Deciphering the Mechanical Properties of Type III Secretion System

Subscriber access provided by Kaohsiung Medical University

Biological and Environmental Phenomena at the Interface

Deciphering the Mechanical Properties of Type III Secretion System EspA Protein by Single Molecule Force Spectroscopy Hila Nadler, Lihi Shaulov, Yossi Blitsman, Moran Mordechai, Jurgen Jopp, Neta Sal-Man, and Ronen Berkovich Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b01198 • Publication Date (Web): 04 May 2018 Downloaded from http://pubs.acs.org on May 5, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

TITLE. Deciphering the Mechanical Properties of Type III Secretion System EspA Protein by Single Molecule Force Spectroscopy AUTHORS. Hila Nadlera‡, Lihi Shaulovb‡, Yossi Blitsmana, Moran Mordechaia, Jürgen Joppc, Neta SalManb,* and Ronen Berkovicha, c, *.

AFFILIATIONS. a

Department of Chemical Engineering, Ben-Gurion University of the Negev, Beer Sheva

8410501, Israel. b

Department of Microbiology, Immunology and Genetics, Ben-Gurion University of the Negev,

Beer Sheva 8410501, Israel. c

The Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the

Negev, Beer Sheva 8410501, Israel.

KEYWORDS. EspA, AFM, single molecule, force spectroscopy, I91, T3SS, proteins.

ACS Paragon Plus Environment

1

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 36

ABSTRACT. Bacterial type III secretion systems inject virulence factors by bacterial pathogens into host-cells during bacterial infection. In enteropathogenic Escherichia coli, this system contains an external filament, formed by a self-oligomerizing protein called E. coli secreted protein A (EspA). The EspA filament penetrates the thick viscous mucus layer to facilitate the attachment of the bacteria to the gut-epithelium. To do that, the EspA filament requires noteworthy mechanical endurance considering the mechanical shear stresses found within the intestinal tract. To date, the mechanical properties of the EspA filament and the structural and biophysical knowledge of monomeric EspA are very limited, mostly due to the strong tendency of the protein to self-oligomerize. . To overcome this limitation, we employed a Single Molecule Force Spectroscopy (SMFS) technique and studied the mechanical properties of EspA. Force extension dynamic of (I91)4-EspA-(I91)4 chimera revealed two structural unfolding events occurring at low forces during EspA unfolding, thus indicating no unique mechanical stability of the monomeric protein. SMFS examination of purified monomeric EspA protein, treated by a gradually re-folded protocol, exhibited similar mechanical properties as the EspA protein within the (I91)4-EspA-(I91)4 chimera. Overall, our results suggest that the mechanical integrity of the EspA filament likely originates from the interactions between EspA monomers and not from the strength of an individual monomer.


2

Page 3 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

INTRODUCTION. Gram-negative bacterial pathogens, such as Salmonella, Shigella, Yersinia, Pseudomonas, and species of Escherichia coli are causative agents of serious human diseases, ranging from pneumonia to lethal diarrhea and the plague, that annually account for millions of deaths worldwide. Those pathogens all utilize a common, syringe-like protein complex, termed the type III secretion system (T3SS), which injects the bacterial effectors from the bacterial cytoplasm directly into the host cell. This process is essential for the virulence of these bacterial pathogens, since the injected effectors manipulate key intracellular pathways (e.g. cell cycle, immune response, cytoskeletal organization, metabolic processes, and trafficking within the host cell) that ultimately promote bacterial replication and transmission1-4. The T3SS apparatus are well conserved among T3SSs of different pathogens and share significant similarities with components of the flagellar system5-6. Yet, the T3SS of enteropathogenic E. coli (EPEC) and enterohemorrhagic E. coli (EHEC), two important human enteric pathogens7, contain an extended filament connected to the needle complex8-10. This filament forms a continuous physical bridge between the bacteria and the host cell surface that can extend to lengths of more than 600 nm and it is composed entirely of a single oligomerizing protein, termed E. coli secreted protein A (EspA)10-11. EPEC EspA protein consists of 192 residues and forms a helical tube with outer diameter of 120 Å and a hollow central channel of 25 Å8. Due to the inherent property of the protein to oligomerize when overexpressed, a high-resolution structure of the monomeric protein was never obtained. However, its crystallographic structure in complex with its chaperone, CesA, at a resolution of 2.8 Å, revealed that EspA contains two α-helixes, which adopt a coiled coil structure, separated by a flexible central region of 89 residues12. The arrangement of the coiled


