Article pubs.acs.org/jnp
Cytotoxic Fusicoccane-Type Diterpenoids from Streptomyces violascens Isolated from Ailuropoda melanoleuca Feces Dan Zheng,†,§,∥ Li Han,†,∥ Xiaodan Qu,† Xiu Chen,‡ Jialiang Zhong,⊥ Xiaoxu Bi,† Jiang Liu,† Yi Jiang,*,‡ Chenglin Jiang,‡ and Xueshi Huang*,† †
Institute of Microbial Pharmaceuticals, College of Life and Health Sciences, Northeastern University, Shenyang 110819, People’s Republic of China ‡ Yunnan Institute of Microbiology, Yunnan University, Kunming 650091, People’s Republic of China § Laboratory of Metabolic Disease Research and Drug Development, China Medical University, Shenyang 110001, People’s Republic of China ⊥ Shanghai Institute of Pharmaceutical Industry, Shanghai 201203, People’s Republic of China S Supporting Information *
ABSTRACT: Six new fusicoccane-type diterpenoids (2−7) were isolated from the fermentation broth of Streptomyces violascens, which was isolated from Ailuropoda melanoleuca (giant panda) feces. The structures of these new compounds were elucidated by a detailed spectroscopic data and X-ray crystallographic analysis. Compounds 5−7 demonstrated cytotoxicity against five human cancer cell lines, with IC50 values ranging from 3.5 ± 0.7 to 14.1 ± 0.8 μM. Cell adhesion, migration, and invasion assays showed that 6 inhibited the migration and invasion of human hepatocellular carcinoma SMMC7721 cells in a dose-dependent manner. Through further investigation, it was revealed that 6 inhibited the enzymatic activity of matrix metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9), in addition to down-regulating the expressions of MMP-2 and MMP-9 at both the protein and mRNA levels to influence the migration and invasion of cancer cells. usicoccane is a unique 5/8/5 tricyclic diterpene. It was first isolated as a glycoside, fusicoccin, from the phytopathogenic fungus Fusicoccum amygdali and named after the fungus,1 which induces a widening of the stomatal pore in the infected leaf. Follow-up studies indicated that fusicoccins targeted the 14-3-3 protein and regulated the plasma membrane H+-ATPase to influence plant growth including stimulating cell elongation, speeding up seed germination, and inducing root formation.2−5 Fusicoccanes are relatively rare in nature, and only about 50 members, including both aglycones and glycosides, in this family were found until now. They were mainly obtained from plant pathogenic fungi2,6−10 and liverworts,2,11−15 although they were also found from algae,2 ferns,2 higher plants,16 and streptomycetes.17,18 With further research, multiple biological activities of fusicoccanes were revealed; for example, periconicins A and B showed antibacterial activity,6 cyclooctatin inhibited lysophospholipase,17,19 and cotylenin A induced differentiation in human carcinoma cell lines.20,21 In the course of our continuing search for bioactive constituents from actinomycetes associated with animal feces, the secondary metabolites of Streptomyces violascens (YIM 100212), which was isolated from Ailuropoda melanoleuca feces, were investigated. A small amount (100 mL) of fermentation broth of S. violascens showed cytotoxic activity and contained diverse compounds illustrated through a bioactive assay
F
© 2017 American Chemical Society and American Society of Pharmacognosy
together with HPTLC and HPLC-MS analysis. Previously 80 L of culture broth of S. violascens was extracted and fractionated, and four prenylindoles were obtained from the strain.22 Targeting several colored compounds without UV absorbance on the HPTLC led to the isolation of six new fusicoccane-type diterpenoid derivatives, 14-hydroxycyclooctatin (2), 12αhydroxycyclooctatin (3), 12β-hydroxycyclooctatin (4), fusicomycin A (5), fusicomycin B (6), and isofusicomycin A (7), along with a known compound, cyclooctatin (1). The structures of the new compounds were elucidated by detailed spectroscopic data and X-ray crystallographic analysis. The cytotoxic effects of 1−7 were evaluated in five human carcinoma cell lines. The antimigration and anti-invasion effects of 6 were evaluated on human hepatocellular carcinoma SMMC7721 cells. Herein, we report the fermentation, isolation, structural elucidation, and cytotoxic activity of new fusicoccane-type diterpenoid derivatives 2−7. The effect of 6 on the activity and expression of matrix metalloproteinases 2 and 9 (MMP-2 and MMP-9) was also analyzed to explore the mechanism of action. Received: July 20, 2016 Published: February 16, 2017 837
DOI: 10.1021/acs.jnatprod.6b00676 J. Nat. Prod. 2017, 80, 837−844
Journal of Natural Products
Article
