De novo Biosynthesis of Indole-3-acetic acid in Engineered

Jul 5, 2019 - Indole-3-acetic acid (IAA) is considered the most common and important naturally occurring auxin in plants and a major regulator of plan...
5 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX

De Novo Biosynthesis of Indole-3-acetic Acid in Engineered Escherichia coli Daoyi Guo,* Sijia Kong, Xu Chu, Xun Li, and Hong Pan*

Downloaded via BUFFALO STATE on July 19, 2019 at 14:17:11 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Key Laboratory of Organo-Pharmaceutical Chemistry, Jiangxi Province Gannan Normal University, Ganzhou 341000, China ABSTRACT: Indole-3-acetic acid (IAA) is considered the most common and important naturally occurring auxin in plants and a major regulator of plant growth and development. In this study, an aldehyde dehydrogenase AldH from Escherichia coli was found to convert indole-3-acetylaldehyde into IAA. Then we established an artificial pathway in engineered E. coli for microbial production of IAA from glucose. The overall pathway includes the upstream pathway from glucose to L-tryptophan and the downstream pathway from L-tryptophan to IAA. To our knowledge, this is the first report on the biosynthesis of IAA directly from a renewable carbon source. The study described here shows the way for the development of a beneficial microbe for biosynthesis of auxin and promoting plant growth in the future. KEYWORDS: metabolic engineering, Escherichia coli, aldehyde dehydrogenase, indole-3-acetic acid

■

INTRODUCTION Indole-3-acetic acid (IAA) is the most common plant auxin, and it plays a central role in modulating plant growth and development.1 Despite the importance of IAA in plant development and a long history of study, our knowledge about the IAA biosynthesis remains limited.2−4 Many rhizosphere bacteria can also synthesize IAA, which acts as a signal molecule to promote plant growth.5,6 Most of the IAA biosynthesis pathways use L-tryptophan as the starting substrate, and they include indole-3-pyruvic acid, indole-3acetamide, indole-3-acetonitrile, tryptamine, and tryptophan side-chain oxidase pathways.7−10 Among them, the indole-3pyruvic acid pathway may be the main route in both microorganisms and plants. Originally, a three-step indole-3pyruvic acid route was postulated in the microorganism: IAA production via an indole-3-pyruvic acid route consists of three steps; L-tryptophan is first converted to indole-3-pyruvic acid by an aminotransferase. Subsequently, a decarboxylase enzyme decarboxylates indole-3-pyruvic acid into indole-3-acetylaldehyde. Finally, indole-3-acetylaldehyde is oxidized to IAA by aldehyde dehydrogenase. A two-step indole-3-pyruvic acid route for the biosynthesis of IAA has been established in plants.8 L-Tryptophan is first converted into indole-3-pyruvic acid by the TAA family of aminotransferases.11 The subsequent conversion of indole-3-pyruvic acid to IAA is catalyzed by the YUC family of flavin-containing monooxygenases.12,13 Recently, a novel alternative route for the biosynthesis of IAA from Rhizobium tropici CIAT 899 was proposed by Imada et al. and confirmed by Tullio et al., in which an indolepyruvate ferredoxin oxidoreductase converts indole-3-pyruvic acid straight to IAA.14,15 In recent years, many microbes have been tested to evaluate their capacity of synthesizing IAA from L-tryptophan.16,17 However, the de novo biosynthesis of IAA from a renewable carbon source by engineered micro-organisms is lacking. In this study, we show that an aldehyde dehydrogenase AldH from Escherichia coli can catalyze the oxidation of indole-3acetylaldehyde to the corresponding IAA. Then we design an © XXXX American Chemical Society

IAA biosynthetic pathway from L-tryptophan in E. coli. Finally, a de novo biosynthetic pathway for the production of IAA from glucose is constructed through strengthening the shikimate pathway (Figure 1). The study described here shows the way for the development of a microorganism for production of auxin and promoting plant growth in the future.