3

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 36

coil motifs of EspA resembles the structural organization of the flagellin protein (FliC), the flagellar filament, which was shown to contain two long coiled coils motifs in its D0 domain13. Moreover, mutations in the coiled coil motifs of EspA drastically impaired EspA filament biogenesis, therefore suggesting that these structures are likely present in the mature protein14-15. The EspA filament is important during early stages of infection and is responsible for the initial attachment of the bacterium to its host cell9, 16. The assembling EspA filament is required to penetrate the thick mucus layer found on the surface of the epithelial cells of the intestinal tract, before it attaches to the host cell and facilitates effectors translocation into it. Intimate association between the pathogen and its host cell is later established by cellular cytoskeleton rearrangement and pedestal formation, induced by bacterial effectors17-19. To form this intimate association, the EspA filament has to resist the shear forces induced by the mucus flow, the intestinal peristalsis and the pulling force inflicted by the attached bacteria. Gastrointestinal mucosal flow is described as a creeping flow20, under which viscous drag effects predominate and extend throughout the flow field. Under such stresses, the forces acting on the filament (assuming a simple cylindrical geometry for it) can be roughly estimated as F ~ 1,500 pN (see Supplementary for details). To put these force values into perspective, stable protein unfolding requires ~10 – ~500 pN21-31, while ~2000 pN is required for breaking a covalent bond32. This suggests that the EspA filament can withstand significant mechanical stress (illustrated in Fig 1).


4

Page 5 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 1. Schematic representation of the T3SS including the EspA filament that bridges between the bacterium and the host cell membrane. Virulence factors pass through the EspA filament and are injected into host cells cytoplasm. The filament is subjected to external forces imposed by the bacterium above it and shear stresses induced by the viscous mucosal flow.

In this study, we apply Single-Molecule Force Spectroscopy (SMFS) to characterize the mechanical properties of EspA and its unfolding events as an indication for its structure. For this purpose, we use an established approach that clone the protein of interest between modules of I91 (formerly I27) protein27-28,

30, 33-37

. The I91 domain has been extensively studied using

SMFS21-23, 25, 38-41. Since it displays a well-defined unfolding fingerprint, it serves as precursor that can be easily distinguished from the uncharacterized protein of interest, thus enabling the


5

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 36

identification of the studied protein unfolding events. In this study, we cloned the EspA protein between four flanking I91 domains at each terminus, (I91)4-EspA-(I91)4, and found that the EspA protein displays two low force-unfolding events. Moreover, SMFS measurements with a recombinant EspA protein that was exposed to denaturation conditions (8 M urea), to enable binding to the SMFS gold coated coverslip as monomeric EspA, followed by a gradual refolding procedure, obtained similar two low-force-unfolding events. These results supported our findings using the (I91)4-EspA-(I91)4 chimera and validated our unfolding-refolding method. Our findings indicate that the mechanical stability of the EspA filament does not originates from the stability of the individual monomers but probably from the interactions between the EspA monomers.