give a crude extract. The constituents were isolated by repeated column chromatography over silica gel, Sephadex LH-20, and ODS to afford pure compounds 1−7. Compund 2 was isolated as a colorless oil, and the molecular formula was determined to be C20H34O4 by HREIMS. The 1H NMR (Table 1) data of 2 indicates the presence of an olefinic proton at δH = 5.43 (dd, J = 11.5, 7.7 Hz), one oxygenated methine at δH = 4.35 (brt, J = 4.0 Hz), one oxygenated methylene at δH = 3.57 (dd, J = 10.6, 7.7 Hz) and δH = 3.47 (dd, J = 10.6, 6.6 Hz), and four methyls at δH = 1.28, δH = 1.15, δH = 0.90, and δH = 0.76. The 13C NMR (Table 1) data show 20 carbon signals attributed to four carbons without directly bonded protons, six methines, six methylenes, and four methyl carbons on the basis of the HSQC experiment. The 1H and 13C NMR data of 2 were very similar to those of the related compound cyclooctatin (1),17−19 which we also obtained from the same strain. Compared with 1, one more oxygenated carbon was present at δC = 87.2 and one methine was absent. HMBC correlations from H-9 (δH = 5.43), H-15 (δH = 1.80), H-12 (δH = 1.55), H-13 (δH = 1.40), H-19 (δH = 0.76), and H20 (δH = 0.90) to C-14 (δC = 87.2) confirmed that C-14 was oxygenated in 2. The relative configuration of 2 was deduced from a NOESY experiment. The NOE correlations between H6 (δH = 2.03) and H-5 (δH = 4.35), H-16 (δH = 3.57, 3.47), and H3-17 (δH = 1.28) indicate that 3-CH2OH, H-5, H-6, and 7CH3 have a cis configuration; the NOE correlations between H-
■
RESULTS AND DISCUSSION Isolation and Structural Elucidation. The fermentation broth of YIM 100212 was clarified with a centrifuge to obtain 75 L of culture supernatant. The supernatant was absorbed onto the polymeric resin Amberlite XAD-16. Salt and high molecular weight materials were washed out with water, while other organic materials were eluted with an EtOH gradient to
Table 1. 1H (600 MHz) and 13C (150 MHz) NMR Data for Compounds 2−4 2a
a
3b
position
δC, mult
δH, mult (J in Hz)
δC, mult
1
45.9, CH2
33.9, CH2
2 3 4
35.8, CH 44.9, CH 39.7, CH2
5 6 7 8
75.7, 57.2, 78.4, 41.8,
CH CH C CH2
1.61, 1.28, 2.49, 2.52, 1.62, 1.30, 4.35, 2.03,
9 10 11 12
121.2, 155.9, 45.4, 43.3,
CH C C CH2
13
31.0, CH2
14 15 16
87.2, C 35.9, CH 63.4, CH2
17 18 19 20 5-OH 7-OH 12-OH 16-OH
26.7, 25.0, 17.7, 19.2,
CH3 CH3 CH3 CH3
m m m m brt (12.8) brt (12.8) brt (4.0) t (5.1)
2.67, brt (11.5) 1.85, dd (11.5, 7.7) 5.43, dd (11.5, 7.7)
1.55, 1.41, 1.67, 1.40,
m m m m
1.80, 3.57, 3.47, 1.28, 1.15, 0.76, 0.90,
m dd (10.6, 7.7) dd (10.6, 6.6) s s d (7.0) d (7.0)
33.5, CH 43.9, CH 38.9, CH2 73.6, 56.2, 76.3, 41.0,
CH CH C CH2
119.9, 152.5, 46.7, 80.8,
CH C C CH
30.9, CH2 47.5, CH 30.6, CH 61.6, CH2 26.6, 23.2, 18.1, 22.0,
CH3 CH3 CH3 CH3
4b δH, mult (J in Hz) 1.48, 1.02, 2.42, 2.43, 1.61, 1.21, 4.28, 1.75,
m m m m m m m m
2.62, m 1.80, m 5.25, t (10.5)
3.54, m 1.55, 1.46, 2.35, 1.74, 3.48, 3.36, 1.20, 1.14, 0.70, 0.87, 5.57, 5.24, 4.58, 4.30,
m m m m m m s s d (6.9) d (6.9) d (2.6) s d (5.6) t (5.3)
δC, mult 42.8, CH2 33.5, CH 43.7, CH 38.8, CH2 73.4, 56.7, 75.7, 41.2,
CH CH C CH2
117.3, 151.2, 47.0, 81.2,
CH C C CH
30.1, CH2 46.0, CH 26.2, CH 61.6, CH2 26.4, 16.7, 15.6, 22.2,
CH3 CH3 CH3 CH3
δH, mult (J in Hz) 1.80, 0.90, 2.40, 2.43, 1.60, 1.20, 4.28, 1.76,
m m m m m m m m
2.62, m 1.80, m 5.15, t (10.5)
3.45, m 1.55, 1.14, 2.20, 1.94, 3.48, 3.35, 1.20, 0.95, 0.68, 0.92, 5.60, 5.27, 4.66, 4.32,
m m m m m m s s d (6.9) d (6.9) d (2.6) s d (5.6) t (5.3)
In CD3OD. bIn DMSO-d6. 838
DOI: 10.1021/acs.jnatprod.6b00676 J. Nat. Prod. 2017, 80, 837−844
Journal of Natural Products
Article
from the HMBC correlations. The correlations observed between H-19 (δH = 3.89, 3.66) and C-1′ (δC = 173.9) indicated that fragments I and II were connected through an ester bond. The relative configuration of fragment I was identical with those of 2−4 according to a ROESY experiment. The NOE correlations of fragment II observed between H-7′ (δH = 3.83) and 3′-OH (δH = 5.13), H-6′ (δH = 1.65), and 8′CH3 (δH = 0.73); between H-2′ (δH = 2.67) and 3′-OH (δH = 5.13), 4′-CH3 (δH = 0.72); and between H-4′ (δH = 1.88) and 6′-CH3 (δH = 0.77) indicated that fragment II possessed the relative configurations as shown in Figure 2B. To establish the absolute configuration of 5, p-bromobenzoyl ester 5a was obtained by treating 5 with para-bromobenzoyl chloride in CH2Cl2. Single-crystal X-ray diffraction analysis of 5a using Mo Kα was then carried out, and the absolute configuration of 5 was determined as shown in Figure 2C. Thus, the structure of 5 was elucidated and named fusicomycin A. Compound 6 was confirmed to have the molecular formula C36H60O8 by its HREIMS and 13C NMR data. The IR spectrum showed the presence of hydroxy groups (3362 cm−1), carbonyl groups (1712 cm−1), and a double bond (1604 cm−1). As with 5, a partial structure of 6, consisting of a fusicoccane diterpenoid moiety and a polyketone fragment, was clearly elucidated from the 1H and 13C NMR data (Table 2), as well as a 2D NMR experiment. The fusicoccane diterpenoid moiety was determined to be 19-hydroxycyclooctatin through 1D and 2D NMR data. The polyketone fragment in 6 showed very similar 1H and 13C NMR data to those of 5II, except for one more methylene existing in 6. The polyketone fragment of 6 was elucidated to be a 2-(2-hydroxy-3,5-dimethyl-6-(3-oxohexan-2-yl)tetrahydron-2H-pyran-2-yl)propanoic acid residue on the basis of its 1H, 13C, and 2D NMR data. The HMBC correlations between H-19 (δH = 3.96, 3.73) and C-1′ (δC = 173.9) helped connect these two fragments. 