH1 WT. However, the IC50-value of TH588 for mmMTH1 L116M (32 nM) was more than 4-fold lower than for the mmMTH1 WT protein (138 nM) Table 1, Figure 6A and 6B) showing the importance of this residue in contributing to the binding affinity of the TH588 inhibitor. Furthermore, a crystal structure of mmMTH1 mutant L116M with TH588 was solved at 2.4 Å resolution and compared to hsMTH1 and mmMTH1 with TH588 bound (Figure 6C and 6D). The active site and amino acid 116 now closely resembles the structure of hsMTH1 with TH588 bound.

Figure 6.


Page 18 of 47

Page 19 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 6: The amino acid in position 116 of MTH1 influences the affinity for TH588. Inhibition curves of TH588 for (A) hsMTH1 and hsMTH1 M116L and (B) mmMTH1 and mmMTH1 L116M are shown. Data are presented as mean of data points in duplicate and standard errors of mean. C) Crystal structure of mmMTH1 mutant L116M (green) overlaid with hsMTH1 (pink, PDB code 4N1U)(15) and mmMTH1 (blue), all with TH588 bound. TH588 and key residues (N33, D119, D120 and W117) are shown as sticks as well as amino acid residue L116/M116. D) The Fo-Fc omit map, contoured at 2.0 σ is shown for TH588 in the crystal structure of mmMTH1 L116M (color as in C).


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Crystal structure of mmMTH1 in complex with the substrate 8-oxo-dGTP. 8-oxo-dGTP is believed to be one of the main substrates of MTH1. We crystallized mmMTH1 in complex with 8oxo-dGTP and solved the structure. We were expecting to find MTH1 in complex with the product 8-oxo-dGMP due to MTH1 catalyzed hydrolysis of 8-oxo-dGTP but surprisingly found the substrate 8-oxo-dGTP in the active site of the protein. The reason for poor hydrolysis might be the high concentration of substrate (10 mM) compared to the relatively low concentration of magnesium (6 mM MgCl2) used in the crystallization experiment. The level of free Mg2+, not complexed with 8-oxodGTP, could be very low. However, analysis of the structure showed that occupancy for β- and γphosphates is approximately 50% showing that 50% of the substrate had been converted to product. The enzyme-substrate complex shows that mmMTH1 binds the nucleotide (8-oxo-dGTP) in a similar fashion as previously shown for the hsMTH1 - 8-oxo-dGMP complex (PDB code 3ZR0) (Figure 7B).(9) The amine group and nitrogen from the purine ring of the nucleotide forms hydrogen bonds with the side chains of Asn33, Asp119 and Asp120. The crystal structure shows that the purine ring of the nucleotide makes π-π stacking interactions with Phe72 and Trp117 (Figure 7A). The hydroxyl group attached to the oxolane ring of 8-oxo-dGTP forms hydrogen bonds with Thr8 and a water molecule. Similarly, oxygen from the oxalane ring is hydrogen bonded with a nearby water molecule. Furthermore, the phosphate groups from the substrate form hydrogen bonds with the protein and with neighboring water molecules. The α-phosphate is hydrogen bonded to two neighboring water molecules and to the side chains of Lys23 and Lys38. The βphosphate forms hydrogen bonds with the side chains of Gly36, Glu100 and a water molecule. Similarly, the γ-phosphate interacts with the side chains of Lys38, Glu52 and a water molecule (Figure 7A).

Figure 7.


Page 20 of 47

Page 21 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 7: (A) Crystal structure of mmMTH1 in complex with the substrate 8-oxo-dGTP. Hydrogen bonds are shown as black dashed line and amino acid residues in the vicinity of 8-oxo-dGTP are shown as sticks. (B) The mmMTH1-8-oxo-dGTP complex and 8-oxo-dGMP of the hsMTH1-8-oxodGMP complex (PDB code 3ZR0)(9) are overlaid. (C) The Fo-Fc omit map, contoured at 2.0 σ is shown for 8-oxo-dGTP in the crystal structure of mmMTH1.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

