CsFEX, a Fluoride Export Protein Gene from Camellia sinensis

May 6, 2019 - CsFEX, a Fluoride Export Protein Gene from Camellia sinensis, .... Tertiary structure prediction results of the CsFEX protein (Figure S1...
0 downloads 0 Views 10MB Size
Download PDF
Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2019, 67, 5997−6006

CsFEX, a Fluoride Export Protein Gene from Camellia sinensis, Alleviates Fluoride Toxicity in Transgenic Escherichia coli and Arabidopsis thaliana Jiaojiao Zhu, Anqi Xing, Zichen Wu, Jing Tao, Yuanchun Ma, Bo Wen, Xujun Zhu, Wanping Fang, and Yuhua Wang* College of Horticulture, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China Downloaded via NOTTINGHAM TRENT UNIV on July 18, 2019 at 16:47:10 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

S Supporting Information *

ABSTRACT: A fluoride export gene (CsFEX) was newly found and isolated from Camellia sinensis, and its functions in detoxifying F were investigated in transgenic Escherichia coli and Arabidopsis thaliana. CsFEX contains two crcB domains, which is the typical structure in plants. The expression of CsFEX in C. sinensis is tissue-specific and related to maturity of leaves, and its expression is significantly induced by F treatments in different tissues of C. sinensis, particularly in leaves. Additionally, the growth of C. sinensis, E. coli, and A. thaliana can all be inhibited by F treatment. However, the growth of CsFEX-overexpression E. coli was increased with lower F content under F treatment compared to the control. Similarly, the germination and growth of CsFEX-overexpression A. thaliana were enhanced with lower F content under F treatment compared to the wild type. CsFEX relieves F toxicity in the transgenic E. coli and A. thaliana by alleviating F accumulation. KEYWORDS: Camellia sinensis, fluoride export protein, F tolerance/detoxication, transgenic Escherichia coli, transgenic Arabidopsis thaliana

■

INTRODUCTION As one of the main halogens, fluorine is mainly present in the environment as fluoride (F) compounds.1 With human activities,2 industrial pollution,3 and application of chemical phosphate fertilizer,4 the content of F in soil has gradually increased. Studies have found that F is a common phytotoxin in plants via inhibition of enzyme activity5 and photosynthesis,6 resulting in visible damage7,8 and slowing of growth.9 Furthermore, F can be absorbed from both the soil by plant roots or the air by leaves10,11 and then transported and distributed throughout the plant.12 Accumulating reports have shown that the F content of mature leaves of Camellia sinensis is 871−1337 mg kg−1, while the F content of old leaves can exceed 2000 mg kg−1,13 which is 10−100 times higher than that of other plants grown in the same environmental conditions.14−16 Interestingly, tea seedlings accumulate large amounts of F without exhibiting any toxic symptoms, indicating that C. sinensis is a hyperaccumulator with high tolerance to F and has specific mechanisms driving F accumulation/detoxification.17 At present, there are three mechanisms that explain the accumulation and detoxification of F in C. sinensis. Cell wall precipitation and vacuolar compartmentalization prevent F from entering the physiological metabolic center of the protoplast without affecting the normal metabolic activities of C. sinensis cells, which may be one of the mechanisms of the F tolerance observed in C. sinensis.18−20 An alternative mechanism is that chelation of F ions in C. sinensis with free aluminum,21 magnesium, calcium,10,22,23 or tea polysaccharides allows F to exist in C. sinensis in the form of stable fluoride− ligand complexes, thereby reducing F damage to C. sinensis.1,18,24 Additionally, recent reports reveal that F as a © 2019 American Chemical Society

signal triggers the response of the defense gene (RLK) on the plasma membrane and then activates Ca2+ ATPase. Activated Ca2+ ATPase subsequently promotes the absorption and transport of F. This finding indicates that the Ca2+ signaling pathway might be involved in F accumulation/detoxification in C. sinensis.25 However, the complicated molecular mechanisms governing F accumulation/detoxification in C. sinensis remain unclear. Recently, many reports have indicated that the resistance to F toxicity is promoted by the family of F exporters in bacteria and eukaryotes. The exporters are divided into two phylogenetically unrelated categories: the first is a variant in the voltage-gated chloride channel (CLC) superfamily, namely, CLCF. The CLCF genes encode F−/H+ antiporters in eubacteria.26,27 The second is a more broadly distributed family, Fluc (formerly crcB) in bacteria28 and FEX2 in eukaryotes.29 For example, a recent study showed that FEX proteins (including FEX1 and FEX2 proteins) in Saccharomyces cerevisiae function as ion channels that select fluorides over chlorides and that FEX proteins can be constitutively expressed in yeast plasma membranes.30 In addition, studies have shown that FEX protein acts directly in the efflux of fluoride ions.30 Ji et al. believe that microorganisms have developed into a highly selective F channel (Fluc) to cope with the presence of F stress in the environment, which alleviates microbial toxicity by exporting inhibitory F in the cytoplasm to outside of the cell.31 Nicholas et al. concluded that the Fluc Received: Revised: Accepted: Published: 5997

January 25, 2019 April 16, 2019 May 6, 2019 May 6, 2019 DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Article

Journal of Agricultural and Food Chemistry Table 1. Primers Designed in This Studya primer name

sequence (5′ → 3′)

