Cytotoxicity and Anti-inflammatory Properties of Apigenin

2 days ago - 1H and 13C NMR spectra of compounds 1 and 4–6 and ORTEPs derived from the single-crystal X-ray analyses of compounds 1 and 7 (PDF)...
2 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/jnp

Cite This: J. Nat. Prod. XXXX, XXX, XXX−XXX

Cytotoxicity and Anti-inflammatory Properties of Apigenin-Derived Isolaxifolin Yongsheng Chen,†,‡ Wan-Na Chen,# Nan Hu,† Martin G. Banwell,†,§ Chenxi Ma,§ Michael G. Gardiner,§ and Ping Lan*,†,# †

Institute for Advanced and Applied Chemical Synthesis, Jinan University, Guangzhou, 510632, People’s Republic of China Department of Food Science and Engineering, Jinan University, Guangzhou, 510632, People’s Republic of China § Research School of Chemistry, Institute of Advanced Studies, The Australian National University, Canberra, Australian Capital Territory 2601, Australia # College of Pharmacy, Jinan University, Guangzhou, 510632, People’s Republic of China

Downloaded via NOTTINGHAM TRENT UNIV on August 29, 2019 at 19:10:21 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

S Supporting Information *

ABSTRACT: The rare flavonoid isolaxifolin, a potent insecticide, has been touted as a potential grain-protecting agent. In order to assess any impact of this natural product on human health and to explore its various other biological properties, we have established a semisynthesis from the simpler but structurally related and more abundant natural product apigenin. The five-step reaction sequence has provided, for the first time, sufficient material for an indepth evaluation of the cytotoxic properties of the title natural product. The impact of isolaxifolin on certain pro-inflammatory cytokines in murine macrophage RAW 264.7 cells has also been examined. Such studies have revealed that isolaxifolin displays no toxic effects toward normal cells while displaying greater cytotoxicities against certain cancer cell lines than its synthetic precursor apigenin. Furthermore, unlike apigenin, isolaxifolin only reduced NO, TNF-α, and IL-6 secretions in LPS-induced RAW 264.7 cells in a rather modest and dose-independent manner.

O

balm, onions, and oranges as well as in chamomile and tea.8−10 Numerous biological studies reveal that apigenin possesses significant anti-inflammatory,11−13 antioxidant,12,14,15 and anticancer properties.16 Such features together with its high natural abundance, versatile healthcare effects, and low intrinsic toxicity mean apigenin has received considerable attention as a potential therapeutic agent, including for the purposes of cancer prevention.17,18 However, while apigenin is known to regulate cell proliferation, cell invasion,19 angiogenesis,20 and apoptosis,21 it is better recognized for its chemopreventative effects,17,22,23 not least because of its modest potency, solubility, oral-bioavailability, and noninterference with the actions of other therapeutic agents.23,24 On the basis of the foregoing we sought to prepare isolaxifolin (1) from the more abundant apigenin (3) in order to provide sufficient quantities of the former compound for detailed evaluations of its cytotoxicity and anti-inflammatory properties and in so doing using apigenin as a reference compound. Our results reveal that isolaxifolin is nontoxic to normal cells while also displaying significant cytotoxicity against five cancer cell lines, most notably a human breast

ver millennia the edible plant Derris laxiflora Bentham has been exploited by aboriginals for medicinal purposes.1 During a study of its active principles in the early 1990s, the flavonoids isolaxifolin (1) and laxifolin (2) (Figure 1) were isolated from the root of samples of the plant collected in southern Taiwan.2 More recently the former natural product (misidentified as laxifolin) has been encountered in Derris scandens Bentham,3 a related medicinal plant that has been exploited in Southeast Asia for its insecticidal effects.4 Cometabolites of isolaxifolin, including the prenylated isoflavones osajin, scandinone, and lupalbigenin, are excellent insect antifeedants, being toxic to chewing and sucking insects but not to humans.3,5−7 Similarly, isolaxifolin has been shown, using a fumigation bioassay, to be a potent insecticide, and the source plants are used to control pests in household pantries.7 Despite such observations, the development of isolaxifolin as an insecticide has been inhibited by its low natural abundance (0.0024% dry weight in whole plant) and the tedious procedures required for its isolation in pure form.3 Isolaxifolin can be viewed as an analogue of the dietary flavonoid apigenin (3) (Figure 1) that embodies an added 2,2dimethylated chromene residue and a C-8 prenyl group. Apigenin itself is widely distributed in various vegetables, herbs, and fruit including celery, parsley, tomato, apple, lemon © XXXX American Chemical Society and American Society of Pharmacognosy

Received: February 6, 2019

A

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 1. Structures of isolaxifolin (1), laxifolin (2), and apigenin (3).

Scheme 1. Synthesis of Isolaxifolin (1) from Apigenin (3)

and 13C NMR spectroscopic data (recorded in CDCl3) of compound 1 matched those reported for isolaxifolin2 (Table 1). When taken in conjunction with the single-crystal X-ray analysis of the synthetic material (details of which are also provided in the Experimental Section and the SI), the present work serves to confirm the structure of the natural product isolaxifolin, which has, in one study,3 been misidentified as laxifolin. The present synthetic protocol for obtaining isolaxifolin (Scheme 1) is a robust one since the starting material, reagents, and other chemicals are commercially available, and a 17% overall yield was realized. As such, this route provides an efficient means for obtaining significant quantities of isolaxifolin at modest cost and thus avoiding the need for its tedious extraction and isolation from plant sources. Furthermore, the basic synthetic protocols detailed here could well be applied to other, structurally related natural products.28−30 Cytotoxic Properties. Cytotoxicity. Earlier studies have established the cytotoxicity of apigenin on human breast cancer,31a liver cancer,31b prostate cancer,31c colon cancer,31d and other cancer cell lines.31e Tseng et al. have shown31f that after incubating the MDA-MB-231 human breast cancer cell line with 40.0 μM solutions of apigenin for 48 h only 45% remained viable. In the present study, the in vitro cytotoxicity activities of isolaxifolin and apigenin were evaluated using a methylene blue assay involving the liver cancer cell line HepG2, the breast cancer cell lines MCF-7 and MDA-MB-231, the prostate cancer cell line LNCaP, and the human colon cancer cell line HCT-116. The two compounds were also evaluated against the normal liver cell line LO-2. Specifically, isolaxifolin and apigenin were prepared at concentrations of 123.6 and 185.0 μM in culture medium by appropriate dilutions of a 370.0 and a 247.2 mM DMSO stock solution,

cancer cell line. Isolaxifolin acts by regulating the apoptosis pathway, particularly the late stages of this process. Thus, isolaxifolin impacts on cell cycle progression at the G0/G1 phase and disrupts the mitochondrial membrane potential in MDA-MB-231 cells. Additionally, unlike apigenin, isolaxifolin has little effect on the secretion levels of nitric oxide (NO) as well as pro-inflammatory cytokines (TNF-α/IL-6) in murine macrophage RAW 264.7 cells. As such, compound 1 displays modest anti-inflammatory activity and, thus, warrants consideration for development as a safe, potent, and selective cancer therapeutic agent.