6 had an identical relative configuration to 5 through an analysis of the NOE correlation data. Although the crystal structure analysis of 6 was unsuccessful, we could deduce that 6, named fusicomycin B, had the same stereochemistry as 5 because they were assumed to be formed from the same biosynthetic pathway. Compound 7 shows the same HREIMS data and molecular formula as those of 5, indicating that 7 is an isomer of 5. 7 had the same planar structure as 5 according to an analysis of its 1H, 13 C, and 2D NMR data. The carbon NMR data of 7 were almost identical to those of 5, except for the positions of C-1′, C-3′, C-4′, and 2′-CH3. C-1′, C-3′, and 2′-CH3 were shifted upfield and C-4′ was downfield compared with 5. The NOE correlations of protons in the pyranoid ring and terpenoid skeleton of 7 are the same as those of 5 and 6. Compared to 5 and 6, it presented one more NOE correlation between 3′-OH (δH 5.34) and 2′-CH3 (δH 0.97) in 7. On the basis of the above evidence, 7 is a C-2′ isomer of 5 and was named isofusicomycin A. We suggest that 7 possesses the same absolute configuration as 5 except for C-2′ on the basis of the presumed same biosynthetic pathway. Cytotoxic Activity. The cytotoxic activities of compounds 1−7 were tested in a panel of human tumor cell lines (BGC823, H460, HCT116, HeLa, and SMMC7721). As shown in Table 3, compounds 5−7 showed moderate cytotoxicity against five cell lines, with IC50 values from 3.5 ± 0.7 to 14.1 ± 0.8 μM. Compounds 1−4 were inactive or exhibited very weak activity. 1 showed an approximately 90% inhibition ratio at 200 μM, 3/ 4 showed an approximately 50% inhibition ratio, and 2 did not show any inhibition at 200 μM. Although the IC50 values (>100
18 (δH = 1.15) and H-2 (δH = 2.49), H-19 (δH = 0.76) indicate that H-2, 11-CH3, and 14-isopropyl are cis-oriented (Figure 1). Thus, 2 was elucidated to be 14-hydroxycyclooctatin and had the same relative configuration as cyclooctatin.17−19
Figure 1. Key NOE correlations of compounds 2−4.
Compounds 3 and 4 were obtained as a mixture of two epimers in a nearly 5:3 ratio, according to the integration of the 1 H NMR data. Their molecular formulas were established to be C20H34O4 by HREIMS, and their 1H and 13C NMR data were very similar to those of cyclooctatin (1). The only difference was that one methylene was absent and one more oxygenated methine was present, with a chemical shift δC = 80.8, δH = 3.54 in 3 and δC = 81.2, δH = 3.45 in 4. Thus, an additional hydroxy substituent was deduced. The HMBC correlations from H-1, 12-OH, H-13, and H3-18 to C-12 and from H-12 to C-11, C14, and C-18 revealed that the hydroxy group was located at C12 in both 3 and 4. The NOE cross-peaks observed in 3 from H-6 (δH = 1.75) to H-5 (δH = 4.28), H-16 (δH = 3.48, 3.36), and H3-17 (δH = 1.20); from H-2 (δH = 2.42) to 5-OH (δH = 5.57) and 7-OH (δH = 5.24); and from H-2 (δH = 2.42) to H318 (δH = 1.14) indicated that 3-CH2OH, H-5, H-6, and 7-CH3 were α-oriented and H-2, H-3, 5-OH, 7-OH, and 11-CH3 were β-oriented in 3 (Figure 1). The NOE cross-peaks observed from H-12 (δH = 3.54) to H-15 (δH = 1.74) and H3-18 (δH = 1.14) and from H-14 (δH = 2.35) to 12-OH (δH = 4.58) showed that 12-OH and H-14 were α-configured and H-12 and 14-isopropyl were β-configured (Figure 1). The NMR data for 3 and 4 differed obviously at the C-1, C-15, and C-18 positions, which indicated different configurations of C-12. The NOE correlations observed between H-12 (δH = 3.45) and H-14 (δH = 2.20) and between H3-18 (δH = 0.95) and 12-OH (δH = 4.66), H-15 (δH = 1.94) showed that a β-hydroxy was located at C-12 in 4 (Figure 1). Therefore, 3 and 4 were determined to be 12α-hydroxycyclooctatin and 12β-hydroxycyclooctatin, respectively. Compound 5 was isolated as a white, amorphous powder and possessed the molecular formula C35H58O8, as deduced by HREIMS and 13C NMR data, with 7 degrees of unsaturation. Two structural fragments (I and II) were clearly elucidated from the 1H and 13C NMR data (Table 2), as well as the 2D NMR experiment. Moiety I was determined to be 19hydroxycyclooctatin through comparing with reference data and the analysis of 2D NMR.18 Fragment II, as shown in Figure 2A, is a polyketo substituent commonly found in microbial metabolites biosynthesized by propionate, as was elucidated by 2D NMR. The connectivity of the moieties was established 839
DOI: 10.1021/acs.jnatprod.6b00676 J. Nat. Prod. 2017, 80, 837−844
Journal of Natural Products
Article
Table 2. 1H (600 MHz) and 13C NMR (150 MHz) Data for Compounds 5−7 (in DMSO-d6) 5