CsFEX-ORF-F CsFEX-ORF-R CsFEX-gate-F CsFEX-gate-R CsFEX-qF CsFEX-qR CsGADPH-qF CsGADPH-qR AtACTIN2-F AtACTIN2-R CsFEX-5′-GPS1 CsFEX-5′-GSP2 CsFEX-3′-GSP1 CsFEX-3′-GSP2 EV-F EV-R

ATGTCATTGCAAGAGGGTA CTAATCATAGCCCATGACCCA GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTCATTGCAAGAGGGTACAAC GGGGACCACTTTGTACAAGAAAGCTGGGTCATCATAGCCCATGACCCAATCAGG GGTAGTTGTATTCACCGC GCATTGTTGGACCTTTCG GGCAGCACCTTACCAACAGC GTTTGGCGTCGTTGAGGGTC CTCCCGCTATGTATGTCGCC TTGGCACAGTGTGAGACACAC CATCATCTTTTTGAGTGGATTCAGC AGAAGAACCAGCACTGCCTGCCCG TGCAACTGGCATACAGTTTGGAC CTTTCATGGCTGAGTTTCACGC ATGAGCCATATTCAACGGGAAA GAAAAACTCATCGAGCATC

annotation cloning of the CsFEX ORF construction of the cloning vector qRT-PCR internal reference gene in C. sinensis internal reference gene in A. thaliana 5′-RACE 3′-RACE verification

a

RACE, rapid amplification of cDNA ends; EV, empty vector. The pre-cultured C. sinensis seedlings were treated with 0 (control), 0.42, and 0.84 mM NaF for 0, 1, 2, and 20 days. The seedlings treated by 0 or 0.84 mM F for 20 days were photographed to record the growth status. The young leaves and new roots were collected after 2 days of treatment at 0, 0.42, and 0.84 mM F and dried at 80 °C for determination of F accumulation. The young leaves (the first and second leaves from the top of plants), old leaves (the first and second leaves from the bottom of plants), roots, flowers, fruit, pollen, and stems of C. sinensis were collected and stored at −80 °C to detect the difference in the expression of CsFEX in C. sinensis. The young leaves, old leaves, roots, and stems of C. sinensis treated with 0.84 mM NaF for 0, 1, and 2 days were collected for expression analysis. In addition, the C. sinensis leaves with different maturity (buds, the first leaf, the second leaf, the third leaf, the fourth leaf, the fifth leaf, and the old leaf) were collected for expression analysis. Isolation and Cloning of the CsFEX Gene. On the basis of the conserved crcB domain, the CsFEX gene was detected from transcriptome data (PRJNA315669) reported by Pan et al.33 The open reading frame (ORF) of CsFEX was acquired by amplification of polymerase chain reaction (PCR) using the primer pairs (CsFEXORF-F/R) listed in Table 1. The amplification product was then purified and cloned into the cloning vector pDONR201 for sequencing. Subsequently, the 5′ and 3′ untranslated region (UTR) sequences of CsFEX were amplified using the specific primers CsFEX5′-GSP1/5′-GSP2 and CsFEX-3′-GSP1/3′-GSP2 (Table 1). Analyses of Sequences and Phylogenetic Relationships. The secondary structure of the CsFEX protein was predicted using the online software SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/ npsa_automat.pl?page=/NPSA/npsa_sopma.html), and the model of the tertiary structure of the CsFEX protein was constructed by SWISS-MODEL (https://www.swissmodel.expasy.org). The homologous sequence was aligned by DNAMAN software. A phylogenetic tree of CsFEX in C. sinensis and FEX in other organisms was constructed using the neighbor-joining method in MEGA6 software. The bootstrap method was used with 1500 replicates; other parameters of the phylogenetic tree were set according to Wang et al.35 RNA Extraction, cDNA Synthesis, and Quantitative RealTime Polymerase Chain Reaction (qRT-PCR) Analysis. Total RNA of C. sinensis was extracted using a Rapid RNA Isolation Kit (TaKaRa, Japan), and then the quality of RNA was assessed using the ONE Drop OD-1000+ spectrophotometer (ONE Drop, U.S.A.). cDNA was obtained with the PrimeScript First Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) following the instructions of the manufacturer. qRT-PCR was performed following the method reported by Wang et al.,36 and the relative expression analysis of the data was performed by the 2−ΔΔCT method.37 The internal reference

family in prokaryotes and lower eukaryotes would alleviate the damage caused by fluorosis. 32 Interestingly, the crcB homologues in eukaryotes (such as Neurospora crassa, S. cerevisiae, and Candida albicans) play a role in the export of F; therefore, Li et al. renamed these genes as fluoride export genes (FEX), and this study directly shows that FEX and Fluc are homologous genes in different organisms.29 On the basis of these studies about F exporters in bacteria and eukaryotes, we speculate that F exporters might also be present in C. sinensis. Nonetheless, to the best of our knowledge, no F exporter gene or protein has yet been identified from C. sinensis. Therefore, this study focused on identifying whether C. sinensis contains a F export gene or protein, conferring its high F tolerance. Interestingly, a fragment containing two crcB domains was identified from our previous reported transcriptomic database (PRJNA315669),33 named CsFEX, which encoded a putative CsFEX protein. The expression of CsFEX in different tissues and different maturity of C. sinensis leaves was analyzed, and its response to exogenous F treatment was detected in C. sinensis. Furthermore, CsFEX was cloned from C. sinensis and transformed into Escherichia coli and Arabidopsis thaliana to detect the response of transgenic E. coli and A. thaliana to F treatments, thereby investigating the functions of CsFEX in F resistance. This study suggests that the CsFEX gene plays an important role in the F tolerance in C. sinensis. To the best of our knowledge, CsFEX is a F export gene, which is newly found in C. sinensis in this study.