■

MATERIALS AND METHODS

Enzymes, Chemicals, and Strains. Restriction endonucleases and DNA polymerases were purchased from NEB (New England Biolabs). T4 DNA ligase, plasmid extraction kits, PCR purification kits, and DNA extraction kits were purchased from Fermentas (Burlington, Canada). Indole-3-acetylaldehyde was prepared from indole-3-acetylaldehyde bisulfite as described by Bower et al.18 E. coli DH1013 was used for plasmid construction and screening. E. coli strain RARE whose seven aldehyde reductase genes (dkgB, yeaE, yqhC, yqhD, dkgA, yahK, yjgB) have been deleted is a gift from Professor Kristala L. J. Prather. E. coli strain DG120 which was constructed by deleting the trpR gene using homologous recombination with the Lambda Red system in strain RARE was used as a host for fermentation to synthesize IAA from glucose. Primers trpR-F and trpR-R were used to amplify the kanamycin resistance gene from the plasmid pKD13 with homology arms to the region nearby the trpR gene.19 Production and Purification of Aldehyde Dehydrogenase. To purify E. coli aldehyde dehydrogenase AldH, the corresponding plasmid (pDG-AldH) was introduced via transformation into E. coli BL21(DE3). Single colonies were grown in LB medium with 50 μg/ mL kanamycin at 37 °C until OD600 reached 0.6−0.8. Cultures were cooled to 30 °C, and IPTG was added to a final concentration of 0.1 mM. Cells were harvested 6 h after induction by centrifugation at 5000g for 5 min. The cell pellet was washed twice with 50 mM PBS (pH 7.0) and resuspended in the same buffer containing 1 mM dithiothreitol (DTT). Resuspended cells were lysed by sonication and centrifuged at 45 000g. The soluble fraction was subjected to purification using a His GraviTrap column (11-0033-99; GE Received: Revised: Accepted: Published: A

April 2, 2019 June 26, 2019 July 5, 2019 July 5, 2019 DOI: 10.1021/acs.jafc.9b02048 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 1. Engineered pathways for the production of IAA from glucose.

Table 1. Primers Used in This Study primer name

sequence (5′-3′)

trpR-F trpR-R aldH-NdeI aldH-XhoI trpABCD-XbaI trpABCD-XhoI trpEfbr-XbaI trpEfbr-SpeI-BamHI serAf br-XbaI serAf br-SpeI-SalI

GGAGGCATTTTGCTTCCCCCGCTAACAATGGCGACATATTCCTTCGTTTGTGCGGATCCC CACGATGCCTGATGCGCCACGTCTTATCAGGCCTACAAAATCAGTCCTGCTCCTCGGCCA GTGTCTACATATGAATTTTCATCATCTGGCTTACTG AGTTCTCGAGTCAGGCCTCCAGGCTTATCC CCATCTAGATTTAAGAGGAGATATAATGGCTGACATTC TGCTGCTCGATAGATTCTCGAGTTAACTGCGCGTCGCCGCT GTATCTAGAAAGAGGAGATATAATGCAAACACAAAAACCGACTCTC TATGGATCCACTAGTTCAGAAAGTCTCCTGTGCATGATG GTATCTAGAAAGAGGAGATATAATGGCAAAGGTATCGCTGGAG ATATGTCGACACTAGTTTAGTACAGCAGACGGGCGC

XbaI and serAf br-SpeI-SalI, and ligated into pET28a(+) via XbaI and SalI to yield plasmid pDG32. The XbaI-SalI fragment of trpEf br from pDG31 was inserted into SpeI and SalI sites of pDG11 to give pDG33. The XbaI-SalI fragment of serAf br from pDG32 was inserted into SpeI and SalI sites of pDG33 to give pDG34. The XbaI-SalI fragment of aroGf br, trpEf br, and serAf br from pDG34 was inserted into XbaI and XhoI sites of pBBRMCS1 to give pDG35. All of the primers used in this study are listed in Table 1. The bacterial strains and plasmids used in this study are listed in Tables 2 and 3. Shake Flask Cultures. Shake flask cultures were performed at 30 °C in 100 mL of modified M9 medium with 20 g/L of glucose as previously described by Guo.23 Both 36 mg/L chloromycetin and 50 mg/L kanamycin were added to the medium when needed. When the OD600 reached about 0.6−0.8, IPTG was added to the medium for induction of gene expression at a final concentration of 0.1 mM. Analytical Methods. The extraction of IAA was carried out as previously described by Guo et al.22 Ethyl acetate was used to extract IAA. A 1 μL portion of the ethyl acetate phase was analyzed after a split injection on an Agilent 7890A GC equipped with an Agilent 5975 MS detector and an Agilent HP-5MS capillary column. Ethics Approval. This article does not contain any studies with human participants or animals performed by any of the authors.