■

RESULTS AND DISCUSSION Synthesis of Isolaxifolin. The synthetic route employed in preparing isolaxifolin (1) is shown in Scheme 1 and started with the direct prenylation of apigenin (3) using 3-methyl-2butenal in the presence of Ca(OH)2.25 The regioisomeric and chromatographically separable 2,2-dimethylated chromenes 4 (15%) and 5 (42%) were thus obtained. Treatment of the major product, 5 (a naturally occurring compound known as carpachromene26), with Ac2O in the presence of pyridine yielded the corresponding mono-acetate that was subjected to condensation with 3-methyl-2-buten-1-ol under Mitsunobu conditions using triphenylphosphine and diethyl azodicarboxylate (DEAD). By such means ether 6 was obtained in 68% yield from precursor 5. Compound 6 was subjected to a europium(III)-tris(1,1,1,2,2,3,3-heptafluoro-7,7-dimethyl-4,6octanedionate) [Eu(fod)3]-catalyzed tandem para-Claisen− Cope rearrangement reaction,27 thus affording product 7 (83%), the structure of which was confirmed by single-crystal X-ray analysis [see the Experimental Section and Supporting Information (SI) for details]. K2CO3-promoted hydrolysis of acetate 7 then gave the target phenol 1 in 71% yield. The 1H B

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

μM. At 46.3 μM apigenin did not show (Figure 2B) any significant cytotoxicity (as defined by a greater than 50% reduction in cell viability), and MCF-7 cells were only inhibited by apigenin at significantly higher concentration (20% cell viability at 188.7 μM). Isolaxifolin, on the other hand, was “effective” across the five cancer cell lines, being most potent against MDA-MB-231 cells (20% cell viability at 17.3 μM), followed by MCF-7, HepG2, LNCaP, and HCT116 cells (20% cell viability at 24.2, 24.7, >30.9, and >34.6 μM, respectively); it was nontoxic to the normal (LO-2) cell line (Figure 2A). Effects on Cell Cycle Arrest. Since isolaxifolin showed the greatest cytotoxicity towards the MDA-MB-231 cell line, this was chosen for further studies. Isolaxifolin concentrations of 0, 8.6, 12.4, and 17.3 μM were subsequently used. As shown in Figure 3A, analysis of the cellular DNA content following propidium iodide (PI) staining revealed that the number of MDA-MB-231 cells in the G0/G1 phase increased from 50.4% in untreated cells to 59.5%, 60.2%, and 63.3% in cells incubated with 8.6, 12.4, and 17.3 μM concentrations, respectively, of isolaxifolin. Correspondingly, the percentage of cells in the S-phase decreased from 39.2% to between 29.5% and 26.8% upon treatment with isolaxifolin. These dosedependent changes clearly demonstrate that isolaxifolin arrests cell proliferation at the G0/G1 phase, and this is likely, therefore, to be the locus of the observed cytotoxicity activity. Induction of Apoptosis. Using an inverted fluorescence microscope, the intensity of the blue fluorescence arising from the staining of the chromosome in apoptotic cells was also measured. This is correlated with the level of nuclear chromatin condensation in treated cells. Thus, as revealed in Figure 3B, the fluorescence varies in a concentrationdependent manner and indicates the presence of increased levels of apoptotic cell bodies at higher concentrations of isolaxifolin. As such, the activation of the apoptotic pathway is clearly linked to the cytotoxicity of isolaxifolin. The rates of development and the extent of apoptosis in MDA-MB-231 cells triggered by exposure to varying concentrations of isolaxifolin were determined after 48 h incubation periods using flow cytometric analysis with early apoptotic cells, late apoptotic cells, and viable cells being sorted by such means. As shown in Figure 3, the proportion of MDA-MB-231 cells in the late apoptotic stage, labeled as Q2, increased slightly as the concentration of isolaxifolin was raised from 8.6 μM to 12.4 μM, with a more significant effect being

Table 1. NMR Spectroscopic Data for Natural Isolaxifolin and Synthetic 1 13

C NMR (δC)

positiona 2 3 4 5 6 7 8 9 10 1′ 2′, 6′ 3′, 5′ 4′ 1″ 2″ 3″ 4″ 5″ 2‴ 3‴ 4‴ 5‴ 6‴

natural isolaxifolinb f

163.0 103.5f 182.9 157.0 105.0 159.4f 107.6 154.5 103.6f 123.7f 128.3 116.2 154.3 21.6 122.2 131.7f 25.7 18.0 78.6f 131.9 115.8 28.0 28.1

compound 1c 164.6 102.9 182.9 157.2 105.6 160.4 107.8 154.4 104.8 122.8 128.4 116.3 154.0 21.6 122.1 128.1 25.7 18.1 77.9 131.8 115.7 28.2 28.2

1

H NMR (δH)

natural isolaxifolind

compound 1e

6.49 s

6.56 s

7.72 d (8.5) 6.89 d (8.5)

7.80 d (8.7) 6.97 d (8.7)

3.47 d (7.1) 5.17 t (6.9)

3.51 d (7.1) 5.24 m

1.62 s 1.76 s

1.69 s 1.83 s

5.57 d (10.0) 6.70 d (10.0) 1.42 s

5.62 d (10.0) 6.74 d (10.0) 1.47 s

not showng not showng

12.99 s 5.76 br s

a

See Figure 1 for numbering. bData obtained from ref 2 and recorded in CDCl3 at 75 MHz. cRecorded in CDCl3 at 100 MHz. dData obtained from ref 2 and recorded in CDCl3 at 300 MHz. eRecorded in CDCl3 at 400 MHz. fThese differences in chemical shift are attributed to the varying pH of the media (CDCl3) in which the spectra were recorded. gSignals due to OH group protons not shown.

respectively. As revealed in Figure 2, after 48 h both natural products showed no obvious effects on normal human liver cells LO-2, thus, providing some assurance about the safety of isolaxifolin in the proposed agrochemical settings. Given that initial studies on the cancer cell lines revealed isolaxifolin to be active at much lower concentrations than apigenin, the former compound was tested at concentrations of 30.9, 24.7, 17.3, and 6.2 μM, while apigenin was tested at a concentration of 185.0

Figure 2. Cytotoxicity effect of differing concentrations of isolaxifolin (A) and apigenin (B) on the human cell lines MDA-MB-231, MCF-7, LO-2, LNCaP, HCT-116, and HepG2. C