■

MATERIALS AND METHODS

Growth Conditions, F Treatment, and Sample Collection. The 1-year-old cutting seedlings of C. sinensis cv. LongjingChangye were collected from Nanjing Ya Run Tea Co., Ltd., China. The tea seedlings with uniform growth were selected, rinsed with doubledistilled water (ddH2O), and used as experimental materials. The seedlings were placed in three plastic containers (four C. sinensis seedlings per plastic container) containing 1 L of 1/2 complete nutrient solution for 2 weeks in a light chamber with a photoperiod of 12 h light (25 ± 2 °C)/12 h dark (20 ± 2 °C) and 70 ± 10% relative water content. Then, the seedlings were pre-cultured in complete medium for 4 weeks before F treatment. The complete nutrient solution was prepared following the method of Ghanati et al.34 The nutrient solutions were refreshed every 5 days, and the pH value was adjusted to 5.0 by 1 M HCl or 1 M NaOH solution every day. 5998

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Article

Journal of Agricultural and Food Chemistry

Figure 1. Effects of F treatment on C. sinensis growth. Changes of young leaves and new roots of C. sinensis treated with different concentrations of F [(A and C) 0 mM control and (B and D) 0.84 mM treatment, respectively] for 20 days. (E) Differences in F content between young leaves and new roots of C. sinensis treated with different concentrations of F for 2 days. Data are presented as the mean ± SD. Letters indicate significant differences at p < 0.05.

Figure 2. Nucleotide sequence and encoded amino acid sequence of CsFEX cDNA.

5999

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Journal of Agricultural and Food Chemistry

Article

■

gene used in this study was CsGAPDH. All experiments were repeated 3 times with independent RNA samples, and the primers were listed in Table 1. Construction of the Prokaryotic Expression Vector and F Tolerance of Transgenic E. coli Cells. The ORF of CsFEX was subcloned from the cloning vector pDONR201 and then ligated into the pET-28a expression vector. The pET-CsFEX recombinant plasmid and the empty vector were used to transform E. coli ROSETTA cells, and proper insertion was confirmed by enzyme digestion and sequencing. To examine the effect of overexpressing CsFEX on the growth of E. coli strains, the empty vector and CsFEX transformed E. coli strains were cultured in lysogeny broth (LB) medium until the optical density at a wavelength of 600 nm (OD600) value reached 0.8; then 5fold serial dilutions were inoculated in solid LB media containing different concentrations of F (0, 5, 50, and 100 mM); and the growth state of the two strains was observed after 12 h. Meanwhile, the transformed E. coli strains with an OD600 value of 1 were added to LB liquid containing different concentrations of F (0, 5, 50, and 100 mM) at a ratio of 1:1000 and then cultured in an oscillating incubator with shaking at 220 rpm at 37 °C. The OD600 value was measured by a spectrophotometer at different times (2, 4, 8, 10, and 12 h), and the curves were plotted with GraphPad Prism software. In addition, to detect the F content in the two strains, the cells were collected after culturing for 10 h under treatment with different concentrations of F. Transformation of CsFEX into A. thaliana. To further confirm the function of CsFEX, CsFEX was amplified using CsFEX-gate-F/R (Table 1) and cloned into pDONR201. It was then recombined into pK7FWG2 to generate the 35S:CsFEX:EGFP construct. Then, the construct was introduced into the Colombia ecotype of A. thaliana by the floral dip method.38 Transgenic A. thaliana was screened on 1/2 Murashige and Skoog (MS) agar media containing 50 μg mL−1 kanamycin. A RT-PCR assay was conducted to verify the integration of CsFEX in positive transgenic A. thaliana using gene-specific primers (CsFEX-gate-F/-R; Table 1), and the AtACTIN2 (AT3G18780) gene in Table 1 was used as a control. All A. thaliana were grown at 22 ± 2 °C in a light incubator with a 16 h light (220 μmol m−2 s−1)/8 h dark cycle. Phenotype Analysis of Transgenic A. thaliana and Subcellular Localization of CsFEX. Wild-type (WT) and transgenic A. thaliana seeds (WT, L-2, L-4, and L-8) were plated on 1/2 MS solid medium with various concentrations of F (0, 4, 6, or 8 mM). After 2 days of vernalization at a low temperature (4 °C), the plates were transferred to a light incubator with a 16 h light (220 μmol m−2 s−1)/8 h dark cycle for 7 days. The germination rate was calculated. The phenotypes of A. thaliana were observed and photographed with a camera after cultured for 14 days with various concentrations of F (0, 4, 6, and 8 mM). Meanwhile, A. thaliana grown for 14 days on 1/2 MS solid media with different concentrations of exogenous F (4 and 6 mM) were harvested for F content detection. To confirm the subcellular localization of CsFEX, signals of CsFEX-EGFP in roots of WT and transgenic A. thaliana were observed by laser confocal microscopy (CarlZeiss LSM710, Germany). Extraction and Determination of F in Samples. To collect bacterial samples, the bacterial liquid was centrifuged at 5000 rpm for 15 min and then resuspended 3 times with ddH2O. To collect plant samples, C. sinensis and A. thaliana samples were collected and weighed. The above bacterial samples and plant samples were placed in 50 mL centrifugal tubes that contained 30 mL of ddH2O and then extracted at 100 °C for 30 min in a water bath. The extraction mixtures were cooled to room temperature and centrifuged at 5000g for 15 min, and then the supernatant was collected to determine the F content using the 9609BNWP fluoride ion selective electrode and 096019 stirrer probe following the description by Gao et al.39 Statistical Analyses. All data in this study were analyzed using SPSS version 17.0 and were presented as the mean ± standard deviation (SD). Significant differences between the experimental data were tested with analysis of variance (ANOVA) and Duncan’s test and were marked by different letters (p < 0.05).