DISCUSSION hsMTH1 has been shown to be a promising drug target against cancer.(15, 32, 35, 36) For successful development of a clinical candidate that can advance into clinical trials for treatment of cancer we need to make use of animal models. To understand which organisms that would be the most suitable model organisms for studying MTH1 inhibitors, we compared the inhibitory potency of the known MTH1 inhibitor TH588 on MTH1 from several different potential model organisms. IC50 values were determined for recombinantly expressed MTH1 proteins from dog, mouse, human, zebrafish, pig and rat (Table 1). In order to investigate if the selectivity of MTH1 inhibitors developed towards the human enzyme over the mouse enzyme is unique to TH588 we also tested a TH588 analogue, TH1579. TH1579 is a potent hsMTH1 inhibitor with good pharmacokinetic properties that was shown to potently inhibit the growth of tumors of patient derived drug resistant malignant melanoma and human colon cancer in mouse xenograft models(32) and is currently used in a Phase I clinical trial. Also with this inhibitor we see a considerably higher IC50 value for mmMTH1 compared to hsMTH1 and other MTH1 enzymes tested (Table 2) showing that not only TH588 is less efficient on mmMTH1. To understand the interactions at the molecular level crystal structures of clMTH1 (apo) and mmMTH1 (TH588 and 8-oxo-dGTP bound) were solved. The protein sequence analysis showed that all of the MTH1 proteins mentioned here are highly similar (Figure 4 and Figure 8). As expected, analysis of crystal structures showed that the amino acids around the binding site of the inhibitor are nearly identical. The residues in the first coordination sphere in the active site are similar between MTH1 from human, mouse, zebrafish and dog. This is visualized in Figure 5 showing all amino acids within a 6 Å distance from TH588. drMTH1 has three amino acid residues that differ compared to human MTH1 while the residues within 6 Å of TH588 are identical between MTH1 from human, mouse and dog. (15, 24) This suggests


Page 22 of 47

Page 23 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

that dog, mouse, rat, pig and zebrafish would be suitable model organisms in order to develop drugs against the hsMTH1 protein. However, inhibition studies revealed that TH588 was twenty fold less potent against mmMTH1. This could be explained by analysis of the TH588 bound crystal structure of mmMTH1. mmMTH1 has a Leucine at position 116, while MTH1 from human, rat, zebrafish, pig, and dog has a Methionine at this position. The close proximity of Leu116 and Asp120 in the mmMTH1 structure could affect the binding of TH588 and render it less potent towards mmMTH1 compared to MTH1 proteins from other organisms. To confirm this, we mutated residue 116 in hsMTH1 and mmMTH1 to Leucine and Methionine, respectively, and determined IC50 values of the mutants and wild-type enzymes for TH588 (Table 1, Figure 6A and 6B). As expected, the mutation caused a decrease in the potency of TH588 by approximately 3-fold for hsMTH1 and an increase in potency towards the mmMTH1 protein by approximately 4-fold (Table 1). In the crystal structure of the mmMTH1 L116M mutant the Methionine perfectly matches the Methionine in hsMTH1 (Figure 6C). This explains the change in potency towards a more hsMTH1-like potency of TH588 for the mutant compared to wild type mmMTH1. Based on these results rat would be a preferred model organism over mouse. All published inhibitors for hsMTH1 binds deep in the active site pocket interacting with Asp120 neighboring residue 116 as described above. It is possible that the majority of these inhibitors display similar species dependence.(15, 16, 22, 23, 37) No easily observed difference in electrostatic surface properties could be observed by comparing the binding pockets of hsMTH1 and mmMTH1. Quantum chemical calculations could possibly be used to explore this interesting question further. Even though the active site is highly similar in structure between the organisms studied, our result shows that knowledge regarding the immediate surroundings of the active site is crucial for drug development. In addition, further optimizations of the inhibitors may extend the inhibitors interactions further from the active site.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