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 3. Cellular effects of isolaxifolin (1). (A) Cell cycle distribution of MDA-MB-231 cells treated with isolaxifolin. (B) Photomicrographs of MDA-MB-231 nuclear condensation caused by isolaxifolin. (C) Analysis of the apoptosis of MDA-MB-231 cells treated with isolaxifolin; Q1 shows necrotic cells, Q2 shows cells in the late stages of apoptosis, Q3 shows normal cells, Q4 shows cells in the early stages of apoptosis. (D) Loss of mitochondrial membrane potential of MDA-MB-231 cells treated with isolaxifolin. B1 shows red fluorescence; B2 shows green florescence. MDAMB-231 cells treated with isolaxifolin at concentrations of 0, 8.6, 12.4, and 17.3 μM.

observed at a concentration of 17.3 μM. The proportion of MDA-MB-231 cells detected in the early stages of apoptosis, labeled as Q4, increased only marginally as the isolaxifolin concentration was raised from 8.6 μM to 12.4 μM, but a relatively large increase was observed at 17.3 μM. In keeping with the observations of the effect of isolaxifolin on nuclear condensation, increasing concentrations of this compound impacted more significantly on the later rather than the earlier stages of cellular apoptosis (p < 0.05) (Figure 3). Many phytochemicals exert cytotoxicity on cancer cells, and these can involve either direct or indirect blocking of cell-cycle progression.32 The mechanism of action of apigenin, for example, presumably involves the former pathway, as shown by its capacity to induce in vitro apoptosis in the human bladder cancer T-24 cell line.21 Apoptosis is important in controlling cell proliferation, and defects in this process can lead to uncontrolled growth.33 Chromatin condensation is an indicator of apoptosis, and this was heightened, in a dosedependent manner, by both apigenin and isolaxifolin, a result in accord with reports that the former compound induces apoptosis in a range of cancer cell lines.17,34 Apigenin has been shown to block cell cycles at different phases depending on the specific cell type,21,35 and in the present work both natural

products effected G0/G1-phase arrest in the most sensitive cell line (MDA-MB-231). Impact on Mitochondrial Membrane Potential (MMP). Mitochondria play a fundamental role in cellular processes, and disruption of the MMP is a key indicator of apoptosis.36 The JC-1 dye-based protocol is often used as an indicator of MMP, with normal cells exhibiting a red fluorescence, while those undergoing apoptosis and attendant disruption of their mitochondria display green fluorescence. Compared with the appropriate control group, MDA-MB-231 cells displayed diminishing red to green fluorescence on exposure to increasing concentrations of isolaxifolin, suggesting a decrease of the MMP (Figure 3D) and that this natural product is impairing mitochondrial function in the test cells. In line with its apoptotic effects (Figure 3C), the disruption of the MMP in the test cells became significant when compound 1 was tested at 17.3 μM (Figure 3D), suggesting this is the source of the apoptotic effects of isolaxifolin. In the present study we have shown that both apigenin and isolaxifolin disrupt the MMP in MDA-MB-231 cancer cells, an observation that lends further weight to our arguments regarding the mode of action of these compounds as selective cytotoxic agents. D

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Immunomodulatory Activity. Effect on the Viability of RAW 264.7 Cells. The impacts of varying concentrations of isolaxifolin and apigenin on the RAW 264.7 immune cell line were determined using an MTT assay in which cell viabilities were compared to a blank control. Isolaxifolin and apigenin were tested at five concentrations up to 6.2 and 9.2 μM, respectively, and the results compared with those derived from the normal cell line LO-2 (Figure 2). Maximum noncytotoxic dosages of 3.1 and 9.2 μM were established for isolaxifolin and apigenin, respectively (Figure 4). Accordingly, these concen-

associated with the production of these proteins in treated RAW 264.7 cells was measured. The relevant gene transcriptions of TNF-α and IL-6 were analyzed using real-time (q)PCR, while GAPDH served as the internal reference. As revealed in Figure 5C, the suppression of TNF-α- and IL-6associated mRNA by apigenin proceeds in a dose-dependent manner. In contrast, little down-regulation of the TNF-α and IL-6 genes was effected by isolaxifolin at the threshold concentration of 3.1 μM. This trend is consistent with the earlier results shown in Figure 5B. Apigenin has been reported39 to regulate the cellular production of NO, TNFα, IL-1β, and IL-6, the first of these playing a particularly important role in immune responses to inflammation40 and the others being significant for tumor prevention and treatment.41 Our results are consistent with earlier observations, and we have also shown that isolaxifolin has no equivalent impact on the production of such cellular regulators, at least in the case of LPS-induced RAW 264.7 cells. In conclusion, the present work resulted in an efficient synthetic method for producing isolaxifolin, a potentially useful agrochemical, from apigenin, a well-known nutraceutical, thus providing, for the first time, a capacity to compare their cytotoxicity and immunomodulatory properties. Such studies have revealed that isolaxifolin showed superior cytotoxicity against five cancer cell lines by inducing cell cycle arrest in the G0/G1 phase, thereby blocking cell cycle progression and causing late-stage apoptosis by decreasing the MMP in the MDA-MB-231 cell line. Unlike apigenin, isolaxifolin reduced NO, TNF-α, and IL-6 secretion in LPS-induced RAW 264.7 cells in a dose-independent manner. Such results serve to encourage the use of isolaxifolin as a safe agrochemical and as a selective cytotoxic agent for certain therapeutic purposes.

Figure 4. Effects of isolaxifolin and apigenin on RAW 264.7 cell viability (mean ± SD, n = 3). *p < 0.05.

■

trations of the natural products were employed in determining their capacities to induce tumor necrosis factors and cytokines (namely, NO, TNF-α, and IL-6) in RAW 264.7 cells. Effects on NO, TNF-α, and IL-6 Production in LPS-Induced Inflammation Models. The effects of isolaxifolin on the levels of tumor necrosis factor and cytokines NO, TNF-α, and IL-6 were performed using lipopolysaccharide (LPS)-induced RAW 264.7 cells since these are more prone to secreting superfluous NO, TNF-α, and IL-6.37 DXM (dextromethorphan) was used as a positive control.38 The production of NO was detected using the Griess assay. In keeping with an earlier report,13 dose-dependent down-regulation of NO production was observed with apigenin (Figure 5A). On the other hand, isolaxifolin inhibited NO secretion slightly more effectively than the control, DXM (p > 0.05), but in a dose-independent manner. However, even at the highest safe concentration (viz., 3.1 μM), isolaxifolin failed to bring NO secretion below the base level (Figure 5A). As such, we conclude that isolaxifolin is not a potent inhibitor of NO production in LPS-induced RAW 264.7 cells. In a control without LPS present, apigenin inhibited NO secretion in a dose-dependent manner, In contrast, isolaxifolin acts in a rather modest and doseindependent manner. The effects of isolaxifolin and apigenin on TNF-α and IL-6 production were established using ELISA kits, and the outcomes of the relevant studies are shown in Figure 5B. Once again, apigenin reduced formation of TNF-α and IL-6 in a dose-dependent manner and to a noticeable degree (p < 0.05), while isolaxifolin had little effect. In order to confirm such effects of isolaxifolin and apigenin on the levels of secretion of TNF-α and IL-6, the mRNA