RESULTS Accumulation of F in C. sinensis. The phenotype of tea seedlings was investigated after 20 days of treatment with 0.84 mM F. Long-term F treatment caused the growth of tea seedlings to slow, which was manifested by necrosis of new roots, chlorosis, and scorching of the young leaves (panels A− D of Figure 1). Furthermore, the effects of different concentrations of F on the accumulation of F in new roots and young leaves (the first leaf and the second leaf) were also investigated. The results showed that the F content of new roots and young leaves of C. sinensis in fluorine-free culture medium was 6.71 and 315.85 mg kg−1, respectively. Then, it increased to 241.97 and 335.45 mg kg−1 after treatment with 0.42 mM F for 2 days. It reached 427.57 and 356.45 mg kg−1 after treatment with 0.84 mM F for 2 days. These results indicate that the F content of young leaves and new roots of C. sinensis increased significantly after 2 days of F treatment; the increase in F content in new roots was significantly greater than that of young leaves (Figure 1E). Cloning and Characterization of CsFEX. The full length of the CsFEX cDNA sequence is 2205 bp (Figure 2), which contains a 1443 bp ORF (Figure 3), encodes 480 amino acids

Figure 3. Cloning of the CsFEX ORF.

(predicted molecular weight of 52.391 kDa), and has a theoretical isoelectric point of 6.5. Through SOPMA prediction, CsFEX is composed of 38.96% α-helices, 15.21% extended backbone, 4.79% β-sheets, and 41.04% random coils. The tertiary results of FEX protein are presented in Figure S1 of the Supporting Information. The blast alignment showed that the sequence of CsFEX exhibits high homology to FEX in plants. The phylogenetic analysis of FEX in the organism showed that FEXs are mainly divided into two categories and that the evolutionary relationship of FEXs between C. sinensis and other plants is very close (Figure 4A). Sequence analysis by Pfam showed that FEXs in C. sinensis, Actindia chinensis, Ipomoea nil, and Sesamum indicum contain two conserved crcBlike protein structures (Figure 4B), which is the typical structure in plants. Expression Analysis of CsFEX in C. sinensis. To test the expression profile of CsFEX in C. sinensis, the expression levels of CsFEX were compared in roots, stems, young leaves, old leaves, fruits, flowers, and pollen, and the results showed that the expression level of CsFEX in the pollen and young leaves of 6000

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Article

Journal of Agricultural and Food Chemistry

Figure 4. Sequence analysis: (A) phylogenetic comparison of CsFEX proteins in organisms and (B) sequence alignment of FEXs from A. chinensis (AcFEX), I. nil (InFEX), and S. indicum (SiFEX). The black line marks two conserved domains of crcB.

Figure 5. Expression pattern of CsFEX in C. sinensis: (A) qRT-PCR analysis of CsFEX expression level in the roots, stems, young leaves, old leaves, fruit, flowers, and pollen, (B) qRT-PCR analysis of CsFEX expression in leaves, roots, and stems of C. sinensis in response to F treatment, and (C) expression level of CsFEX in C. sinensis leaves of different maturity.

C. sinensis was significantly higher than that of other organs (Figure 5A), which indicates that the expression of CsFEX in C. sinensis is tissue-specific. Furthermore, as shown in Figure 5B, the expression of CsFEX in different tissues of C. sinensis under F treatment was increased with the increase of F treatment time. The CsFEX expression level increased 7.93-

fold in the young leaves of C. sinensis in response to 0.84 mM F for 2 days compared to plants grown under the control conditions, and the CsFEX expression levels of other organs also slightly increased after F treatment (Figure 5B). Moreover, the expression profiles of CsFEX in C. sinensis leaves (bud, first, second, third, fourth, fifth, and old) with different maturity was 6001

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Article

Journal of Agricultural and Food Chemistry

Figure 6. Effect of CsFEX overexpression on F tolerance in E. coli: (A) effects of different concentrations of F (0, 5, 50, and 100 mM) on the phenotype of empty vector E. coli cells and CsFEX-overexpressed E. coli cells and (B) sensitivity of transgenic E. coli cells to NaF.