We here describe the crystal structure of mmMTH1 in complex with the substrate 8-oxo-dGTP. The interactions made by the substrate were compared with our previously solved co-crystal structure of hsMTH1 with the product 8-oxo-dGMP (PDB code: 3ZR0) (Figure 7B).(9) 8-oxo-dGTP sits in the binding pocket in a highly similar fashion as the product 8-oxo-dGMP and makes similar interactions as described previously.(9) Analysis of specific activity of mmMTH1 protein with 8-oxodGTP and dGTP shows that mmMTH1 displays a bigger difference in activity between dGTP and 8oxo-dGTP compared to MTH1 of the other species studied (Figure 3). Asp120 makes two hydrogen bonds to the base of 8-oxo-dGTP. The neighboring amino acid in mmMTH1 is Leu116 while MTH1 from human, rat, zebrafish pig, and dog has a Methionine at this position. The different polarization of Asp120 in mmMTH1 compared to the other MTH1 proteins could cause a more favorable binding to 8-oxo-dGTP over canonical dGTP. The 8-oxo modification has been proposed to influence the keto-enol tautomerization and thereby the strength of the hydrogen bonding to MTH1, on the opposite side of the base, contributing to the substrate specificity of MTH1.(9) To investigate this we determined the specific activity of the mmMTH1 L116M mutant using dGTP as substrate. As expected, the activity with dGTP clearly increased showing that Methionine at position 116 is important for the MTH1 activity with dGTP (Figure 3C). This is further supported by a considerable drop in activity when mutating amino acid residue 116 in the human enzyme from Methionine to Leucine (Figure 3C). The crystal structure of mmMTH1 in complex with 8-oxo-dGTP was grown at neutral pH, in contrast to the previous structure of hsMTH1 in complex with the product (8-oxo-dGMP) which is crystallized at pH 4.(9) The positioning of the substrate and the product is, as expected, virtually identical despite the difference in pH (Figure 7B). In conclusion, the results presented here show that dog, rat, pig and zebrafish are good model organisms to study MTH1 pharmacology as well as for studying the effects of inhibitors that we are


Page 24 of 47

Page 25 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

developing and optimizing to be able to advance into clinical trials. The crystal structures of clMTH1 and mmMTH1 proteins provide a detailed view of the structural conservation between MTH1 from different organisms and the TH588 bound mmMTH1 crystal structure provides the exact interactions between MTH1 and the inhibitor. The higher IC50 value of TH588 observed for mmMTH1 need to be considered when designing and analyzing future experiments using mice and this inhibitor.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 8.

Figure 8: Comparison of crystal structures of MTH1 proteins from different species. (A) Crystal structures of clMTH1 (orange), mmMTH1 (blue) and drMTH1 (yellow, PDB code 5HZX)(24) are overlaid on hsMTH1 (pink, PDB code 4N1U)(15). (B) Crystal structure of clMTH1, (C) mmMTH1 and (D) drMTH1. Amino acid residues differing from hsMTH1 are shown as sticks.


Page 26 of 47

Page 27 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

AUTHOR INFORMATION Corresponding Authors 1Pål

2

Stenmark, E-mail: [email protected]. Telephone: +46 8163729.

Thomas Helleday, E-mail: [email protected]. Telephone: +46762828907.

Present addresses €

Paul Scherrer Institute, OFLC/106, 5232 Villigen PSI, Switzerland

Author contributions PS, TH and UW conceived the project and coordinated the study. MN and RG conducted the crystallization experiments and determined the structures presented in the paper and analyzed the results. ASJ subcloned, performed site-directed mutagenesis, expressed and purified proteins and conducted the biochemical assays together with IA and analyzed data. PS, MN, ASJ and RG analyzed data and wrote the manuscript. All authors reviewed the results, contributed to the writing and approved the final version of the manuscript. # These authors contributed equally to this work. ORCID Mohit Narwal 0000-0002-4014-4741 Robert Gustafsson 0000-0002-4854-5531 Pål Stenmark 0000-0003-4777-3417 Ann-Sofie Jemth 0000-0002-7550-1833 Thomas Helleday 000-0002-7384-092X


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Page 28 of 47

Page 29 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Funding sources This work was supported by the Knut and Alice Wallenberg Foundation (T. Helleday and P. Stenmark), the Wenner-Gren Foundation, Clas Groschinskys Foundation, Åke Wibergs Foundation (P. Stenmark), the Göran Gustafsson Foundation, the Swedish Children's Cancer Foundation, the Swedish Pain Relief Foundation, and the Torsten and Ragnar Söderberg Foundation (T. Helleday), the Swedish Cancer Society (T. Helleday and P. Stenmark) and the Swedish Research Council (T. Helleday and P. Stenmark). Notes T. H. has ownership interest in a patent on MTH1 inhibitors. No potential conflicts of interest were disclosed by the other authors.