6
7
position
δC, mult
δH, mult (J in Hz)
δC, mult
δH, mult (J in Hz)
δC, mult
δH, mult (J in Hz)
1
43.7, CH2
43.6, CH2
34.0, CH 43.6, CH 38.6, CH2
5 6 7 8
73.5, 56.2, 76.0, 41.2,
CH CH C CH2
1.60, 1.12, 2.43, 2.45, 1.56, 1.23, 4.29, 1.79,
43.7, CH2
2 3 4
1.54, 1.06, 2.36, 2.38, 1.49, 1.16, 4.22, 1.71,
1.60, 1.10, 2.42, 2.44, 1.55, 1.22, 4.28, 1.77,
9 10 11 12
118.6, 151.2, 44.3, 45.0,
CH C C CH2
13
24.2, CH2
14 15 16
50.3, CH 33.3, CH 61.2, CH2
17 18 19
26.5, CH3 24.7, CH3 66.7, CH2
20 1′ 2′ 3′ 4′ 5′
16.9, 173.9, 46.6, 98.9, 28.0, 34.8,
CH3 C CH C CH CH2
6′ 7′ 8′ 9′ 10′ 11′ 12′ 2′-CH3 4′-CH3 6′-CH3 8′-CH3 5-OH 7-OH 16-OH 3′-OH
27.7, 73.2, 46.5, 213.5, 35.1, 7.4,
CH CH CH C CH2 CH3
11.9, 16.2, 11.2, 12.3,
CH3 CH3 CH3 CH3
m brd (11.7) m m m m brs t (4.9)
2.51, brt (11.7) 1.78, dd (11.7, 7.2) 5.23, t (8.3)
1.47, 1.31, 1.56, 1.22, 2.32, 1.92, 3.36, 3.32, 1.16, 1.12, 3.89, 3.66, 0.91,
m m m m m m m m s s dd (10.5, 3.8) t (10.5) d (6.8)
2.67, q (7.2) 1.88, 1.66, 1.23, 1.65, 3.83, 2.42,
m m m m brd (10.5) m
2.33, q (7.2) 0.78, t (7.2) 1.02, 0.72, 0.77, 0.73, 5.59, 5.21, 4.30, 5.13,
d (7.2) d (7.6) d (7.2) d (7.2) brs brs brt (4.1) brs
34.0, CH 43.5, CH 38.6, CH2 73.5, 56.2, 76.0, 41.2,
CH CH C CH2
118.9, 151.2, 44.3, 45.0,
CH C C CH2
24.2, CH2 50.3, CH 33.3, CH 61.3, CH2 26.5, CH3 24.7, CH3 66.6, CH2 16.9, 173.9, 46.8, 98.9, 28.0, 34.9,
CH3 C CH C CH CH2
27.7, 73.1, 46.9, 213.0, 43.7, 16.1, 13.6, 12.0, 16.2, 11.2, 12.2,
CH CH CH C CH2 CH2 CH3 CH3 CH3 CH3 CH3
μM) of 1−4 could not be calculated, we still deduced a preliminary structure−activity relationship according to the inhibition ratios of 1−4 at 200 μM and the IC50 values of 5−7. The results indicate that the polyketo side chain at C-19 made a significant contribution to the cytotoxicity (5−7 vs 1), while a hydroxy at C-12 or C-14 significantly decreased the cytotoxic activity (2−4 vs 1). Antimigration and Anti-invasion Effects of 6 on SMMC7721 Cells. Effects of 6 on the Viability of SMMC7721 Cells. Because compounds 5−7 showed significant
brd (10.9) brd (10.9) m m m m brs t (4.9)
2.58, brt (11.8) 1.85, dd (11.8, 7.5) 5.31, t (8.3)
1.55, 1.38, 1.63, 1.29, 2.39, 1.98, 3.45, 3.38, 1.23, 1.19, 3.96, 3.73, 0.98,
m m m m m m m m s s dd (10.5, 3.8) t (10.5) d (6.8)
2.73, q (7.2) 1.96, 1.74, 1.30, 1.71, 3.91, 2.46,
m m m m brd (10.5) m
2.37, 1.41, 0.82, 1.09, 0.80, 0.85, 0.81, 5.61, 5.29, 4.37, 5.21,
t (7.2) m t (7.5) d (7.2) d (6.4) d (6.8) d (6.8) brs brs brt (4.1) brs
34.0, CH 43.6, CH 38.6, CH2 73.5, 56.2, 75.9, 41.3,
CH CH C CH2
118.4, 151.2, 44.3, 45.0,
CH C C CH2
24.4, CH2 50.2, CH 33.7, CH 61.3, CH2 26.5, CH3 24.8, CH3 66.1, CH2 17.1, 172.6, 46.5, 97.3, 29.9, 34.9,
CH3 C CH C CH CH2
27.7, 73.7, 46.3, 214.0, 35.9, 7.3,
CH CH CH C CH2 CH3
10.1, 16.4, 11.2, 12.2,
CH3 CH3 CH3 CH3
m m m m m m brs t (5.5)
2.58, m 1.78, m 5.25, t (8.3)
1.54, 1.37, 1.61, 1.28, 2.38, 1.90, 3.44, 3.37, 1.21, 1.18, 4.08, 3.63, 0.99,
m m m m m m m m s s dd (10.5, 3.4) dd (10.5, 8.7) d (6.8)
2.68, q (7.2) 1.91, 1.75, 1.26, 1.70, 3.75, 2.48,
m m m m dd (10.5, 2.3) m
2.47, q (7.2) 0.88, t (7.2) 0.97, 0.82, 0.78, 0.79, 5.60, 5.28, 4.36, 5.34,
d (7.2) d (7.6) d (7.2) d (7.2) brs brs brt (4.1) brs
cytotoxic activity, in a follow-up study, we chose 6 to investigate the potential anti-invasion effects of fusicoccane diterpenoids with a polyketo substituent on SMMC7721 cells. The inhibition of cell proliferation was further examined by measuring the cell viability after treatment with 6 at four different concentrations of 0.61, 1.83, 5.49, and 16.5 μM and four different time points of 0, 24, 48, and 72 h. Compared to the control group, 6 showed significant inhibition of proliferation for all tested tumor cells in a time- and dosedependent manner (Figure 3A). The viability of the 840
DOI: 10.1021/acs.jnatprod.6b00676 J. Nat. Prod. 2017, 80, 837−844
Journal of Natural Products
Article
Proliferating rates indicated that the effects of 6 on cell adhesion, migration, and invasion were not due to induction of apoptosis at the dosages of 0.6−5.5 μM. Effects of 6 on Adhesion, Migration, and Invasion in SMMC7721 Cells. The potential capacity of the cancer cell adhesion, migration, and invasion plays an important role in metastasis.23,24 The effects of 6 on the cell adhesion were examined using the cell adhesion assay. The results showed that 6 had obvious antiadhesion effects on SMMC7721 cells at 1 h (Figure 3B). To investigate the effect of 6 on migration and invasion, SMMC7721 cells were treated with various nontoxic doses of 6 (0−5.49 μM) for 24 h, and the invasive and migratory behavior was analyzed using Boyden chamber assays with or without Matrigel.25 The results demonstrate that the numbers of migrated cells were significantly suppressed in a dose-dependent manner (Figure 4A,B). Therefore, our data revealed the role of 6 in the suppression of cancer migration and invasion.