difficult to establish, the model plant A. thaliana was employed to overexpress CsFEX to further study its biological functions in the accumulation of F. As shown in Figure 8A, CsFEX overexpression was detected in transgenic A. thaliana lines (L2, L-4, and L-8), but not in WT A. thaliana. The germination rate, growth status, and F accumulation of WT and transgenic lines were detected to investigate whether overexpression of CsFEX in A. thaliana can enhance the tolerance to F stress. The germination rate of WT, L-2, L-4, and L-8 all approached 100% under normal conditions, and the germination rate of WT and overexpressed lines were both inhibited by F treatment in a dose-dependent manner. Moreover, the germination rate was higher in transgenic lines than the WT under the same concentration of F treatment. For example, the germination rates of L-2, L-4, and L-8 were 3.79, 6.05, and 6.87 times that of the WT under 8 mM F, respectively (Figure 8B). The growth rate of WT and overexpressing A. thaliana was significantly inhibited by exogenous F treatment, and the reduction of growth rate of the WT was more severe than transgenic A. thaliana (Figure 8C). Additionally, the F accumulation increased with the increasing concentration of exogenous F in WT and transgenic A. thaliana. Interestingly, the F concentration in transgenic A. thaliana was lower than that of the WT under the same F treatment conditions (Figure 8D). Subcellular Localization of CsFEX in the Roots of A. thaliana. Subcellular localization prediction software WOLF PSORT28 predicts that CsFEX is localized in the plasma membrane. To further validate the subcellular localization of CsFEX, we constructed a CsFEX:GFP fusion protein and transformed it into A. thaliana. As shown in Figure 9, the GFP signal was distributed in the plasma membrane of A. thaliana root cells (panels A−C of Figure 9), while no fluorescence signal was detected in WT A. thaliana root cells (panels D−F of Figure 9). Therefore, these results are consistent with each other.

detected, and the results showed that the relative expression level of CsFEX was lowest in the buds and first leaf, peaked in the second leaf, and then decreased with the increase of leaf maturity (Figure 5C), indicating that the expression of CsFEX in C. sinensis is related to the leaf maturity. Enhanced F Tolerance in E. coli Cells Overexpressing CsFEX. Reverse transcription polymerase chain reaction (RTPCR) was performed to obtain the correct overexpressed CsFEX strain and empty vector strain (Figure S2 of the Supporting Information). The growth of both control and overexpressing strains was inhibited by F treatment in a dosedependent manner. Furthermore, the strain overexpressing CsFEX showed better growth after treatment with 0, 5, 50, and 100 mM F compared to the control (Figure 6A). Simultaneously, the results also showed that the strain overexpressing CsFEX had a higher survival rate when treated with 5, 50, and 100 mM F compared to the empty vector (Figure 6B). In addition, the results showed that the strain overexpressing CsFEX accumulated lower levels of F than the control, indicating that CsFEX functions in enhancing the tolerance of E. coli to F (Figure 7). Enhanced F Tolerance in A. thaliana Overexpressing CsFEX. Because a C. sinensis transgenic system is currently

Figure 7. Effect of overexpression of CsFEX on F accumulation of transgenic A. thaliana lines. 6002

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Article

Journal of Agricultural and Food Chemistry

Figure 8. Effect of overexpression of CsFEX on F tolerance in A. thaliana: (A) RT-PCR identification of CsFEX in transgenic A. thaliana lines, with AtACTIN2 (AT3G18780) used as a control, (B) Differences in germination rates between WT and transgenic A. thaliana exposed to different concentrations of F, (C) WT and transgenic A. thaliana growth for 14 days in response to different concentrations of F, and (D) differences in F content between WT and transgenic A. thaliana.

Figure 9. Subcellular localization of CsFEX protein in root cells of A. thaliana.

■

DISCUSSION

Additionally, the F content of different tissues in C. sinensis exhibits certain regularity, which mainly appears as mature leaf > young leaf > root/stem.13,46 As the tissue with the strongest ability to accumulate F in C. sinensis, the leaves also have the strongest tolerance to F. This study revealed that the F content in tea leaves was approximately 43 times that of new roots under normal conditions, indicating that C. sinensis leaves are the main tissue that accumulates F, which is consistent with the previous findings of Gao et al.19 The report by Zhang et al. suggests that F uptake showed biphasic response patterns following saturable Michaelis−Menten kinetics in the range of low external F while increased linearly with an external supply in the range of high concentrations.47 Here, we found that the F content increased significantly with the increase of the exogenous F concentration, especially in new roots of C.

Recent surveys have indicated that many plants exposed to F often show some morphological symptoms, such as chlorosis and tip and leaf edge necrosis,40−43 suggesting that F is toxic to plants. It is well-known that C. sinensis is a crop that hyperaccumulates F, while many studies have shown this Ftolerant plant also exhibits some physiological and biochemical changes in response to high concentrations of F, including a decrease of photosynthesis, alteration of the leaf antioxidant system, and disruption of the cell ultrastructure.44,45 Similarly, this study showed that high concentrations of exogenous F induced the new roots to turn black, the young leaves to gradually turn yellow, and the edges of the leaves to exhibit scorch symptoms after long-term F treatment (Figure 1A). 6003