Healthcare, Sweden). The eluate from the column was pooled and dialyzed to remove salts. Cell-free extracts and purified enzyme were analyzed by SDS-PAGE. Determination and Characterization of Aldehyde Dehydrogenase Activity. Aldehyde dehydrogenase activity was measured using a method described by Jo et al. with slight modifications.20 The reaction mixture containing 50 mM PBS (pH 8.0), 2 mM DTT, and 20 μg/mL AldH was incubated at 25 °C for 5 min. The reaction was initiated by adding 0.1−1 mM aldehyde(s) and 4 mM NAD+. Enzyme activity was assessed by measuring the reduction of NAD+ to NADH at 340 nm. The amount of NADH formed was determined using a molar extinction coefficient (Δε340) of 6.22 × 103 M−1 cm−1. Plasmid Construction. Plasmid pDG9 for coexpression aminotransferase aro8 and decarboxylase kdc gene from Saccharomyces cerevisiae and aldehyde dehydrogenase aldH gene from E. coli was constructed in our previous study.21 TrpABCD was amplified by PCR using primers trpABCD-XbaI and trpABCD-XhoI and ligated into pDG9 via NheI and XhoI to yield plasmid pDG30. Plasmid pDG11 for expression 3-deoxy-7-phosphoheptulonate synthase aroGf br was constructed in our previous study.22 Anthranilate synthase trpEf br (S40F, GenBank NP_415780.1) was synthesized by Genewiz Biotech Co. Ltd., amplified by PCR using primers trpEfbrXbaI and trpEf br-SpeI-BamHI, and ligated into pET28a(+) via XbaI and BamHI to yield plasmid pDG31. Phosphoglycerate dehydrogenase serAf br (H344A/N364A, GenBank NP_417388.1) was synthesized by Genewiz Biotech Co. Ltd., amplified by PCR using primers serAfbrB

DOI: 10.1021/acs.jafc.9b02048 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 2. Plasmids Used in This Study plasmids

properties

source

pDG-AldH

this study 19

pDG9 pDG11 pDG30

N-terminal His-tagged AldH, inserted between NdeI and XhoI sites of pET28a(+) contains the kanamycin resistance gene from Tn5 flanked by FRT sites pET28a; pT7: aro8, kdc, and aldH pET28a; pT7: aroGfbr pET28a; pT7: aro8, kdc, aldH, and trpABCD

pDG31

pET28a; pT7: trpEfbr

pDG32

pET28a; pT7: serAf br

pDG33

pET28a; pT7: aroGfbr and trpEf br

pDG34

pET28a; pT7: aroGfbr, trpEf br, and serAf br

pDG35

pBBRMCS1; pT7: aroGf br, trpEf br, and serAf br

pKD13

21 22 this study this study this study this study this study this study

Table 3. Strains Used in This Study strains RARE BL21(DE3) DH1013 DG120 DG121 DG122

■

properties MG1655 derivative; ΔdkgB, ΔyeaE, ΔyqhC, ΔyqhD, ΔdkgA, ΔyahK, and ΔyjgB F− ompT lon hsdSB (rB−mB−) gal dcm (DE3) F− endAl recAl galE15 ga1K16 nupG rpsL ΔlacX74 RARE derivative; ΔtrpR RARE/pDG9 DG120/pDG30/pDG35

source 28 NEB

Figure 2. Expression and purification of recombinant E. coli AldH protein: (1) cell-free soluble extracts of E. coli AldH.; (2) purified E. coli AldH.