Figure 2. (A) Key COSY and HMBC correlations of fragments I and II of 5. (B) Key NOE correlations of fragment II of 5. (C) Singlecrystal X-ray structure of 5a.
Table 3. Cytotoxicity Activities of 5−7 (IC50 μM) 5 BGC-823 H460 HCT116 HeLa SMMC7721
7.0 4.1 6.7 6.7 8.9
± ± ± ± ±
6 1.0 1.3 0.2 0.2 0.9
10.5 3.5 5.8 7.6 9.6
± ± ± ± ±
adriamycin
7 1.7 0.7 0.2 0.8 0.2
9.5 6.1 8.0 9.3 14.1
± ± ± ± ±
0.8 1.0 0.6 0.2 0.8
1.5 1.0 1.4 1.0 2.2
± ± ± ± ±
0.1 0.2 0.2 0.1 0.3
Figure 4. Compound 6 treatment decreased the migration and invasion of SMMC7721 cells. The cells were seeded in a Transwell upper chamber with (B) or without Matrigel (A). After 24 h, the number of cells on the other side of the membrane was stained by H&E (A) or crystal violet (B). The vehicle-treated group is the control (Con). Data represent mean ± SD (n = 3). *p < 0.05 versus nontreated control cells. §p < 0.05 compared to the 0.61 μM treatment. #p < 0.05 compared to the 1.83 μM treatment.
Effects of 6 on MMP-2 and MMP-9 Expression and Activity in SMMC7721 Cells. The basal membrane and the extracellular matrix degradation are an important step for tumor metastasis. Among the matrix metalloproteinases, MMP-2 and MMP-9 play essential roles because they efficiently degrade the main component of the extracellular matrix, such as type IV collagen.26−29 To investigate the primary anti-invasive mechanisms of 6, we examined its impact on MMP-2 and MMP-9 expression and activity. The activities of MMP-2 and MMP-9 in a culture media of SMMC7721 cells were analyzed by zymography. Compared to the control, the MMP-2 and MMP-9 activities were suppressed in a dose-dependent manner by treatment of 6 (Figure 5A,B). To investigate the effect of 6 on MMP-2 and MMP-9 gene expression, the MMP-2 and MMP-9 protein and mRNA levels
Figure 3. Proliferating rates and the adhesion in 6-treated SMMC7721 cells. (A) Different concentration of 6 (0, 0.61, 1.83, 5.49, 16.5 μM) were used to treat SMMC7721 cells. The vehicle-treated group is the control (Con). At indicated time intervals, the proliferating rates of SMMC7721 cells were determined by MTT assay. (B) The cells were seeded on Matrigel with 0.5% serum-free RPMI-1640 medium before incubating with 6 (0.61, 1.83, 5.49 μM) for 1 h. Then, the cells were washed with 2% bovine serum albumin for 30 min and stained with crystal violet. The absorbance of OD was detected and recorded with a microplate reader at 540 nm. Data represent mean ± SD (n = 3). *p < 0.05 versus nontreated control cells. §p < 0.05 compared to the 0.61 μM treatment. #p < 0.05 compared to the 1.83 μM treatment.
SMMC7721 cells was not significantly affected at the tested concentrations of 0.6−5.5 μM in 24 h (Figure 3A). 841
DOI: 10.1021/acs.jnatprod.6b00676 J. Nat. Prod. 2017, 80, 837−844
Journal of Natural Products
Article
Figure 6. Effects of 6 on MMP-2 and MMP-9 expression. (A) The protein levels of MMP-2 and MMP-9 were determined by Western blot. (B, C) MMP-2 and MMP-9 protein levels were quantified by densitometric analysis. (D, E) The mRNA levels of MMP-2 and MMP-9 were determined by qRT-PCR. The vehicle-treated group is the control (Con). Results are the mean ± SD (n = 3). *p < 0.05 versus nontreated control cells. §p < 0.05 compared to the 0.61 μM treatment. #p < 0.05 compared to the 1.83 μM treatment.