EXPERIMENTAL SECTION. Construction of EspA-His plasmid. The espA gene was amplified from EPEC genomic DNA by

using

the

primer

pairs

EspA-His-F/EspA-His-R

(GGCATATGTGCGATACATCAACTACAGCATC/GGCTCGAGTTTACCAAGGGATATTC CTGA), digested with XhoI/NdeI and ligated into an XhoI/NdeI-digested pET21a(+) plasmid. The resulting plasmid encoded a cysteine residue at position 2 and a hexa-His tag at the Cterminus of the EspA sequence. Construction of His-(I91)4-EspA-(I91)4 plasmid – a sequence of four I91 subunits flanking the espA gene from each side was chemically synthesized in order to reduce the risk of duplication or reduction of I91 subunits during the PCR amplification process. The design of the sequence also included two unique sequences between the second and the third I91 sequence and between the sixth and the seventh I91 subunit, to allow confident sequencing of the final construct. The


6

Page 7 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

hexa-His tag was labeled on the N-terminus of the fused protein (I91)4-EspA-(I91)4 and two additional cysteine were added at its C-terminus. We included a NotI and a HindIII restriction sites at the 5’ and 3’ of the EspA gene to allow an easy replacement of the encoded protein embedded between the (I91)8 subunits. To insert the (I91)4-EspA-(I91)4 into pET28a(+) plasmid we used Gibson assembly42, where the (I91)4-EspA-(I91)4 sequence was amplified using the primer

pairs

I27_EspA_F/I27_EspA_R

(AAGAAGGAGATATACCATGGGC/TTGTTAGCAGCCGGATCTCA), and the pET28a(+) vector

was

amplified

by

the

primer

pairs

pET28_I27

_F/pET28_I27

_R

(TGAGATCCGGCTGCTAACAA/GCCCATGGTATATCTCCTTCTT). The (I91)8-His was expressed from the pQE-80L (I91)8 vector (a generous gift from the Allegre-Cebollada laboratory). Protein purification. E. coli strain BL21 transformed with pEspA-His, p(I91)4-EspA-(I91)4His or pQE-80L were grown to mid exponential phase in LB broth and induced with 0.1 mM IPTG for 16 h at 16 °C. The bacteria were harvested and resuspended in lysis buffer (30 mM NaH2PO4 buffer, 400 mM NaCl, 10 mM imidazole with a protease inhibitor cocktail (Roche)) supplemented with 10 µg/mL of lysozyme, and it was incubated on ice for 30 min. The Histagged proteins were purified using Ni-NTA resin (Thermo-Scientific) according to the manufacturer’s protocol. For further purification, the proteins were loaded on a Superdex 200 HR 10/300 column, calibrated with PBS with 10% glycerol. Protein concentration was determined by the Bradford assay (BioRad). Single Molecule Force Spectroscopy of (I91)4-EspA-(I91)4 construct. Single-molecule force spectroscopy experiments were carried out on a commercial Luigs & Neumann atomic force microscope (AFM) in a set of force extension (FX)

21

experiments on the chimera polyprotein


7

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 36

(I91)4-EspA-(I91)4. FX experiments were performed with a 400 nm/s piezo movement velocity. Individual cantilevers (gold coated Si-Ni Biolevers, BL-TR400PB Asylum Research, Oxford Instruments) were calibrated prior to collection of traces using the equipartition theorem43, measuring spring constants, KS, ranging between 22 – 26 pN/nm. Glass coverslides were cleaned by rinsing with 99.9 % ethanol (Romical), and then with deionized water (Ultra 370 series, Aqua Max, 18.2 MΩ.cm). After drying, the coverslides were coated with a layer of Ni followed by a layer of Au using a thermal evaporator (Quorum K975X). The samples were prepared by depositing ~18 µL of the polyprotein onto the freshly evaporated gold coverslide for 10 – 20 minutes. Measurements were carried out in HEPES buffer (0.5 EDTA, 150 mM NaCl, 20 mM hepes, pH 7.5). Urea unfolding and gradual refolding treatment on the AFM coverslip. Samples of purified EspA-His, (I91)4-EspA-(I91)4-His or (I91)8-His proteins were transferred into Mini GeBAFlex tube and solvent substitution was performed by an overnight dialysis in 8 M urea (Sigma), followed by another 2 h dialysis in fresh 8 M urea. As routinely done after dialysis, we transferred the protein samples into clean tubes and centrifuged them at 18,500 x g for 20 min at 4 °C to remove large protein aggregates. The supernatants that due to the unfolding conditions are enriched with the monomeric fraction of the proteins were collected and 20 µL samples were transferred onto a gold-coated coverslip to allow their binding to the gold particles through the cysteine residue located at the N-terminus of the proteins. After 40 min incubation at RT the coverslide was transferred into a 12 wells plate and was socked for 20 min intervals at decreasing urea concentration solutions (6, 4, 3, 2, 1, 0.75, 0.5, and 0.2 M) followed by three washes with PBS (Biological Industries) to allow gradual refolding of the proteins adsorbed on the gold coated coverslide.