Invitrogen this study this study this study

produced up to 387 ± 19.8 mg/L IAA from 0.5 g/L of tryptophan with a molar yield of 0.90 moL/moL (Figure 3). This proves that the designed IAA synthetic pathway from Ltryptophan was functionally expressed in E. coli. AldH -Dependent in Vivo Production of IAA from Glucose. After successfully showing the biosynthesis of IAA from L-tryptophan in E. coli, we further designed a de novo biosynthesis pathway of IAA from glucose. To obtain IAA from glucose, candidate strains need to have a strong capacity for the intrinsic L-tryptophan synthesis. Recently, great progress has been made on engineered E. coli with the goal of efficient production of L-tryptophan from glucose.24,25 Indole and Lserine are two precursor substrates for the production of Ltryptophan. Therefore, increasing the intracellular titer of indole and L-serine is indispensable for efficient biosynthesis of L-tryptophan. In order to improve the intrinsic L-tryptophan synthesis, several strategies have been applied in this study, such as knocking out L-tryptophan transcriptional repressor trpR to deregulate transcription regulation in the L-tryptophan pathway, overexpression of feedback-resistant derivatives of AroGfbr and anthranilate synthase TrpEfbr to increase the intracellular titer of indole, overexpression of feedback-resistant derivatives of SerAfbr to increase the intracellular titer of L-serine, and overexpression of TrpABCD for the efficient biosynthesis of Ltryptophan from indole and L-serine. Finally, a complete IAA biosynthetic pathway was established by further coexpression of ARO8, KDC, and AldH for conversion of L-tryptophan to IAA. The resulting E. coli strain DG122 produced up to 744 ± 26.9 mg/L IAA from 20 g/L of glucose after induction for 24 h (Figure 3). This proves that the designed IAA biosynthetic pathway from glucose was functionally expressed in E. coli. Besides IAA, the significant formation of phenylacetic acids and 4-hydroxyphenylacetic acids was also observed in this

RESULT Kinetic Characterization of AldH. An aldehyde dehydrogenase AldH from E. coli was earlier discovered and can accept a broad range of various aldehydes as substrates.20 We speculated on whether the observed promiscuity of the AldH could extend also to indole-3-acetylaldehyde. The AldH enzyme was purified by nickel-based affinity chromatography, and its activity was verified in vitro via the reduction of NAD+, in the presence of indole-3-acetylaldehyde. The purity of the AldH was evaluated by SDS−PAGE, which showed one band with a molecular mass of about 54 kDa (Figure 2). AldH preferred NAD+ over NADP+ as a cofactor for the oxidation of indole-3-acetylaldehyde tested. The steady-state Michaelis− Menten kinetics and the catalytic efficiency for indole-3acetylaldehyde in the presence of NAD+ were 3.78 mM and 8.96 S−1, respectively. The biochemical characteristics of E. coli AldH show that it can accept indole-3-acetylaldehyde as substrate. AldH-Dependent in Vivo Production of IAA from LTryptophan. We designed an IAA biosynthetic pathway from L-tryptophan in E. coli RARE strain. This pathway comprised three gene products: S. cerevisiae aminotransferase ARO8 for the conversion of L-tryptophan to indole-3-pyruvic acid, S. cerevisiae decarboxylase KDC for the decarboxylation of indole3-pyruvic acid to indole-3-acetaldehyde, and E. coli AldH for the oxidation of indole-3-acetaldehyde to the corresponding IAA. The resulting strain DG121 was grown in modified M 9 medium with 0.5 g/L of tryptophan. IAA was extracted from recombinant E. coli and control strains and analyzed by GCMS. No IAA was detected in the negative control E. coli strain with empty plasmid. The recombinant strains DG121 C

DOI: 10.1021/acs.jafc.9b02048 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

hyde dehydrogenase dhaS in Bacillus amyloliquefaciens SQR9 and Bacillus subtilis 168 produced up to 39 and 22 mg/L IAA from 3 mM L-tryptophan, respectively.27 However, free Ltryptophan is very rare in nature, so it is necessary to develop a microorganism that synthesizes IAA from a simple carbon source which is widely distributed in nature. In this study, we showed that E. coli AldH can catalyze the oxidation of indole-3-acetylaldehyde to the IAA. Then a de novo biosynthetic pathway for the production of IAA from glucose was constructed in E. coli through strengthening the shikimate pathway. The overall pathway includes the upstream pathway from glucose to L-tryptophan and the downstream pathway from L-tryptophan to IAA. The biosynthesis of IAA is hindered by the formation of byproduct indole-3-ethanol due to quick and endogenous reduction of indole-3-acetylaldehyde to indole-3-ethanol by aldehyde reductase in E. coli. Kunjapur et al. reported that an E. coli strain RARE with seven aldehyde reductase genes knocked out can accumulate aromatic aldehydes as end products.28 In this study, E. coli strain RARE was used as the host for biosynthesis of IAA. In summary, we report the discovery that E. coli AldH can catalyze conversion of indole-3-acetylaldehyde to the corresponding IAA. We successfully generated engineered E. coli strains capable of producing IAA from glucose. The next step is to develop a beneficial microbe for biosynthesis of IAA and promoting plant growth by targeted integration of the constitutive expression of IAA biosynthetic pathway into E. coli chromosome.