EXPERIMENTAL SECTION

Materials and Reagents. Apigenin (98.0%), 3-methyl-2-butenal (98.0%), Ca(OH)2 (95.0%), Ph3P (98.0%), 3-methyl-2-buten-1-ol (98.0%), diethyl azodicarboxylate (98.0%), and K2CO3 (99.0%) were purchased from the Energy Chemical Co., Ltd. (Shanghai, China). Eu(fod)3 (99.0%) and LPS were purchased from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco’s modified Eagle medium (DMEM), Roswell Park Memorial Institute-1640 (RPMI 1640) medium, and antibiotics were purchased from Gibco Biotechnology (Beijing, China). Fetal bovine serum (FBS) was obtained from the Tianhang Biotech Co., Inc. (Zhejiang, China). All cell lines were obtained from the Cancer Institute of Sun Yat-Sen University (Guangzhou, China). Annexin V-FITC apoptosis, PI staining, and JC-1 analysis kits were purchased from Becton, Dickinson & Co. (Shanghai, China), while a Hoechst 33258 dsDNA staining kit was obtained from Beyotime Biotechnology (Shanghai, China). NO, tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) analysis kits were purchased from NeoBioscience (Shenzhen, China). General Synthetic and Related Protocols. 1H and 13C NMR spectra were recorded at 25 °C on a Bruker spectrometer operating at 600 or 400 MHz for proton and 150 or 100 MHz for carbon nuclei. For 1H NMR spectra, signals arising from the residual protio-forms of the solvent were used as the internal standards. 1H NMR data are reported as follows: chemical shift (δ) [multiplicity, coupling constant(s) J (Hz), relative integral] where multiplicity is defined as s = singlet; d = doublet; t = triplet; q = quartet; m = multiplet or combinations of the above. Infrared spectra (νmax) were recorded on a Perkin−Elmer 1800 Series FTIR spectrometer. Samples were analyzed as thin films on KBr plates. Low-resolution ESI mass spectra were recorded on a single-quadrupole liquid chromatograph− mass spectrometer, while high-resolution measurements were conducted on a time-of-flight instrument. Melting points were measured on an Optimelt automated melting point system and are E

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 5. Aspects of the immunomodulatory effects of isolaxifolin (1) and apigenin (3). (A) Effects of differing concentrations of isolaxifolin and apigenin on NO production in RAW 264.7 cells. (B) Effect of differing concentrations of isolaxifolin and apigenin on the secretion of TNF-α and IL-6 in RAW 264.7 cells. (C) Effect of differing concentrations of isolaxifolin and apigenin on TNF-α mRNA and IL-6 mRNA expression in RAW 264.7 cells. LPS: lipopolysaccharide, 1.0 μg/mL; DXM: dexamethasone, 254.8 μM; *p < 0.05; **p < 0.01 compared to the LPS group. powder: 1H NMR (400 MHz, DMSO-d6) δ 13.11 (s, 1H), 10.40 (br s, 1H), 7.98 (d, J = 8.9 Hz, 2H), 6.94 (d, J = 8.9 Hz, 2H), 6.89 (d, J = 10.0 Hz, 1H), 6.86 (s, 1H), 6.23 (s, 1H), 5.80 (d, J = 10.0 Hz, 1H), 1.45 (s, 6H); 13C NMR (100 MHz, DMSO-d6) δ 182.0, 163.7, 161.3, 160.9, 158.7, 151.2, 128.6, 128.06, 121.0, 116.1, 114.4, 104.6, 103.0, 101.0, 99.3, 78.1, 27.8; IR (KBr) νmax 3372, 2922, 1656, 1592, 1546, 1344, 1295, 1240, 1172, 1126 cm−1; MS (ESI, +ve) m/z 359 ([M + Na]+, 10), 107 (100); HRMS [M + Na]+ calcd for C20H16O523Na 359.0895, found 359.0893. Concentration of fraction B (Rf = 0.3 in 1:3 v/v EtOAc/n-hexane) afforded compound 5 (2.10 g, 42%) as an amorphous, yellow powder: 1 H NMR (400 MHz, DMSO-d6) δ 13.40 (s, 1H), 10.39 (s, 1H), 7.94 (d, J = 8.8 Hz, 2H), 6.93 (d, J = 8.8 Hz, 2H), 6.84 (s, 1H), 6.58 (m, 2H), 5.79 (d, J = 9.9 Hz, 1H), 1.43 (s, 6H); 13C NMR (100 MHz, DMSO-d6) δ 182.0, 164.0, 161.3, 158.7, 156.4, 155.5, 129.0, 128.6, 121.0, 116.0, 114.5, 104.8, 104.7, 102.9, 95.0, 78.0, 27.8; IR (KBr) νmax 3372, 2969, 2931, 1656, 1608, 1454, 1349, 1238, 1173, 1128 cm−1; MS (ESI, +ve) m/z 701 (100%), 475 (60), 359 ([M + Na]+, 30), 187 (100); HRMS [M + Na]+ calcd for C20H16O523Na 359.0895, found 359.0891.

uncorrected. Eluted TLC plates were visualized using a 254 nm UV lamp, while flash chromatographic separations were carried out using silica gel 60 (40−63 μm) as the stationary phase and the AR-grade solvents indicated as the mobile phase. When necessary, reactions were performed under a nitrogen atmosphere. Specific Chemical Transformations. 5,4′-Dihydroxy-7,8-(2,2dimethylpyrano)flavone (4) and 5,4′-Dihydroxy-6,7-(2,2dimethylpyrano)flavone (5). A magnetically stirred solution of apigenin (4.00 g, 14.8 mmol) in MeOH (150 mL) maintained at 0 °C was treated with 3-methyl-2-butenal (7.20 mL, 74.0 mmol) followed by Ca(OH)2 (2.20 g, 29.6 mmol). The ensuing mixture was warmed to 18 °C and stirred at this temperature for 72 h before being concentrated under reduced pressure. The residue was extracted with EtOAc (300 mL), and the resulting mixture washed with 1 M aqueous HCl (100 mL). The separated organic layer was dried (Na2SO4), filtered, and concentrated under reduced pressure. The brownish oil was subjected to flash chromatography (silica, 1:9 v/v EtOAc/nhexane elution) to give two fractions, A and B. Concentration of fraction A (Rf = 0.25 in 1:3 v/v EtOAc/n-hexane) afforded compound 4 (750 mg, 15%) as an amorphous, yellow F