ACKNOWLEDGMENTS The authors thank Tobias Koolmeister and Martin Henriksson for synthesis of TH588. Furthermore, we thank PSF and the SciLifeLab Drug Discovery and Development platform for help with protein purification and the beamline scientists at BESSY, Germany; ESRF, France; Max-Lab, Sweden and the Swiss Light Source, Switzerland for their support in structural biology data collection.

ABBREVIATIONS MTH1, MutT Homolog 1; IC50, concentration giving half-maximal inhibition; TCEP, tris(2carboxyethyl)phosphine; PEG, polyethylene glycol.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table 1: IC50 Values of TH588 for MTH1 from Different Organisms

Enzyme

IC50 value (nM)

hsMTH1

6.8 ± 0.6

clMTH1

4.0 ± 0.9

mmMTH1

138 ± 2.8

drMTH1

11 ± 5

rnMTH1

6.6 ± 3.0

ssMTH1

3.1 ± 1.5

hsMTH1 M116L

22.5 ± 0.7

mmMTH1 L116M

32 ± 15

*hs (Homo sapiens; human), cl (Canis lupus; dog), mm (Mus musculus; mouse), dr (Danio rerio; zebrafish), rn (Rattus norvegicus; rat), ss (Sus scrofa; pig) *IC50 values were determined from three independent experiments run with data points in at least duplicates. Shown are means and standard deviations.

Table 2. IC50 values of TH1579 for MTH1 from different species


Page 30 of 47

Page 31 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Fold difference of IC50 values relative to IC50 value of hsMTH1

IC50 value for TH1579 (nM)

n

hsMTH1

2.2 ± 1.0

10

1

clMTH1

3.9 ± 0.4

2

1.8

mmMTH1

132 ± 21

2

60

rnMTH1

4.6 ± 2.0

2

2.1

ssMTH1

2.5

1

1.1

Enzyme

*hs (Homo sapiens; human), cl (Canis lupus; dog), mm (Mus musculus; mouse), rn (Rattus norvegicus; rat), ss (Sus scrofa; pig) *IC50 values were determined from runs with data points in at least duplicates. Shown are means and standard deviations from the number of independent experiments performed (n) as indicated in the table.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 47

Table 3: Crystallographic Data Collection and Refinement Statistics Data collection

clMTH1 Apo

mmMTH1 +TH588

mmMTH1 +8-oxo-dGTP

mmMTH1 L116M +TH588

PDB accession codes

5MZF

5MZG

5MZE

6EHH

Beamline

BESSY BL14.1(27)

ESRF ID30A-3(28)

BESSY BL14.1(27)

BESSY BL14.1(27)

Wavelength (Å)

0.918409

0.9677

0.918409

0.9184

No. of images

2000

3600

2000

2000

Exposure time (s)

0.5

0.02

0.2

0.5

Oscillation range (°)

0.1

0.05

0.1

0.1

Transmission (%)

100

5.534

100

100

Detector

PILATUS 6M

PILATUS3 2M

PILATUS 6M

PILATUS 6M

Space group

P21

P212121

P21

P21

a, b, c (Å)

56.5 67.4 93.3

40.0 67.7 123.1

58.5 139.2 58.7

58.7 142.1 58.8

α, β, γ (°)

90, 90.3, 90

90, 90, 90

90, 107.5, 90

90, 107.5, 90

Resolution (Å)

48.4-2.0 (2.1-2.0)

45.6-1.9 (2.0-1.9)

47.3-2.1 (2.2-2.1)

47.4-2.4 (2.492.40)

Rmerge (%)

9.9 (34.5)

7.1 (61.7)

12.8 (51.6)

23.4 (124.5)

I/σ (I)

9.5 (3.7)