■

AUTHOR INFORMATION

Corresponding Authors

*Tel: +86-797-8393536; E-mail: [email protected]. *Tel: +86-797-8393536; E-mail: [email protected]. ORCID

Daoyi Guo: 0000-0001-5488-2377

Figure 3. GC/MS analyses of IAA in engineered E. coli strains. Identified substances: (1) benzoic acid (internal standard); (2) phenylacetic acid; (3) 4-hydroxyphenylacetic acid; (4) IAA.

Funding

This work was supported by National Natural Science Foundation of China (81460312) and National Science Foundation of Jiangxi Province (2018ACB21045, GJJ170840).

recombinant E. coli, as revealed by GC/MS analysis (Figure 3). We hypothesize that the precursor substrate for phenylacetic acid is from L-phenylalanine pathway intermediate phenylpyruvic acid. Phenylpyruvic acid can be converted to phenylacetaldehyde by 2-keto acid decarboxylase KDC. Then phenylacetaldehyde was converted to phenylacetic acid by aldehyde dehydrogenases AldH. Similarly, the precursor substrate for 4-hydroxyphenylacetic acid is from L-tyrosine pathway intermediate 4-hydroxyphenylpyruvic acid.

Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Bartel, B. AUXIN BIOSYNTHESIS. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1997, 48, 51−66. (2) Fu, S. F.; Wei, J. Y.; Chen, H. W.; Liu, Y. Y.; Lu, H. Y.; Chou, J. Y. Indole-3-acetic acid: A widespread physiological code in interactions of fungi with other organisms. Plant Signal Behav. 2015, 10, e1048052. (3) Di, D. W.; Zhang, C.; Luo, P.; An, C. W.; Guo, G. Q. The biosynthesis of auxin: how many paths truly lead to IAA? Plant Growth Regul. 2016, 78, 275−285. (4) Mano, Y.; Nemoto, K. The pathway of auxin biosynthesis in plants. J Exp Bot. J. Exp. Bot. 2012, 63, 2853−2872. (5) Spaepen, S.; Vanderleyden, J.; Remans, R. Indole-3-acetic acid in microbial and microorganism-plant signaling. Fems Microbiology Reviews 2007, 31, 425−448. (6) Li, M.; Guo, R.; Yu, F.; Chen, X.; Zhao, H.; Li, H.; Wu, J. Indole3-Acetic Acid Biosynthesis Pathways in the Plant-Beneficial Bacterium Arthrobacter pascens ZZ21. Int. J. Mol. Sci. 2018, 19, 443. (7) Patten, C. L.; Glick, B. R. Bacterial biosynthesis of indole-3acetic acid. Can. J. Microbiol. 1996, 42, 207−20. (8) Mashiguchi, K.; Tanaka, K.; Sakai, T.; Sugawara, S.; Kawaide, H.; Natsume, M.; Hanada, A.; Yaeno, T.; Shirasu, K.; Yao, H. The main

■

DISCUSSION The large-scale and long-term use of chemical fertilizers and traditional pesticides has caused serious environmental pollution. Thus, it is of great significance to develop beneficial microbes instead of chemical fertilizers and pesticides to support plant growth. Among these beneficial microbes, the auxin-producing strain has played an important role in promoting plant growth. IAA is considered the most important naturally occurring auxin in plants and a major regulator of plant development.26 By improving the ability of microorganisms to produce IAA through synthetic biology technology, it is possible to develop a beneficial microbe to promote plant growth. Shao et al. reported coexpression of the aminotransferase patB, decarboxylase yclC, indole-3-acetaldeD