Figure 5. Compound 6 treatment inhibits MMP-2 and MM-9 enzymatic activity. MMP-2 and MMP-9 enzymatic activities were determined by gelatin zymography. (A) The 72 kDa bands correspond to MMP-2 and 92 kDa to MMP9. (B) MMP-2 and MMP-9 activities were quantified by densitometric analysis. 6 reduced MMP-2 and MMP-9 activity in a dose-dependent manner. The vehicle-treated group is the control (Con). Results are the mean ± SD (n = 3). *p < 0.05 versus nontreated control cells. §p < 0.05 compared to the 0.61 μM treatment. #p < 0.05 compared to the 1.83 μM treatment.
(FBS), penicillin−streptomycin−amphotericin (PSA), and 0.25% trypsin (EDTA) were purchased from Gibco BRL Co., Ltd. (Gaithersburg, MD, USA). Matrigel matrix basement membrane and albumin bovine V (BSA) were purchased from BD Biosciences (Becton, Dickinson and Company, San Diego, CA, USA). The Transwell chamber was purchased from Thermo Fisher Scientific (Waltham, MA, USA). The BGC823, H460, HCT116, HeLa, and SMMC7721 cell lines were provided by the cell bank of the type culture collection of the Chinese Academy of Sciences (Shanghai, China). Antibodies to MMP2, MMP9, and GAPDH were purchased from Cell Signaling Technology (USA). Microbial Material. The producing strain was isolated from fresh fecal samples excreted by healthy adult Ailuropoda melanoleuca (giant panda) living in Yunnan Wild Animal Park, Kunming, Yunnan Province, People’s Republic of China, in October 2009. The strain was identified as Streptomyces violascens by one of the authors (Y.J.) based on morphological characteristics and 16S rRNA gene sequences. The BlAST result showed that the sequence was completely identical (100%) to the sequence of S. violascens ISP 5183T (accession number AY999737). The strain (No. YIM 100212) was deposited in the Yunnan Institute of Microbiology, Yunnan University, People’s Republic of China. Fermentation, Extraction, and Isolation. A slant culture of the strain was inoculated into 500 mL Erlenmeyer flasks containing 100 mL of seed medium composed of 4 g L−1 yeast extract, 4 g L−1 glucose, 5 g L−1 malt extract, 1.0 mL of multiple vitamin solution, and 1 mL L−1 trace element solution. The pH was 7.2 with no adjustment, and the flasks were incubated for 2 days at 28 °C on a rotary shaker at 180 rpm. This seed culture was used to inoculate the fermentation medium with 10% volume. The fermentation was carried out in a 500 mL/1000 mL Erlenmeyer flask with 100 mL/200 mL of fermentation medium containing soybean meal 10 g L−1, peptone 2 g L−1, glucose 20 g L−1, soluble starch 5 g L−1, yeast extract 2 g L−1, NaCl 4 g L−1, K2HPO4 0.5 g L−1, MgSO4·7H2O 0.5 g L−1, and CaCO3 2 g L−1, with a pH of 7.8 with no adjustment, and the flasks were incubated for 7 days at 28 °C on a rotary shaker at 180 rpm. The completed fermentation broth (80 L) was clarified with a centrifuge to obtain 75 L of culture supernatant. Then, the supernatant
were measured after treatment with 6 at the test concentrations. The intracellular protein levels of MMP-2 and MMP-9 were assessed by Western blotting analysis (Figure 6A), showing that MMP-2 and MMP-9 were substantially down-regulated in response to 6, compared with nontreated cells (Figure 6C,B) after treatment with 6. Quantitative real-time PCR was further employed to analyze the effect of 6 on the mRNA transcriptional expression of MMP-2 and MMP-9. The mRNA expression of MMP-2 and MMP-9 was also reduced in a dose-dependent manner (Figure 6E,D) after treatment with 6. The results indicate that 6 might regulate the migration and invasion of SMMC7721 cells via decreasing the expression and activity of MMP-2 and MMP-9.
■
EXPERIMENTAL SECTION
General Experimental Procedures. Optical rotation was determined using an Anton Paar MCP200 automatic polarimeter (Graz, Austria). IR spectra were recorded with a Bruker Tensor 27 FTIR spectrometer. ESIMS were recorded on an Agilent 1290-6420 triple quadrupole LC-MS spectrometer (Santa Clara, CA, USA). HREIMS spectra were measured using an Autospec Premier P776 mass spectrometer (Waters). NMR spectra were recorded on a Bruker Advance III-600 MHz and a Bruker AV-600 MHz spectrometer (Bruker, Rheinstetten, Germany). X-ray crystallographic analysis was carried out on a Bruker SMART APEX-II diffractometer. Silica gel (100−200 mesh, 200−300 mesh, Qingdao Marine Chemical, Ltd., Qingdao, China), Sephadex LH-20 (GE Healthcare Biosciences AB, Uppsala, Sweden), YMC*GEL ODS-A (S-50 μm, 12 nm) (YMC Co., Ltd., Kyoto, Japan), and Amberlite XAD-16 polymeric resin (Rohm and Hass Shanghai Chemical Industry Co., Ltd., Shanghai, China) were used for column chromatography. The MTT assay was analyzed using a microplate reader (BioTek Synergy H1, BioTek Instruments, Inc., VT, USA). RPMI 1640 medium (RPMI1640), fetal bovine serum 842
DOI: 10.1021/acs.jnatprod.6b00676 J. Nat. Prod. 2017, 80, 837−844
Journal of Natural Products
Article