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Article

Journal of Agricultural and Food Chemistry sinensis, indicating that the new roots can quickly absorb and transfer F.47 In combination of previous reports and our findings, it is clear that, although C. sinensis is severely impacted by high concentrations of exogenous F, it is still a hyperaccumulator with higher F tolerance compared to other species. However, the molecular mechanism driving F tolerance/detoxification in C. sinensis still remains ambiguous. The recent discovery of F exporters is a breakthrough in exploring the mechanisms of F resistance; therefore, current research is increasingly focusing on F exporters. On the basis of reports in prokaryotes and eukaryotes and our previous transcriptome database (PRJNA315669),33 we identified a fragment that contains two conserved crcB domains, indicating that this fragment is a typical plant FEX; therefore, we named it CsFEX. Furthermore, the expression of CsFEX in C. sinensis was tissue-specific and highest in the young leaves, particularly in the second leaf, and then it was reduced with the increase of leaf maturity. These results indicate that the expression of CsFEX is related to the maturity of C. sinensis leaves, which is closely related to the contents of F.48 With respect to the lower relative expression levels of CsFEX in buds and the first leaf, we speculate that it may result from the fact that the buds and the first leaf have not formed a complete and mature leaf structure compared to the mature leaves. Additionally, the expression of CsFEX in different tissues of C. sinensis can be induced by a high concentration of exogenous F treatment in 2 days, indicating that CsFEX responds to exogenous F triggers indeed. To further confirm the functions of CsFEX, prokaryote E. coli was employed to overexpress CsFEX. Our findings indicate that CsFEX recombinant protein confers enhanced F tolerance and lower F content in transformed E. coli cells. Similarly, Baker et al. reported that the growth of the crcB knockout E. coli strain was significantly inhibited at micromolar concentrations of F, with a minimum inhibitory concentration (MIC) slightly higher than 1 mM, while the growth of WT E. coli cells were significantly inhibited at 30 mM NaF, with a MIC of about 200 mM,27 and Baker et al. also suggests that the crcB protein reduces F toxicity by reducing the concentration of F in E. coli cells. Combining published studies with our findings, we therefore speculate that CsFEX can enhance the tolerance to F toxicity in E. coli cells by reducing F accumulation. With respect to findings of eukaryotes, deletion of the FEX gene in three model eukaryotes (S. cerevisiae, N. crassa, and C. albicans) induces a fluoride-sensitive phenotype, and knockout cells lacking the FEX gene are 200−1000 times more sensitive to F than the corresponding WT strain. This directly demonstrates the importance of FEX in resisting F toxicity.28 To further confirm the mechanism of CsFEX driving F tolerance, model plant A. thaliana was used to construct overexpressing lines in this study. The results of the overexpression study revealed that A. thaliana lines overexpressing CsFEX showed higher germination rates and growth rates with a lower F content compared to the WT under exogenous F treatment. In addition, subcellular localization experiments revealed that CsFEX is localized in the plasma membrane of A. thaliana root cells, which is consistent with the results in yeast.30 Therefore, this study demonstrates that overexpression of CsFEX enhances F tolerance in A. thaliana via reducing the F content. In summary, this is the first study to identify and clone the F-specific export gene CsFEX from C. sinensis. The expression of CsFEX in C. sinensis is tissue-specific and related to the

maturity of leaves; it can be triggered by exogenous F treatment. Furthermore, overexpression of CsFEX in E. coli and A. thaliana confers enhanced tolerance to F toxicity by alleviating F accumulation. These findings directly reveal the effects of CsFEX on alleviating F toxicity. Combining the previous reports and our findings, we speculate that F is passively absorbed by tea plants under high F concentration47 or actively absorbed through some ion channels (such as Ca2+ ATPase),25 and then the putative fluoride export proteins (CsFEX and CsCLCF) are activated to excrete F from the cytoplasm into the cell wall or apoplast to alleviate F toxicity. On the other way, excess F can be separated into vacuoles to reduce the toxicity (Figure 10). However, the accurate molecular mechanisms of F accumulation, toxicity/detoxification, and resistance in C. sinensis warrant more attention to decipher.

Figure 10. Speculated graphic model of CsFEX functions in C. sinensis. Combining the previous reports and our findings, we speculate that F is passively absorbed by tea plants under high F concentration47 or actively absorbed through some ion channels (such as Ca2+ ATPase),25 and then the putative fluoride export proteins (CsFEX and CsCLCF) are activated to excrete F from the cytoplasm into the cell wall or apoplast to alleviate F toxicity. On the other way, excess F can be separated into vacuoles to reduce the toxicity.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.9b00509. Tertiary structure prediction results of the CsFEX protein (Figure S1) (PDF) RT-PCR identification of CsFEX in transgenic E. coli cells (Figure S2) (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Telephone/Fax: +86-25-84395182. E-mail: wangyuhua@ njau.edu.cn. ORCID

Xujun Zhu: 0000-0001-8932-4324 Yuhua Wang: 0000-0002-3126-2682 Funding

This work was supported by the National Natural Science Foundation of China (31770733), the earmarked fund for China Agriculture Research System (CARS-19), and the earmarked fund for Jiangsu Agricultural Industry Technology System (JATS[2018]280). 6004