16.3 (3.0)

8.0 (2.2)

5.0 (1.1)

Completeness (%)

99.6 (99.8)

100 (100)

99.7 (97.5)

99.0 (95.4)

Redundancy

3.8 (3.9)

6.5 (6.3)

3.8 (3.2)

3.9 (3.8)

CC1/2

99.6 (91.8)

99.9 (90.4)

99.3 (64.1)

98.1 (42.9)

Resolution (Å)

48.4-2.0

45.5-1.9

47.3-2.1

47.4-2.40

No. of unique reflections

47302 (3496)

29434 (1775)

51831 (4149)

35400 (3577)

Refinement


Page 33 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Rwork/Rfree

18.9/23.4

17.9/21.8

20.1/23.9

24.9/29.9

Protein

5299

2510

5025

4976

Inhibitor

-

38

-

76

Substrate

-

-

128

-

Other Ligands

83

27

24

140

Water

398

156

408

261

Protein

17.8

29.5

23.6

27.7

Inhibitor

-

19.8

-

29.0

Substrate

-

-

32.9

-

Other Ligands

41.5

50.7

35.6

41.1

Water

24.9

35.7

32.0

26.6

RSCC** (TH588)

-

0.97

-

0.93

RSCC** (8-oxo-dGTP)

-

-

0.94

-

Bond lengths (Å)

0.008

0.011

0.011

0.006

Bond angles (°)

1.32

1.50

1.64

1.06

Most favorable region

99.7

98.7

98.6

97.7

Additional allowed region

0.2

1.3

1.4

2.3

No. Atoms

B-factors (Å2)

R.m.s. deviations

Ramachandran plot, residues in (%)

*cl (Canis lupus; dog), mm (Mus musculus; mouse) ** Real space correlation coefficient for substrate/inhibitor in chain A.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Page 34 of 47

Page 35 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

REFERENCES 1.

McLennan, A. G. (2006) The Nudix hydrolase superfamily, Cell. Mol. Life Sci. CMLS 63, 123143.

2.

Bessman, M. J., Frick, D. N., and O'Handley, S. F. (1996) The MutT proteins or "Nudix" hydrolases, a family of versatile, widely distributed, "housecleaning" enzymes, J. Biol. Chem. 271, 25059-25062.

3.

Dunckley, T., and Parker, R. (1999) The DCP2 protein is required for mRNA decapping in Saccharomyces cerevisiae and contains a functional MutT motif, EMBO J. 18, 5411-5422.

4.

Steiger, M., Carr-Schmid, A., Schwartz, D. C., Kiledjian, M., and Parker, R. (2003) Analysis of recombinant yeast decapping enzyme, RNA N.Y. N 9, 231-238.

5.

Nakabeppu, Y. (2001) Regulation of intracellular localization of human MTH1, OGG1, and MYH proteins for repair of oxidative DNA damage, Prog. Nucleic Acid Res. Mol. Biol. 68, 7594.

6.

Nakabeppu, Y., Kajitani, K., Sakamoto, K., Yamaguchi, H., and Tsuchimoto, D. (2006) MTH1, an oxidized purine nucleoside triphosphatase, prevents the cytotoxicity and neurotoxicity of oxidized purine nucleotides, DNA repair 5, 761-772.

7.

Fujikawa, K., Kamiya, H., Yakushiji, H., Fujii, Y., Nakabeppu, Y., and Kasai, H. (1999) The oxidized forms of dATP are substrates for the human MutT homologue, the hMTH1 protein, J. Biol. Chem. 274, 18201-18205.

8.

Sakai, Y., Furuichi, M., Takahashi, M., Mishima, M., Iwai, S., Shirakawa, M., and Nakabeppu, Y. (2002) A molecular basis for the selective recognition of 2-hydroxy-dATP and 8-oxo-dGTP by human MTH1, J. Biol. Chem. 277, 8579-8587.

9.

Svensson, L. M., Jemth, A.-S., Desroses, M., Loseva, O., Helleday, T., Högbom, M., and Stenmark, P. (2011) Crystal structure of human MTH1 and the 8-oxo-dGMP product complex, FEBS Lett. 585, 2617-2621.