= 90°, β = 90°, γ = 90°, volume = 8265.0(3) Å3, Z = 8, ρ calcd = 1.270 g/cm3, θ range = 1.33−27.5°, Mo Kα radiation, wavelength = 0.710 73 Å, temperature = 296 K, F(000) = 3360, reflections collected 40 892, unique 18 362 [R(int) = 0.0688], completeness to θ = 27.50°, 99.5%, the final refinement gave R1 = 0.0594 and wR2 = 0.1304 (w = 1/σ|F|2), S = 0.912, maximum transmission 0.7456, minimum transmission 0.6617, absolute structure parameter = −0.013(7). Bruker SMART APEX-II data collection: the structures were solved by direct methods using SHELXS-97 and refined by means of fullmatrix least-squares on F2. Crystallographic data have been deposited under number CCDC 1476951 at the Cambridge Crystallographic Data Centre, 12 Union Road, Cambridge, CB2 1EZ, UK (+44 1223 336408). Cytotoxicity Assay. The cytotoxicities of 1−7 were evaluated against five human cancer cell lines including a gastric carcinoma cell line (BGC-823), a large-cell lung carcinoma cell line (H460), a cervix carcinoma cell line (HeLa), a colon carcinoma cell line (HCT116), and a hepatocellular carcinoma cell line (SMMC-7721). The human cancer cell lines were cultured in RPMI-1640 or Dulbecco’s modified Eagle’s medium supplemented with 10% heat-inactivated FBS. The cytotoxic effects were assayed by the MTT method after exposure to compounds 1−7 at six concentrations (100, 33, 10, 3.3, 1.0, and 0.33 μM). After incubation at 37 °C for 72 h, 10 μL of MTT (5 mg/mL) was added to each well and incubated for another 4 h, and then the liquid in the wells was removed. DMSO (150 μL) was added to each well. The absorbance was recorded on a microplate reader at a wavelength of 570 nm, and the IC50 was defined as a 50% reduction of the absorbance in the control assay. The results were represented as the mean ± SD from three independent experiments, and adriamycin was used as a positive control. Cell Adhesion Assay. The Matrigel with 0.5% serum-free RPMI1640 medium was seeded at 100 μL/well in 96-well plates overnight. After that, the plates were washed and incubated with 2% bovine serum albumin for 30 min and then washed with phosphate-buffered saline (PBS). The SMMC7721 cells were treated with different concentrations of 6 (0.61, 1.83, and 5.49 μM), seeded at 2 × 104 cells/ well in 96-well plates, and incubated for 1 h. Then, the nutrient solution was removed, and 0.2% crystal violet was added to the plates. After 10 min of incubation, 100 μL of DMSO was added to each well, and the plates were placed on a horizontal orbital microplate shaker for 20 min at room temperature. The absorbance of optical density (OD) at 540 nm was measured and recorded with a microplate reader. Transwell Chamber Assay. For migration, 200 μL of RPMI-1640 medium with 10% FBS was added to the lower chamber of the Transwell plate. Then 200 μL of RPMI-1640 medium with 0.1% FBS and 4 × 105 cells and different concentrations of 6 (0.61, 1.83, and 5.49 μM) were added to the upper chamber of the Transwell plates. After 6 h, the cells on the lower surface of the membrane were fixed with paraformaldehyde solution for 30 min and stained with hematoxylin and eosin (H&E) for 5 min. For invasion, 100 μL of the diluted Matrigel (1:3) in serum-free cold RPMI-1640 was applied to the top side of the polycarbonate filter and incubated for 2 h at 37 °C. The other procedure was the same as the migration assay, except for being stained with 0.1% crystal violet. The pictures were collected by phase contrast microscopy. Gelatin Zymography. SMMC7721 cells in 96-cell plates (2 × 105 cells/well) were treated with different concentrations of 6 (0.61, 1.83, and 5.49 μM) for 24 h. The supernatants were collected and subjected to electrophoresis by 10% SDS-PAGE containing 0.1% gelatin. After the electrophoresis, the gels were washed three times with 2.5% Triton X-100, 1 h each time, and incubated in reaction buffer (50 mM TrisHCl, 10 mM CaCl2, 1 μM ZnCl2, and 0.2 M NaCl, pH 7.6) at 37 °C for 36 h. The gels were then stained with Coomassie brilliant blue R250 for 2 h. The activities of MMP-2 and MMP-9 were quantified by densitometer measurements using a digital imaging analysis system. Real-Time PCR. The effects of 6 on the expression of MMP-2 and MMP-9 mRNA were examined in SMMC7721 cells using SYBRGreen real-time quantitative PCR. SMMC7721 cells (5 × 105 cells/ well) in six-well plates were treated with various concentrations (0.61, 1.83, and 5.49 μM) of 6 for 24 h. The total RNA was extracted from
was absorbed onto the Amberlite XAD-16 polymeric resin. Salt and high molecular weight materials were washed out with water, and other organic materials were eluted with an EtOH gradient (from 20% to 95%) to give 45 g of crude extract by rotary evaporation under reduced pressure. The total extract was subjected to open silica gel (100−200 mesh) column chromatography with a CH2Cl2−MeOH solvent system (from 50:1 to 15:1 and then 1:1 last) to yield nine fractions. Fraction 5 was subjected to Sephadex LH-20 chromatography (MeOH) to produce 12 subfractions (Fr.5.1−Fr.5.12). Fr.5.5 was further separated by silica gel (200−300 mesh) column chromatography (CH2Cl2−MeOH, 20:1) to yield four subfractions (Fr.5.5.1−Fr.5.5.4). Then, Fr.5.5.2 was purified by ODS column chromatography, eluting with water−methanol (10:90), to