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

(15); HRMS [M + Na]+ calcd for C25H24O523Na 427.1521, found 427.1506. X-ray Crystallographic Studies. Crystallographic Data for Compound 1. C25H24O5, M = 404.44, T = 150 K, monoclinic, space group C2/c, Z = 8, a = 26.0009(6) Å, b = 9.6431(3) Å, c = 16.4553(4) Å, β = 94.559(2)°, V = 4112.77(19) Å3, Dx = 1.306 g cm−3, 4326 unique data (2θmax = 56.8°), 2885 with I > 2.0σ(I); R = 0.052, Rw = 0.134, S = 1.03. Crystallographic Data for Compound 7. C27H26O6, M = 446.48, T = 100 K, monoclinic, space group P21/n, Z = 4, a = 18.695(2) Å, b = 6.122(3) Å, c = 20.101(4) Å, β = 98.333(18)°, V = 2276.3(14) Å3, Dx = 1.303 g.cm−3, 4646 unique data (2θmax = 52.8°), 3254 with I > 2.0σ(I); R = 0.0575, Rw = 0.1593, S = 1.046. Structure Determination. Images for compound 1 were measured on a Agilent SuperNova diffractometer (Mo Kα, graphite monochromator, λ = 0.710 73 Å), and those for the acetate derivative 7 on the MX1 beamline at the Australian Synchrotron (Melbourne). Data collection, cell refinement, and data reduction for compound 1 employed the CrysAlis PRO program,42 while SHELXT43 and SHELXL44 were used for structure solution and refinement. Data collection, cell refinement, and data reduction for compound 7 used Blu-Ice45 and XDS,46 while the structure was solved with the ShelXT 2018/2 structure solution program47 using the dual solution method and refined with SHELXL44 using Olex248 as the graphical interface. Atomic coordinates, bond lengths and angles, and displacement parameters have been deposited at the Cambridge Crystallographic Data Centre (CCDC Deposition numbers 1888687 and 1888688). The data can be obtained free-of-charge via www.ccdc.cam.ac.uk/ data_request/cif, by e-mailing [email protected] or by contacting the Cambridge Crystallographic Data Centre, 12 Union Road, Cambridge CB2 1EZ, UK; fax: +44 1223 336033. Cell Cultures. The MDA-MB-231, MCF-7, HepG2, LNCaP, and RAW 264.7 cell lines were cultured in DMEM, while the LO-2 and HCT-116 cell lines were grown in RPMI-1640 medium. All media were blended with 10% FBS, 86.0 μM streptomycin, 50 units/mL penicillin, and 71.9 μM gentamycin, while cells were cultured under a 5% CO2 atmosphere at 37 °C. Cytotoxicity Analyses (Using a Methylene Blue Assay). Stock solutions of isolaxifolin and apigenin were prepared in dimethyl sulfoxide (DMSO) at a concentration of 100.0 mg/mL and later diluted with fresh medium to achieve the required concentrations (6.2, 17.3, 24.7, and 30.9 μM for isolaxifolin; 23.1, 46.3, 94.4, and 185.0 μM for apigenin). The final concentration of DMSO in each culture was less than 0.1%. Evaluations of cytotoxicity properties were performed using minor modifications of previously described49 protocols. Thus, cells were seeded at a density of 1.5 × 105 cell/ mL in 100 μL aliquots on a 96-well microplate and incubated overnight (∼12 h). The supernatant liquid in each well was then replaced with fresh medium (100 μL) containing isolaxifolin or apigenin. Experiments were performed in triplicate for 48 h and then stained with the methylene blue solution. The cell viability rate was calculated using eq 1:

4′-Acetoxy-6,7-(2,2-dimethylpyrano)-5-prenyloxyflavone (6). Step i: A magnetically stirred solution of compound 5 (6.6 g, 19.6 mmol) in anhydrous CH2Cl2 (60 mL) maintained at 0 °C was treated with pyridine (1.60 mL, 19.6 mmol) followed by Ac2O (1.86 mL, 19.6 mmol). The ensuing solution was warmed to 18 °C and stirred at this temperature for 6 h before being filtered through a pad of TLC-grade silica gel, and the filtrate concentrated under reduced pressure. The resulting yellow solid was directly subjected to the next step of the reaction sequence. Step ii: A magnetically stirred solution of the acetate was dissolved in dry tetrahydrofuran (THF) (60 mL) and cooled to 0 °C followed by the addition of Ph3P (7.7 g, 29.4 mmol), 3-methyl-2-buten-1-ol (3.0 mL, 29.4 mmol), and diethyl azodicarboxylate (4.6 mL, 29.4 mmol). The ensuing mixture was warmed to 18 °C, stirred at this temperature for 6 h, then concentrated under reduced pressure followed by flash chromatography (silica, 5:95 v/v EtOAc/n-hexane elution). Concentration of the appropriate fractions (Rf = 0.6 in 1:3 v/v EtOAc/n-hexane) afforded compound 6 (6.0 g, 68% from 5) as an amorphous, pale-yellow powder: 1H NMR (600 MHz, DMSO-d6) δ 8.09 (d, J = 8.7 Hz, 2H), 7.34 (d, J = 8.7 Hz, 2H), 6.90 (s, 1H), 6.81 (s, 1H), 6.64 (d, J = 10.1 Hz, 1H), 5.90 (d, J = 10.1 Hz, 1H), 5.53 (m, 1H), 4.51 (d, J = 7.3 Hz, 2H), 2.32 (s, 3H), 1.72 (s, 3H), 1.61 (s, 3H), 1.44 (s, 6H); 13C NMR (150 MHz, DMSO-d6) δ 176.1, 169.4, 159.9, 158.5, 157.8, 153.6, 153.3, 138.3, 131.6, 128.8, 128.0, 123.1, 120.7, 116.4, 113.9, 112.8, 108.3, 101.1, 78.1, 71.7, 28.3, 26.0, 21.4, 18.2; IR (KBr) νmax 2974, 2931, 1756, 1638, 1599, 1505, 1445, 1361, 1291, 1191, 1164, 1119, 1086, 1019, 912 cm−1; MS (ESI, +ve) m/z 469 ([M + Na]+, 100%), 447 ([M + H]+,10); HRMS [M + Na]+ calcd for C27H26O623Na 469.1627, found 469.1628. 4′-Acetoxy-5-hydroxy-6,7-(2,2-dimethylpyrano)-8-prenylflavone (7). A magnetically stirred solution of compound 6 (6.00 g, 13.4 mmol) in CHCl3 (60 mL) was treated with Eu(fod)3 (800 mg, 0.77 mmol), and the ensuing mixture was heated at 60 °C for 1 h before being cooled and concentrated under reduced pressure. The yellow solid obtained was subjected to flash chromatography (silica, 5:95 v/v EtOAc/n-hexane elution), and concentration of the appropriate fractions (Rf = 0.8 in 1:3 v/v EtOAc/n-hexane) afforded compound 7 (5.00 g, 83%) as yellow needles, mp = 132−134 °C: 1H NMR (400 MHz, CDCl3) δ 12.93 (s, 1H), 7.91 (d, J = 8.8 Hz, 2H), 7.28 (d, J = 8.8 Hz, 2H), 6.74 (d, J = 10.1 Hz, 1H), 6.62 (s, 1H), 5.63 (d, J = 10.1 Hz, 1H), 5.21 (m, 1H), 3.50 (d, J = 7.1 Hz, 2H), 2.35 (s, 3H), 1.83 (s, 3H), 1.70 (s, 3H), 1.47 (s, 6H); 13C NMR (100 MHz, CDCl3) δ 182.8, 169.1, 162.7, 157.1, 154.5, 153.2, 131.8, 129.3, 128.0, 127.6, 122.4, 122.2, 115.8, 107.6, 105.6, 105.5, 105.3, 77.9, 28.2, 25.8, 21.7, 21.2, 18.1; IR (KBr) νmax 2977, 2926, 1763, 1653, 1582, 1507, 1436, 1367, 1320, 1202, 1168, 1119, 1079, 910 cm−1; MS (ESI, +ve) m/z 469 ([M + Na]+, 100%), 443 (40), 427 (80), 405 (30); HRMS [M + Na]+ calcd for C27H26O623Na 469.1627, found 469.1624. Isolaxifolin (1). A magnetically stirred solution of compound 7 (5.0 g, 11.2 mmol) in dry MeOH/THF (90 mL of a 2:1 v/v mixture) was cooled to 0 °C and then treated with K2CO3 (1.50 g, 11.2 mmol). The ensuing mixture was stirred for 4 h at 0 °C and concentrated under reduced pressure, and the yellow oil obtained was then subjected to flash chromatography (silica, 5:95 v/v EtOAc/n-hexane elution). Concentration of the appropriate fractions (Rf = 0.5 in 1:3 v/ v EtOAc/n-hexane) and recrystallization of the resulting solid (from CDCl3) afforded isolaxifolin 1 (3.20 g, 71%) as yellow crystals, mp = 120 °C [lit.2 mp = 259−260 °C (after recrystallization from EtOAc/ n-hexane)]; presumably, two distinct crystal morphologies have been obtained from these two different solvent systems and, thus, the melting points of the two samples are significantly different. 1H NMR (400 MHz, CDCl3) δ 12.99 (s, 1H), 7.80 (d, J = 8.7 Hz, 2H), 6.97 (d, J = 8.7 Hz, 2H), 6.74 (d, J = 10.0 Hz, 1H), 6.56 (s, 1H), 5.76 (br s, 1H), 5.62 (d, J = 10.0 Hz, 1H), 5.24 (m, 1H), 3.51 (d, J = 7.1 Hz, 2H), 1.83 (s, 3H), 1.69 (s, 3H), 1.47 (s, 6H); 13C NMR (100 MHz, CDCl3) δ 182.9, 164.6, 160.4, 157.2, 154.4, 154.0, 131.8, 128.4, 128.1, 122.8, 122.1, 116.3, 115.7, 107.8, 105.6, 104.8, 102.9, 77.9, 28.2, 25.7, 21.6, 18.1; IR (KBr) νmax 3386, 2976, 2926, 1654, 1606, 1562, 1507, 1466, 1433, 1346, 1294, 1205, 1173, 1127, 835 cm−1; MS (ESI, +ve) m/z 427 ([M + Na]+, 100%), 405 ([M + H]+,15), 245 (20), 217

Cell viability = (Absx /Abs0 ) × 100%

(1)

where Absx is the absorbance measured for cells treated with varying concentrations of the test compounds and Abs0 is the absorbance measured for the cells not exposed to the test substrates. Standard deviations were calculated in triplicate. Cell Cycle Analyses. Each phase of the cell cycle was evaluated using the PI staining method. Thus, MDA-MB-231 cells were placed in a six-well plate and incubated, under standard conditions, for 24 h. The supernatant liquid was then replaced with fresh media containing varying concentrations of isolaxifolin (8.6, 12.4, and 17.3 μM), and incubation continued for a further 48 h. The treated MDA-MB-231 cells were pelleted and then fixed with 75% ethanol solution and maintained at −20 °C overnight before being stained, in the dark at ambient temperatures, with PI-containing RNase for 15 min. A ca. 10 000-cell sample from each well was then analyzed by flow cytometry using a FACSCanto cell analyzer (Becton, Dickinson & Co., USA). G

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Nuclear Morphology Analyses Using Hoechst 33258. The nuclear morphologies of isolaxifolin-treated MDA-MB-231 cells were evaluated using a Hoechst 33258 kit and following the manufacturer’s protocol. MDA-MB-231 cells were grown, under standard conditions, in a six-well culture plate for 24 h. The supernatant liquid was then replaced with fresh media containing varying concentrations of isolaxifolin (8.6, 12.4, and 17.3 μM), and incubation continued for 48 h. After this time, the supernatant medium was removed and the residual cellular material treated with 0.5 mL of the fixing solution for 10 min, before being washed three times with PBS buffer, then stained with Hoechst 33258 dye for 5 min. The excess dye solution was removed, and examination of the residual cells was conducted under a fluorescence microscope (AXIO, Vert.A1, Germany) using excitation and emission wavelengths of 350 and 460 nm, respectively. Apoptosis Analyses. The rates of isolaxifolin-induced apoptosis of MDA-MB-231 cells were analyzed using an annexin V-FITC/PI apoptosis detection kit. Thus, the MDA-MB-231 cells were treated with isolaxifolin-containing medium (8.6, 12.4, and 17.3 μM) for 48 h, and the harvested cells then treated in the dark and at ambient temperatures with annexin V-FITC/PI for 15 min. A total of 10 000 cells from each sample were then examined by flow cytometry. MMP Analyses. The MMPs of MDA-MB-231 cells that had been treated with differing concentrations of isolaxifolin for 48 h were analyzed using a commercial kit (JC-1) containing the membranepermeant dye 5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide. Thus, the harvested cells were stained in the dark for 15 min, and the flow cytometry profiles were recorded. An excitation wavelength of 488 nm was used while emissions were observed at 525 and 590 nm for green fluorescence and red fluorescence, respectively. The results of such MMP analyses are presented as percent ratios of green-to-red fluorescence intensities. Analyses of the Viability of RAW 264.7 Cells. The effects of isolaxifolin and apigenin on the viability of RAW 264.7 cells were determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Isolaxifolin and apigenin were dissolved in DMSO and diluted with DMEM to concentrations of 6.2 μM by four serial dilutions. The final DMSO content was less than 1%. RAW 264.7 cells were seeded in a 96-well microplate at a density of 2.5 × 104 cells/well and then cultured for 12 h. The supernatant liquid in each well was then replaced with media containing differing concentrations of isolaxifolin and apigenin. A blank control was also prepared. After another 24 h of incubation, cell numbers were measured after treatment with the MTT dye solution. The viabilities of the RAW 264.7 cells were then calculated using eq 1. Evaluation of Immunomodulatory Activity. RAW 264.7 cells were seeded at 1 × 105/well in 24-well plates, then incubated at 37 °C under a 5% CO2 atmosphere for 4 h. The LPS (1.0 μg/mL) solution was added to each well and incubated for 24 h. The medium was replaced by solutions containing differing concentrations of isolaxifolin (0.8, 1.6, 3.1 μM) or apigenin (2.3, 4.6, 9.2 μM). After 24 h, the cellular productions of NO, TNF-α, and IL-6 were determined with LPS (1 μg/mL) being used to induce inflammatory responses, while DXM (254.8 μM) was employed as a positive control. RNA Extraction and mRNA Analysis. A total extraction of the mRNA in the RAW 264.7 cells was effected using the TRIzol reagent kit (Invitrogen, Carlsbad, CA, USA). The purity and concentration of the extracted mRNA and its reverse transcription to cDNA were effected using kits supplied by TaKaRa Biotechnology (Dalian, China). The necessary divergent and convergent primers were purchased from Taihe Biotechnology Co., Ltd. (Beijing, China), while the primer sequences used in the study are shown in Table 2. Polymerase chain reactions (PCR) were carried out using the LightCycler 96 System kit (Roche Diagnostics, Mannheim, Germany). Following the instructions provided with this kit, the super PCR mix, forward primers, reverse primers, cDNA, buffer, and nuclease-free water were blended together. The mRNA expression levels of TNF-α and IL-6 were displayed using GAPDH as the housekeeping “gene”.