10.

Donkena, K. V., Young, C. Y. F., and Tindall, D. J. (2010) Oxidative stress and DNA methylation in prostate cancer, Obstet. Gynecol. Int. 2010, 302051.

11.

Topal, M. D., and Baker, M. S. (1982) DNA precursor pool: a significant target for N-methylN-nitrosourea in C3H/10T1/2 clone 8 cells, Proc. Nat. Acad. Sci. U. S. A. 79, 2211-2215.

12.

Ichikawa, J., Tsuchimoto, D., Oka, S., Ohno, M., Furuichi, M., Sakumi, K., and Nakabeppu, Y. (2008) Oxidation of mitochondrial deoxynucleotide pools by exposure to sodium nitroprusside induces cell death, DNA repair 7, 418-430.

13.

Oka, S., Ohno, M., Tsuchimoto, D., Sakumi, K., Furuichi, M., and Nakabeppu, Y. (2008) Two distinct pathways of cell death triggered by oxidative damage to nuclear and mitochondrial DNAs, EMBO J. 27, 421-432.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

14.

Sakumi, K., Furuichi, M., Tsuzuki, T., Kakuma, T., Kawabata, S., Maki, H., and Sekiguchi, M. (1993) Cloning and expression of cDNA for a human enzyme that hydrolyzes 8-oxo-dGTP, a mutagenic substrate for DNA synthesis, J. Biol. Chem. 268, 23524-23530.

15.

Gad, H., Koolmeister, T., Jemth, A.-S., Eshtad, S., Jacques, S. A., Ström, C. E., Svensson, L. M., Schultz, N., Lundbäck, T., Einarsdottir, B. O., Saleh, A., Göktürk, C., Baranczewski, P., Svensson, R., Berntsson, R. P.-A., Gustafsson, R., Strömberg, K., Sanjiv, K., JacquesCordonnier, M.-C., Desroses, M., Gustavsson, A.-L., Olofsson, R., Johansson, F., Homan, E. J., Loseva, O., Bräutigam, L., Johansson, L., Höglund, A., Hagenkort, A., Pham, T., Altun, M., Gaugaz, F. Z., Vikingsson, S., Evers, B., Henriksson, M., Vallin, K. S. A., Wallner, O. A., Hammarström, L. G. J., Wiita, E., Almlöf, I., Kalderén, C., Axelsson, H., Djureinovic, T., Puigvert, J. C., Häggblad, M., Jeppsson, F., Martens, U., Lundin, C., Lundgren, B., Granelli, I., Jensen, A. J., Artursson, P., Nilsson, J. A., Stenmark, P., Scobie, M., Berglund, U. W., and Helleday, T. (2014) MTH1 inhibition eradicates cancer by preventing sanitation of the dNTP pool, Nature 508, 215-221.

16.

Huber, K. V. M., Salah, E., Radic, B., Gridling, M., Elkins, J. M., Stukalov, A., Jemth, A.-S., Göktürk, C., Sanjiv, K., Strömberg, K., Pham, T., Berglund, U. W., Colinge, J., Bennett, K. L., Loizou, J. I., Helleday, T., Knapp, S., and Superti-Furga, G. (2014) Stereospecific targeting of MTH1 by (S)-crizotinib as an anticancer strategy, Nature 508, 222-227.

17.

Parker, A. R., O'Meally, R. N., Oliver, D. H., Hua, L., Nelson, W. G., DeWeese, T. L., and Eshleman, J. R. (2002) 8-Hydroxyguanosine repair is defective in some microsatellite stable colorectal cancer cells, Cancer Res. 62, 7230-7233.

18.

Parker, A. R., O'Meally, R. N., Sahin, F., Su, G. H., Racke, F. K., Nelson, W. G., DeWeese, T. L., and Eshleman, J. R. (2003) Defective human MutY phosphorylation exists in colorectal cancer cell lines with wild-type MutY alleles, J. Biol. Chem. 278, 47937-47945.

19.