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Article

Journal of Agricultural and Food Chemistry Notes

(20) Schneider, T.; Schellenberg, M.; Meyer, S.; Keller, F.; Gehrig, P.; Riedel, K.; Lee, Y.; Eberl, L.; Martinoia, E. Quantitative detection of changes in the leaf-mesophyll tonoplast proteome in dependency of a cadmium exposure of barley (Hordeum vulgare L.) plants. Proteomics 2009, 9 (10), 2668−2677. (21) Ding, R.; Huang, X. Biogeochemical cycle of aluminium and fluorine in tea garden soil system and its relationship to soil acidification. Acta Pedol. Sin. 1991, 28 (3), 229−236. (22) Ruan, J.; Ma, L.; Shi, Y.; Han, W. The impact of pH and calcium on the uptake of fluoride by tea plants (Camellia sinensis L.). Ann. Bot. 2004, 93 (1), 97. (23) Arnesen, A. K. M. Availability of fluoride to plants grown in contaminated soils. Plant Soil 1997, 191 (1), 13−25. (24) Cai, H. M.; Peng, C. Y.; Chen, J.; Hou, R. Y.; Gao, H. J.; Wan, X. C. X-ray photoelectron spectroscopy surface analysis of fluoride stress in tea (Camellia sinensis (L.) O. Kuntze) leaves. J. Fluorine Chem. 2014, 158 (158), 11−15. (25) Li, Q.-S.; Lin, X.-M.; Qiao, R.-Y.; Zheng, X.-Q.; Lu, J.-L.; Ye, J.H.; Liang, Y.-R. Effect of fluoride treatment on gene expression in tea plant (Camellia sinensis). Sci. Rep. 2017, 7 (1), 9847. (26) Stockbridge, R. B.; Lim, H.-H.; Otten, R.; Williams, C.; Shane, T.; Weinberg, Z.; Miller, C. Fluoride resistance and transport by riboswitch-controlled CLC antiporters. Proc. Natl. Acad. Sci. U. S. A. 2012, 109 (38), 15289−15294. (27) Baker, J. L.; Sudarsan, N.; Weinberg, Z.; Roth, A.; Stockbridge, R. B.; Breaker, R. R. Widespread genetic switches and toxicity resistance proteins for fluoride. Science 2012, 335 (6065), 233−235. (28) Stockbridge, R. B.; Robertson, J. L.; Kolmakova-Partensky, L.; Miller, C. A family of fluoride-specific ion channels with dualtopology architecture. eLife 2013, 2, e01084. (29) Li, S.; Smith, K. D.; Davis, J. H.; Gordon, P. B.; Breaker, R. R.; Strobel, S. A. Eukaryotic resistance to fluoride toxicity mediated by a widespread family of fluoride export proteins. Proc. Natl. Acad. Sci. U. S. A. 2013, 110 (47), 19018−19023. (30) Smith, K. D.; Gordon, P. B.; Rivetta, A.; Allen, K. E.; Berbasova, T.; Slayman, C.; Strobel, S. A. Yeast Fex1p is a constitutively expressed fluoride channel with functional asymmetry of its two homologous domains. J. Biol. Chem. 2015, 290 (32), 19874. (31) Ji, C.; Stockbridge, R. B.; Miller, C. Bacterial fluoride resistance, Fluc channels, and the weak acid accumulation effect. J. Gen. Physiol. 2014, 144 (3), 257−261. (32) Last, N. B.; Kolmakova-Partensky, L.; Shane, T.; Miller, C. Mechanistic signs of double-barreled structure in a fluoride ion channel. eLife 2016, 5, e18767. (33) Pan, J.; Wang, W.; Li, D.; Shu, Z.; Ye, X.; Chang, P.; Wang, Y. Gene expression profile indicates involvement of NO in Camellia sinensis pollen tube growth at low temperature. BMC Genomics 2016, 17 (1), 809. (34) Ghanati, F.; Morita, A.; Yokota, H. Effects of aluminum on the growth of tea plant and activation of antioxidant system. Plant Soil 2005, 276 (1−2), 133−141. (35) Wang, Y.; Shu, Z.; Wang, W.; Jiang, X.; Li, D.; Pan, J.; Li, X. CsWRKY2, a novel WRKY gene from Camellia sinensis, is involved in cold and drought stress responses. Biol. Plant. 2016, 60 (3), 443. (36) Wang, W.; Wang, Y.; Du, Y.; Zhao, Z.; Zhu, X.; Jiang, X.; Shu, Z.; Yin, Y.; Li, X. Overexpression of Camellia sinensis H1 histone gene confers abiotic stress tolerance in transgenic tobacco. Plant Cell Rep. 2014, 33 (11), 1829−1841. (37) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25 (4), 402−408. (38) Clough, S. J.; Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16 (6), 735−743. (39) Gao, H.; Zhang, Z.; Wan, X. Influences of charcoal and bamboo charcoal amendment on soil-fluoride fractions and bioaccumulation of fluoride in tea plants. Environ. Geochem. Health 2012, 34 (5), 551− 562.

The authors declare no competing financial interest.