Table 2. Sequences of TNF-α, IL-6, and GAPDH Primers name

sequence (5′−3′)

TNF-α

forward: CCACCACGCTCTTCTGTCTA reverse: TGGTTTGTGAGTGTGAGGGT forward: TTCTTGGGACTGATGCTGGT reverse: CAGGTCTGTTGGGAGTGGTA forward: AACGACCCCTTCATTGACCT reverse: CATTCTCGGCCTTGACTGTG

IL-6 GAPDH

Statistical Analyses. Experiments were performed in triplicate, and the results were presented as mean values ± standard deviation (SD). Statistical analyses were performed using the SPSS software (SPSS, Inc., Chicago, IL, USA) to identify any significant deviations. All values were assessed by one-way analysis of variance (ANOVA) in conjunction with Duncan’s new multiple-range test (MRT). p < 0.05 was deemed as statistically significant.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jnatprod.9b00113. 1 H and 13C NMR spectra of compounds 1 and 4−6 and ORTEPs derived from the single-crystal X-ray analyses of compounds 1 and 7 (PDF) X-ray crystallographic data for compound 1 (CIF) X-ray crystallographic data for compound 7 (CIF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel: +86-20-85221367. ORCID

Yongsheng Chen: 0000-0003-0597-814X Martin G. Banwell: 0000-0002-0582-475X Ping Lan: 0000-0002-9285-3259 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors thank the Chinese National Natural Science Foundation (grant 31700670, 21801094), the Program for Guangdong YangFan Introducing Innovative and Entrepreneurial Teams (grant 2016YT03H132), and the Department of Science and Technology of Guangdong Province under grant 2016A010105010 for financial support. Some of the X-ray crystallographic studies reported herein were undertaken on the MX1 beamline at the Australian Synchrotron (Melbourne) and part of Australia’s Nuclear Science and Technology Organization (ANSTO).

■

REFERENCES

(1) Chien, S.-C.; Chen, C.-C.; Wang, S.-Y.; Wu, J.-H.; Shih, C.-C.; Chao, L. K.; Chao, C.-Y.; Chiu, H.-L.; Kuo, Y.-H. Phytochem. Lett. 2017, 21, 29−31. (2) Lin, Y.-L.; Chen, Y.-L.; Kuo, Y.-H. Chem. Pharm. Bull. 1991, 39, 3132−3135. (3) Hymavathi, A.; Devanand, P.; Suresh, B. K.; Sreelatha, T.; Pathipati, U. R.; Madhusudana, R. J. J. Agric. Food Chem. 2011, 59, 1653−1657. (4) Puttarak, P.; Sawangjit, R.; Chaiyakunapruk, N. J. Ethnopharmacol. 2016, 194, 316−323.