Patel, A., Burton, D. G. A., Halvorsen, K., Balkan, W., Reiner, T., Perez-Stable, C., Cohen, A., Munoz, A., Giribaldi, M. G., Singh, S., Robbins, D. J., Nguyen, D. M., and Rai, P. (2015) MutT Homolog 1 (MTH1) maintains multiple KRAS-driven pro-malignant pathways, Oncogene 34, 2586-2596.

20.

Yoshimura, D., Sakumi, K., Ohno, M., Sakai, Y., Furuichi, M., Iwai, S., and Nakabeppu, Y. (2003) An oxidized purine nucleoside triphosphatase, MTH1, suppresses cell death caused by oxidative stress, J. Biol. Chem. 278, 37965-37973.

21.

Kawamura, T., Kawatani, M., Muroi, M., Kondoh, Y., Futamura, Y., Aono, H., Tanaka, M., Honda, K., and Osada, H. (2016) Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival, Sci. Rep. 6, 26521.

22.

Kettle, J. G., Alwan, H., Bista, M., Breed, J., Davies, N. L., Eckersley, K., Fillery, S., Foote, K. M., Goodwin, L., Jones, D. R., Käck, H., Lau, A., Nissink, J. W. M., Read, J., Scott, J. S., Taylor, B., Walker, G., Wissler, L., and Wylot, M. (2016) Potent and Selective Inhibitors of MTH1 Probe Its Role in Cancer Cell Survival, J. Med. Chem. 59, 2346-2361.

23.

Petrocchi, A., Leo, E., Reyna, N. J., Hamilton, M. M., Shi, X., Parker, C. A., Mseeh, F., Bardenhagen, J. P., Leonard, P., Cross, J. B., Huang, S., Jiang, Y., Cardozo, M., Draetta, G.,


Page 36 of 47

Page 37 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Marszalek, J. R., Toniatti, C., Jones, P., and Lewis, R. T. (2016) Identification of potent and selective MTH1 inhibitors, Bioorg. Med. Chem. Lett. 26, 1503-1507. 24.

Bräutigam, L., Pudelko, L., Jemth, A.-S., Gad, H., Narwal, M., Gustafsson, R., Karsten, S., Carreras Puigvert, J., Homan, E., Berndt, C., Berglund, U. W., Stenmark, P., and Helleday, T. (2016) Hypoxic Signaling and the Cellular Redox Tumor Environment Determine Sensitivity to MTH1 Inhibition, Cancer Res. 76, 2366-2375.

25.

Baykov, A. A., Evtushenko, O. A., and Avaeva, S. M. (1988) A malachite green procedure for orthophosphate determination and its use in alkaline phosphatase-based enzyme immunoassay, Anal. Biochem. 171, 266-270.

26.

Li, C., Wen, A., Shen, B., Lu, J., Huang, Y., and Chang, Y. (2011) FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method, BMC Biotechnol. 11, 92.

27.

Mueller, U., Darowski, N., Fuchs, M. R., Forster, R., Hellmig, M., Paithankar, K. S., Puhringer, S., Steffien, M., Zocher, G., and Weiss, M. S. (2012) Facilities for macromolecular crystallography at the Helmholtz-Zentrum Berlin, J. Synchrotron Radiat. 19, 442-449.

28.

Theveneau, P., Baker, R., Barrett, R., Beteva, A., Bowler, M. W., Carpentier, P., Caserotto, H., Sanctis, D. d., Dobias, F., Flot, D., Guijarro, M., Giraud, T., Lentini, M., Leonard, G. A., Mattenet, M., McCarthy, A. A., McSweeney, S. M., Morawe, C., Nanao, M., Nurizzo, D., Ohlsson, S., Pernot, P., Popov, A. N., Round, A., Royant, A., Schmid, W., Snigirev, A., Surr, J., and MuellerDieckmann, C. (2013) The Upgrade Programme for the Structural Biology beamlines at the European Synchrotron Radiation Facility – High throughput sample evaluation and automation, J. Physics: Conference Series 425, 012001.

29.

Battye, T. G. G., Kontogiannis, L., Johnson, O., Powell, H. R., and Leslie, A. G. W. (2011) iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM, Acta Crystallogr. D Biol. Crystallogr. 67, 271-281.