give compounds 5 (25.2 mg), 6 (20.4 mg), and 7 (6.0 mg). Fr.5.7 was subjected to silica gel (200−300 mesh) column chromatography (petroleum ether−ethyl acetate, 1:1) to yield six subfractions (Fr.5.7.1−Fr.5.7.6). Compound 1 (9.0 mg) was obtained from Fr.5.7.6 using ODS column chromatography, eluting with water− methanol (15:85). Fraction 7 was subjected to Sephadex LH-20 chromatography (MeOH) to afford 11 subfractions (Fr.7.1−Fr.7.11). Fr.7.5 was purified by ODS column chromatography, eluting with water−methanol (25:75), to yield compound 2 (6.5 mg). Fr.7.7 was further separated into eight subfractions (Fr.7.7.1−Fr.7.7.8). Compounds 3 and 4 were obtained as a mixture (2.5 mg) from Fr.7.7.8 using ODS column chromatography, eluting with water−methanol (30:70) and purified by silica gel (200−300 mesh) column chromatography (CH2Cl2−MeOH, 20:1). 14-Hydroxycyclooctatin (2): colorless oil; [α]20 D = +24.0 (c 1.0, MeOH); IR (film) νmax 3327, 2954, 2928, 2855, 1605, 1465, 1416, 1378, 1260, 1175 cm−1; 1H and 13C NMR see Table 1; ESIMS m/z 361 [M + Na]+, 699 [2M + Na]+; HREIMS m/z: 338.2458 [M]+ (calcd for C20H34O4, 338.2457). 12α-Hydroxycyclooctatin (3) and 12β-hydroxycyclooctatin (4): colorless oil; IR (film) νmax 3341, 2958, 2926, 1599, 1465, 1412, 1379, 1260, 1174, 1089, 1027 cm−1; 1H and 13C NMR see Table 1; ESIMS m/z 361 [M + Na]+, 699 [2M + Na]+; HREIMS m/z 338.2461 [M]+ (calcd for C20H34O4, 338.2457). Fusicomycin A (5): white, amorphous powder; [α]20 D = +68.0 (c 1.0, MeOH); IR (film) νmax 3375, 2959, 2927, 1738, 1713, 1611, 1460, 1410, 1376, 1260, 1173 cm−1; 1H and 13C NMR see Table 2; ESIMS m/z 629 [M + Na]+, 1235 [2M + Na]+; HREIMS m/z 606.4145 [M]+ (calcd for C35H58O8, 606.4132). Fusicomycin B (6): white, amorphous powder; [α]20 D = +76.0 (c 1.0, MeOH); IR (film) νmax 3362, 2959, 2930, 2878, 1712, 1604, 1461, 1377, 1177 cm−1; 1H and 13C NMR see Table 2; ESIMS m/z 643 [M + Na]+; HREIMS m/z 620.4297 [M]+ (calcd for C36H60O8, 620.4288). Isofusicomycin A (7): white, amorphous powder; [α]20 D = +96.0 (c 0.5, MeOH); IR (film) νmax 3360, 2959, 2930, 1737, 1713, 1601, 1460, 1411, 1377, 1280, 1174 cm−1; 1H and 13C NMR see Table 2; ESIMS m/z 629 [M + Na]+, 1235 [2M + Na]+; HREIMS m/z 606.4108 [M]+ (calcd for C35H58O8, 606.4132). Synthesis and Isolation of 5a. To a stirred, ice-salt bath cooled solution of 5 (10 mg, 0.016 mM), Et3N (15 μL), and catalytic amounts of 4-dimethylaminopyridine (DMAP) in anhydrous CH2Cl2 (3 mL) was added dropwise para-bromobenzoyl chloride (25 mg, 0.116 mM) in anhydrous CH2Cl2 (2 mL). After the addition was complete, the mixture was stirred at room temperature for 12 h. To the mixture were added ice and a saturated NaCl solution (5 mL). After stirring for 10 min, the CH2Cl2 layer was separated, and the aqueous layer was extracted with CH2Cl2 (2 × 5 mL). The combined organic extracts were washed with saturated brine (15 mL) and dried over anhydrous Na2SO4. After filtration and evaporation, the residue was purified by silica gel column chromatography (petroleum ether−ethyl acetate, 2:1) to yield 5a (4 mg). X-ray Crystallography of 5a. Colorless, transparent columnar crystals of 5a were obtained from a 10:1 (v/v) mixture of EtOAc and H2O. Crystal data of 5a: C42H61BrO9, MW = 789.82, orthorhombic, crystal size 0.12 × 0.15 × 0.19 mm, space group P212121, unit cell dimensions a = 10.2741(19) Å, b = 26.3220(5) Å, c = 30.5610(6) Å, α 843
DOI: 10.1021/acs.jnatprod.6b00676 J. Nat. Prod. 2017, 80, 837−844
Journal of Natural Products
Article
the cells using TRIzol Reagent (Ambion, Foster City, CA, USA) according to the manufacturer’s instructions. The cDNA was synthesized from the extracted total RNA using a reverse transcriptase kit (Promega, Madison, WI, USA). Primer sequences of MMP-2 (FACCCAGATGTGGCCAACTAC; R-GAGCAAAGGCATCATCC ACT) and MMP-9 (F-TCTTCCCTGGAGACCTGAGA; RATTTCGACTCTCCACGCATC) were used for amplification. PCR was performed at 95 °C for 10 min, 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 20 s for 44 cycles. GAPDH was used as an internal control. Western Blot Analysis. SMMC7721 cells were seeded at a density of 5 × 105 cells/well into six-well plates and treated with various concentrations (0.61, 1.83, and 5.49 μM) of 6 for 24 h. The cells were washed twice with PBS and lysed with RIPA buffer (Beyotime, Haimen, China) and protease inhibitor cocktail (Promega, Madison, WI, USA) for 40 min on ice. The cell lysates were collected, and the protein content was determined by BCA protein assay kit (Beyotime). Equivalent amounts of protein from each sample (60 μg) were denatured in Laemmli loading buffer and subsequently loaded onto 10% SDS-PAGE. After electrophoresis, the proteins were transferred onto PVDF membranes (Millipore, Billerica, MA, USA), and subsequently incubated with the primary and peroxidase-conjugated secondary antibodies. The blots were visualized by chemiluminescence, and the protein expression was normalized to GAPDH. Statistical Analysis. The measured data were expressed as mean ± standard deviation. Student’s t test was performed using SPSS 10.0. A p value of