H

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

(5) Sreelatha, T.; Hymavathi, A.; Rama, S. R. V.; Devanand, P.; Usha, R. P.; Madhusudana, R. J.; Suresh, B. K. Bioorg. Med. Chem. Lett. 2010, 20, 549−553. (6) Rani, P. U.; Hymavathi, A.; Babu, K. S.; Rao, A. S. J. Biopesticides 2013, 6, 14−21. (7) Sriwanthana, B.; Chavalittumrong, P.; Suphaphon, B.; Wongsinkongman, P.; Kijphati, R. J. Tradit. Thai Altern. Med. 2011, 3, 17−26. (8) Duthie, G.; Crozier, A. Curr. Opin. Clin. Nutr. Metab. Care 2000, 11, 447−451. (9) Shukla, S.; Gupta, S. Mol. Cancer Ther. 2006, 5, 843−852. (10) Birt, D. F.; Hendrich, S.; Wang, W. Pharmacol. Ther. 2001, 90, 157−177. (11) Song, J. L.; Son, K. H.; Chang, H. W.; Do, J. C.; Jung, K. Y.; Kang, S. S.; Kim, H. P. Arch. Pharmacal Res. 1993, 16, 25−28. (12) Lee, J.-H.; Zhou, H. Y.; Cho, S. Y.; Kim, Y. S.; Lee, Y. S.; Jeong, C. S. Arch. Pharmacal Res. 2007, 30, 1318−1327. (13) Funakoshi-Tago, M.; Nakamura, K.; Tago, K.; Mashino, T.; Kasahara, T. Int. Immunopharmacol. 2011, 11, 1150−1159. (14) Singh, J. P.; Selvendiran, K.; Banu, S. M.; Padmavathi, R.; Sakthisekaran, D. Phytomedicine 2004, 11, 309−314. (15) Romanová, D.; Vachálková, A.; Cipák, L.; Ovesná, Z.; Rauko, P. Neoplasma 2001, 48, 104−107. (16) Madunić, I. V.; Madunić, J.; Antunović, M.; Paradžik, M.; Garaj-Vrhovac, V.; Breljak, D.; Marijanović, I.; Gajski, G. NaunynSchmiedeberg's Arch. Pharmacol. 2018, 391, 1−14. (17) Shukla, S.; Gupta, S. Pharm. Res. 2010, 27, 962−978. (18) Zhou, X.; Wang, F.; Zhou, R.; Song, X.; Xie, M. J. Food Biochem. 2017, 41, e12376. (19) Gupta, S.; Afaq, F.; Mukhtar, H. Biochem. Biophys. Res. Commun. 2001, 287, 914−920. (20) Kim, H. J.; Ahn, M. R. Nat. Prod. Commun. 2016, 11, 1433− 1436. (21) Shi, M. D.; Shiao, C. K.; Lee, Y. C.; Shih, Y. W. Cancer Cell Int. 2015, 15, 33. (22) Ali, F.; Rahul; Naz, F.; Jyoti, S.; Siddique, Y. H. Int. J. Food Prop. 2017, 20, 1197−1238. (23) Patel, D.; Shukla, S.; Gupta, S. Int. J. Oncol. 2007, 30, 233−245. (24) Tang, D.; Chen, K.; Huang, L.; Li, J. Expert Opin. Drug Metab. Toxicol. 2017, 13, 1−8. (25) Zheng, S. Y.; Li, X. P.; Tan, H. S.; Yu, C. H.; Zhang, J. H.; Shen, Z. W. Eur. J. Org. Chem. 2013, 2013, 1356−1366. (26) Zheng, Z. P.; Cheng, K. W.; To, J. T. K.; Li, H.; Wang, M. Mol. Nutr. Food Res. 2008, 52, 1530−1538. (27) Al-Maharik, N.; Botting, N. P. Tetrahedron 2003, 59, 4177− 4181. (28) Yalamanchili, C.; Chittiboyina, A. G.; Rotte, S. C. K.; Katzenellenbogen, J. A.; Helferich, W. G.; Khan, I. A. Tetrahedron 2018, 74, 2020−2029. (29) Simons, R.; Gruppen, H.; Bovee, T. F. H.; Verbruggen, M. A.; Vincken, J. P. Food Funct. 2012, 3, 810−827. (30) Raksat, A.; Maneerat, W.; Andersen, R. J.; Pyne, S. G.; Laphookhieo, S. J. Nat. Prod. 2018, 81, 1835−1840. (31) For commentaries on the antiproliferative effects of apigenin, see: (a) Perrott, K. M.; Wiley, C. D.; Desprez, P. Y.; Campisi, J. Geroscience 2017, 39, 161−173. (b) Bhattacharya, S.; Mondal, L.; Mukherjee, B.; Dutta, L.; Ehsan, I.; Debnath, M. C.; Gaonkar, R. H.; Pal, M. M.; Majumdar, S. Nanomedicine 2018, 14, 1905−1917. (c) Shukla, S.; Abbas, A.; Gupta, S. Abstract 4649: Apigenin increases maspin expression and suppresses invasiveness in prostate cancer cells. In Proceedings: AACR 106th Annual Meeting 2015; AACR: 2015; DOI: 10.1158/1538-7445.AM2015-4649. (d) Lee, Y.; Sung, B.; Kang, Y. J.; Kim, D. H.; Jang, J. Y.; Hwang, S. Y.; Kim, M.; Lim, H. S.; Yoon, J. H.; Chung, H. Y. Int. J. Oncol. 2014, 44, 1599−1606. (e) Wang, I. K.; Lin-Shiau, S. Y.; Lin, J. K. Eur. J. Cancer 1999, 35, 1517−1525. (f) Tseng, T. H.; Chien, M. H.; Lin, W. L.; Wen, Y. C.; Chow, J. M.; Chen, C. K.; Kuo, T. C.; Lee, W. J. Environ. Toxicol. 2017, 32, 434− 444. (32) Carnero, A. Br. J. Cancer 2002, 87, 129−133.

(33) Arathi, B. P.; Raghavendra-Rao Sowmya, P.; Kuriakose, G. C.; Shilpa, S.; Shwetha, H. J.; Kumar, S.; Raju, M.; Baskaran, V.; Lakshminarayana, R. J. Agric. Food Chem. 2018, 66, 11362−11371. (34) Shukla, S.; Gupta, S. Clin. Cancer Res. 2004, 10, 3169−3178. (35) Ruela-de-Sousa, R.; Fuhler, G.; Blom, N.; Ferreira, C.; Aoyama, H. Cell Death Dis. 2010, 1, e19. (36) Kroemer, G.; Galluzzi, L.; Brenner, C. Physiol. Rev. 2007, 87, 99−163. (37) Wu, W.; Wang, S.; Liu, Q.; Wang, X.; Shan, T.; Wang, Y. Free Radical Biol. Med. 2018, 129, 338−353. (38) Qin, X.; Jiang, X.; Jiang, X.; Wang, Y.; Miao, Z.; He, W.; Yang, G.; Lv, Z.; Yu, Y.; Zheng, Y. Sci. Rep. 2016, 6, 23240. (39) Ginwala, R.; McTish, E.; Raman, C.; Singh, N.; Nagarkatti, M.; Nagarkatti, P.; Sagar, D.; Jain, P.; Khan, Z. K. J. Neuroimmune Pharm. 2016, 11, 36−47. (40) Guzik, T.; Korbut, R.; Adamek-Guzik, T. J. Physiol. Pharmacol. 2003, 54, 469−487. (41) Aggarwal, B. B.; Vijayalekshmi, R. V.; Sung, B. Clin. Cancer Res. 2009, 15, 425−430. (42) CrysAlis PRO Version 1.171.37.35h (release 09−02−2015 CrysAlis171.NET) (compiled Feb 9 2015, 16:26:32); Agilent Technologies: Oxfordshire, UK. (43) Sheldrick, G. M. Acta Crystallogr., Sect. A: Found. Adv. 2015, A71, 3−8. (44) Sheldrick, G. M. Acta Crystallogr. 2015, C71, 3−8. (45) McPhillips, T. M.; McPhillips, S. E.; Chiu, H. J.; Cohen, A. E.; Deacon, A. M.; Ellis, P. J.; Garman, E.; Gonzalez, A.; Sauter, N. K.; Phizackerley, R. P.; Soltis, S. M.; Kuhn, P. J. Synchrotron Radiat. 2002, 9, 401−406. (46) Kabsch, W. J. Appl. Crystallogr. 1993, 26, 795−800. (47) https://www.xrayforum.co.uk/viewtopic.php?t=3010 (accessed 1/10/19). (48) Dolomanov, O. V.; Bourhis, L. J.; Gildea, R. J.; Howard, J. A. K.; Puschmann, H. J. Appl. Crystallogr. 2009, 42, 339−341. (49) Chen, Y.; Chen, G.; Fu, X.; Liu, R. H. J. Agric. Food Chem. 2015, 63, 169−176.

I

DOI: 10.1021/acs.jnatprod.9b00113 J. Nat. Prod. XXXX, XXX, XXX−XXX