30.

Kabsch, W. (2010) XDS, Acta Crystallogr. D Biol. Crystallogr. 66, 125-132.

31.

Winn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R., Keegan, R. M., Krissinel, E. B., Leslie, A. G. W., McCoy, A., McNicholas, S. J., Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A., and Wilson, K. S. (2011) Overview of the CCP4 suite and current developments, Acta Crystallogr. D Biol. Crystallogr. 67, 235-242.

32.

Warpman Berglund, U., Sanjiv, K., Gad, H., Kalderén, C., Koolmeister, T., Pham, T., Gokturk, C., Jafari, R., Maddalo, G., Seashore-Ludlow, B., Chernobrovkin, A., Manoilov, A., Pateras, I. S., Rasti, A., Jemth, A.-S., Almlöf, I., Loseva, O., Visnes, T., Einarsdottir, B. O., Gaugaz, F. Z., Saleh, A., Platzack, B., Wallner, O. A., Vallin, K. S. A., Henriksson, M., Wakchaure, P., Borhade, S., Herr, P., Kallberg, Y., Baranczewski, P., Homan, E. J., Wiita, E., Nagpal, V., Meijer, T., Schipper, N., Rudd, S. G., Bräutigam, L., Lindqvist, A., Filppula, A., Lee, T.-C., Artursson, P., Nilsson, J. A., Gorgoulis, V. G., Lehtiö, J., Zubarev, R. A., Scobie, M., and Helleday, T. (2016) Validation and development of MTH1 inhibitors for treatment of cancer, Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 27, 2275-2283.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

33.

Krissinel, E., and Henrick, K. (2004) Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions, Acta Crystallogr. D Biol. Crystallogr. 60, 2256-2268.

34.

Kosloff, M., and Kolodny, R. (2008) Sequence-similar, structure-dissimilar protein pairs in the PDB, Proteins 71, 891-902.

35.

Li, L., Song, L., Liu, X., Yang, X., Li, X., He, T., Wang, N., Yang, S., Yu, C., Yin, T., Wen, Y., He, Z., Wei, X., Su, W., Wu, Q., Yao, S., Gong, C., and Wei, Y. (2017) Artificial Virus Delivers CRISPRCas9 System for Genome Editing of Cells in Mice, ACS Nano 11, 95-111.

36.

Russo, M. T., Blasi, M. F., Chiera, F., Fortini, P., Degan, P., Macpherson, P., Furuichi, M., Nakabeppu, Y., Karran, P., Aquilina, G., and Bignami, M. (2004) The oxidized deoxynucleoside triphosphate pool is a significant contributor to genetic instability in mismatch repair-deficient cells, Mol. Cell. Biol. 24, 465-474.

37.

Ellermann, M., Eheim, A., Rahm, F., Viklund, J., Guenther, J., Andersson, M., Ericsson, U., Forsblom, R., Ginman, T., Lindstrom, J., Silvander, C., Tresaugues, L., Giese, A., Bunse, S., Neuhaus, R., Weiske, J., Quanz, M., Glasauer, A., Nowak-Reppel, K., Bader, B., Irlbacher, H., Meyer, H., Queisser, N., Bauser, M., Haegebarth, A., and Gorjanacz, M. (2017) Novel Class of Potent and Cellularly Active Inhibitors Devalidates MTH1 as Broad-Spectrum Cancer Target, ACS Chem. Biol. 12, 1986-1992.


Page 38 of 47

Page 39 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

43x14mm (300 x 300 DPI)

ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

43x14mm (300 x 300 DPI)


Page 40 of 47

Page 41 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

60x20mm (300 x 300 DPI)


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

130x93mm (300 x 300 DPI)


Page 42 of 47

Page 43 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

136x101mm (300 x 300 DPI)


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

180x145mm (300 x 300 DPI)


Page 44 of 47

Page 45 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

69x37mm (300 x 300 DPI)


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

152x156mm (300 x 300 DPI)


Page 46 of 47

Page 47 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

34x27mm (300 x 300 DPI)


Crystal Structures and Inhibitor Interactions of Mouse and Dog MTH1

Recommend Documents