DOI: 10.1021/acs.jafc.9b02048 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry auxin biosynthesis pathway in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 2011, 108, 18512−7. (9) Mano, Y.; Nemoto, K. The pathway of auxin biosynthesis in plants. J. Exp. Bot. 2012, 63, 2853−2872. (10) Duca, D.; Lorv, J.; Patten, C. L.; Rose, D.; Glick, B. R. Indole-3acetic acid in plant-microbe interactions. Antonie van Leeuwenhoek 2014, 106, 85−125. (11) Zhao, Y. Essential Roles of Local Auxin Biosynthesis in Plant Development and in Adaptation to Environmental Changes. Annual Review of Plant Biology 2018, 69, 417. (12) Kasahara, H. Current aspects of auxin biosynthesis in plants. Biosci., Biotechnol., Biochem. 2016, 80, 34−42. (13) Brumos, J.; Alonso, J. M.; Stepanova, A. N. Genetic aspects of auxin biosynthesis and its regulation. Physiol. Plant. 2014, 151, 3−12. (14) Tullio, L. D.; Nakatani, A. S.; Gomes, D. F.; Ollero, F. J.; Megías, M.; Hungria, M. Revealing the roles of y4wF and tidC genes in Rhizobium tropici CIAT 899: biosynthesis of indolic compounds and impact on symbiotic properties. Arch. Microbiol. 2019, 201, 171− 183. (15) Imada, E. L.; Rolla dos Santos, A. A. d. P.; Oliveira, A. L. M. d.; Hungria, M.; Rodrigues, E. P. Indole-3-acetic acid production via the indole-3-pyruvate pathway by plant growth promoter Rhizobium tropici CIAT 899 is strongly inhibited by ammonium. Research in Microbiology 2017, 168, 283. (16) Mcclerklin, S. A.; Lee, S. G.; Harper, C. P.; Nwumeh, R.; Jez, J. M.; Kunkel, B. N. Indole-3-acetaldehyde dehydrogenase-dependent auxin synthesis contributes to virulence of Pseudomonas syringae strain DC3000. PLoS Pathog. 2018, 14, e1006811. (17) Tsavkelova, E. A.; Cherdyntseva, T. A.; Botina, S. G.; Netrusov, A. I. Bacteria associated with orchid roots and microbial production of auxin. Microbiol. Res. 2007, 162, 69−76. (18) Bower, P. J.; Brown, H. M.; Purves, W. K. Cucumber seedling indoleacetaldehyde oxidase. Plant Physiol. 1978, 61, 107−110. (19) Datsenko, K. A.; Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 2000, 97, 6640−6645. (20) Jo, J.-E.; Mohan Raj, S.; Rathnasingh, C.; Selvakumar, E.; Jung, W.-C.; Park, S. Cloning, expression, and characterization of an aldehyde dehydrogenase from Escherichia coli K-12 that utilizes 3Hydroxypropionaldehyde as a substrate. Applied Microbiology & Biotechnology 2008, 81, 51−60. (21) Zhang, L.; Liu, Q.; Pan, H.; Li, X.; Guo, D. Metabolic engineering of Escherichia coli to high efficient synthesis phenylacetic acid from phenylalanine. Amb Express 2017, 7, 105. (22) Guo, D.; Zhang, L.; Kong, S.; Liu, Z.; Li, X.; Pan, H. Metabolic Engineering of Escherichia coli for Production of 2-Phenylethanol and 2-Phenylethyl Acetate from Glucose. J. Agric. Food Chem. 2018, 66, 5886. (23) Guo, D.; Pan, H.; Li, X. Metabolic engineering of Escherichia coli for production of biodiesel from fatty alcohols and acetyl-CoA. Appl. Microbiol. Biotechnol. 2015, 99, 7805−7812. (24) Chen, L.; Zeng, A. P. Rational design and metabolic analysis of Escherichia coli for effective production of L-tryptophan at high concentration. Appl. Microbiol. Biotechnol. 2017, 101, 559−568. (25) Gu, P.; Yang, F.; Li, F.; Liang, Q.; Qi, Q. Knocking out analysis of tryptophan permeases in Escherichia coli for improving Ltryptophan production. Appl. Microbiol. Biotechnol. 2013, 97, 6677− 6683. (26) Gamalero, E.; Glick, B. Plant Growth-Promoting Bacteria and Metals Phytoremediation. Phytotechnologies; CRC Press; CRC Press, 2012; p 361. (27) Shao, J.; Li, S.; Zhang, N.; Cui, X.; Zhou, X.; Zhang, G.; Shen, Q.; Zhang, R. Analysis and cloning of the synthetic pathway of the phytohormone indole-3-acetic acid in the plant-beneficial Bacillus amyloliquefaciens SQR9. Microb. Cell. Fact. 2015, 14, 130. (28) Kunjapur, A. M.; Tarasova, Y.; Prather, K. L. Synthesis and accumulation of aromatic aldehydes in an engineered strain of Escherichia coli. J. Am. Chem. Soc. 2014, 136, 11644−54.

E

DOI: 10.1021/acs.jafc.9b02048 J. Agric. Food Chem. XXXX, XXX, XXX−XXX