■

REFERENCES

(1) Yang, Y.; Liu, Y.; Huang, C.-F.; de Silva, J.; Zhao, F.-J. Aluminium alleviates fluoride toxicity in tea (Camellia sinensis). Plant Soil 2016, 402 (1−2), 179−190. (2) Cronin, S. J.; Neall, V. E.; Lecointre, J. A.; Hedley, M. J.; Loganathan, P. Environmental hazards of fluoride in volcanic ash: A case study from Ruapehu volcano, New Zealand. J. Volcanol. Geotherm. Res. 2003, 121 (3−4), 271−291. (3) Mackowiak, C. L.; Grossl, P. R.; Bugbee, B. G. Biogeochemistry of fluoride in a plant-solution system. J. Environ. Qual. 2003, 32 (6), 2230−2237. (4) Loganathan, P.; Hedley, M. J.; Wallace, G. C.; Roberts, A. H. Fluoride accumulation in pasture forages and soils following longterm applications of phosphorus fertilisers. Environ. Pollut. 2001, 115 (2), 275−282. (5) Baroni Fornasiero, R. Fluorides effects on hypericum perforatum plants: First field observations. Plant Sci. 2003, 165 (3), 507−513. (6) Kamaluddin, M.; Zwiazek, J. J. Fluoride inhibits root water transport and affects leaf expansion and gas exchange in aspen (Populus tremuloides) seedlings. Physiol. Plant. 2003, 117 (3), 368− 375. (7) Dey, U.; Mondal, N. K.; Das, K.; Datta, J. K. Dual effects of fluoride and calcium on the uptake of fluoride, growth physiology, pigmentation, and biochemistry of Bengal gram seedlings (Cicer arietinum L.). Fluoride 2012, 45 (4), 389−393. (8) Jha, S. K.; Nayak, A. K.; Sharma, Y. K. Fluoride toxicity effects in onion (Allium cepa L.) grown in contaminated soils. Chemosphere 2009, 76 (3), 353−356. (9) Miller, G. W. The effect of fluoride on higher plants: With special emphasis on early physiological and biochemical disorders. Fluoride 1993, 26 (1), 3−22. (10) Stevens, D. P.; Mclaughlin, M. J.; Alston, A. M. J. Phytotoxicity of the fluoride ion and its uptake from solution culture by Avena sativa and Lycopersicon esculentum. Plant Soil 1998, 200 (2), 119−129. (11) Ruan, J.; Ma, L.; Shi, Y.; Han, W. Uptake of fluoride by tea plant (Camellia sinensis L.) and the impact of aluminium. J. Sci. Food Agric. 2003, 83 (13), 1342−1348. (12) Fung, K. F.; Zhang, Z. Q.; Wong, J. W. C.; Wong, M. H. Fluoride contents in tea and soil from tea plantations and the release of fluoride into tea liquor during infusion. Environ. Pollut. 1999, 104 (2), 197−205. (13) Shu, W. S.; Zhang, Z. Q.; Lan, C. Y.; Wong, M. H. Fluoride and aluminium concentrations of tea plants and tea products from Sichuan Province, PR China. Chemosphere 2003, 52 (9), 1475−1482. (14) Fluorides in the Environment: Effects on Plants and Animals; Weinstein, L. H., Davison, A., Eds.; Centre for Agriculture and Biosciences International (CABI): Wallingford, U.K., 2004; DOI: 10.1079/9780851996837.0000. (15) Ruan, J. Y.; Wong, M. H. Accumulation of fluoride and aluminium related to different varieties of tea plant. Environ. Geochem. Health 2001, 23 (1), 53−63. (16) Xie, Z.; Chen, Z.; Sun, W.; Guo, X.; Yin, B.; Wang, J. Distribution of aluminum and fluoride in tea plant and soil of tea garden in Central and Southwest China. Chinese Geographical Science. 2007, 17 (4), 376−382. (17) Liu, Y.; Cao, D.; Ma, L.; Jin, X.; Yang, P.; Ye, F.; Liu, P.; Gong, Z.; Wei, C. TMT-based quantitative proteomics analysis reveals the response of Camellia sinensis to fluoride. J. Proteomics 2018, 176 (30), 71−81. (18) Gao, H.; Zhu, X.; Panpan, L. I.; Dejiang, N. I.; Chen, Y. Research on adsorption characteristics of tea polysaccharides to fluorine. J. Tea Sci. 2016, 36 (4), 396−404. (19) Gao, H. J.; Zhao, Q.; Zhang, X. C.; Wan, X. C.; Mao, J. D. Localization of fluoride and aluminum in subcellular fractions of tea leaves and roots. J. Agric. Food Chem. 2014, 62 (10), 2313−2319. 6005

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006

Article

Journal of Agricultural and Food Chemistry (40) Fornasiero, R. B. Phytotoxic effects of fluorides. Plant Sci. 2001, 161 (5), 979−985. (41) Kamaluddin, M.; Zwiazek, J. J. Fluoride inhibits root water transport and affects leaf expansion and gas exchange in aspen (Populus tremuloides) seedlings. Physiol. Plant. 2003, 117 (3), 368− 375. (42) Jha, S. K.; Nayak, A. K.; Sharma, Y. K. Fluoride toxicity effects in onion (Allium cepa L.) grown in contaminated soils. Chemosphere 2009, 76 (3), 353−356. (43) Barbier, O.; Arreola-Mendoza, L.; Del Razo, L. M. Molecular mechanisms of fluoride toxicity. Chem.-Biol. Interact. 2010, 188 (2), 319−333. (44) Cai, H. M.; Dong, Y. Y.; Li, Y. Y.; Li, D. X.; Peng, C. Y.; Zhang, Z. Z.; Wan, X. C. Physiological and cellular responses to fluoride stress in tea (Camellia sinensis) leaves. Acta Physiol. Plant. 2016, 38 (6), 144. (45) Li, C.; Zheng, Y.; Zhou, J.; Xu, J.; Ni, D. Changes of leaf antioxidant system, photosynthesis and ultrastructure in tea plant under the stress of fluorine. Biol. Plant. 2011, 55 (3), 563−566. (46) Fung, K. F.; Zhang, Z. Q.; Wong, J. W.; Wong, M. H. Aluminium and fluoride concentrations of three tea varieties growing at Lantau Island. Environ. Geochem. Health 2003, 25 (2), 219−232. (47) Zhang, L.; Li, Q.; Ma, L.; Ruan, J. Characterization of fluoride uptake by roots of tea plants (Camellia sinensis (L.) O. Kuntze). Plant Soil 2013, 366 (1−2), 659−669. (48) Feng, M. L.; Yun, R. J.; Zhi, S. Y. Study on accumulation characteristics of fluorine in tea plants. Acta Agric. Zhejiangensis 2004, 16 (2), 96−98.

6006

DOI: 10.1021/acs.jafc.9b00509 J. Agric. Food Chem. 2019, 67, 5997−6006