8

Page 9 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Single molecule Force Spectroscopy of Individual EspA molecules. Measurements of EspA monomers proteins were performed on a commercial AFM (Asylum Research Cypher-ES, Oxford Instruments) in the FX mode using Asylum TR400PSA Si-Ni gold coated cantilever with measured spring constant of KS = 27.9 pN/nm as described above. The samples were prepared according to the urea treatment procedure described above. The FX experiments were performed at a pulling velocity of 400 nm/s. Single Molecule Force Spectroscopy Analysis. Data analysis was carried out using IGOR Pro 6.3.7.2 software (WaveMetrics). The extended proteins were analyzed using the worm-like chain (WLC) model of polymer elasticity44-45:

(1)

−2 kBT  1  x 1 x F (x ) =  1 −  − +  lP  4  LC  4 LC   

where F is the elastic force, x is the end-to-end length reaction coordinate, kB is Boltzmann's constant, T is the absolute temperature, lP is the persistence length (a quantity that is related to the intrinsic stiffness of the chain) and LC is the contour length (the nominal end-to-end length of the unfolded protein chain). Force probability density functions (pdfs) of the unfolding and various rupture events were calculated from the collected data. These provide the probability of mechanical structural breaking event at a given force under a specific loading rate. For a given pulling velocity, the cumulative distribution function (cdfs), of the unfolding forces were calculated and fitted with the following expression26 (2)

 k k T   F∆x     − 1  S (F | r ) = 1 − exp− 0 B exp  r∆x   k B T   


9

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 36

where k0 is the unperturbed extrapolated unfolding rate of the protein (at zero force), and ∆x is the distance to transition between the structured and unstructured conformational states of the protein, which are separated by an activation barrier, ∆G0 in the free energy landscape. The loading rate, r, can be estimated by multiplying the pulling velocity, V, with the effective spring constant that represents the stiffness contributions of the cantilever and of the molecule attached to it, Keff = (KS-1 + KM-1)-1, i.e. r = Keff*V

41, 46

. It should be noted that unlike force-ramp

experiments, in the force-clamp mode, where an controlled linear-in-time loading rate is applied, the proteins are being pulled at constant velocity, where the stiffness, KM, varies nonlinearly with the time dependent end-to-end length, x(t). This inconsistency can be bridged under the assumption of high force approximation, while relating to the high stretch regime of the unfolded molecule, to which the WLC model is typically fitted. Thus, the stiffness of the unfolded stretched molecule were directly measured by taking the slope of the linear regime of the stretched molecule prior to an unfolding event as proposed in reference

41

. The slopes of

unfolding events in the EspA and I91 domains taken in the high stretch regime, resulted with spring constant of similar magnitude, KM = dF/dx = 10.4 ± 2.3 pN/nm. For the (I91)4-EspA(I91)4 construct, the loading rate is therefore calculated to be rEspA-I91 = 2,900 pN/s, and for the EspA monomer experiments, rEspA monomer = 3,000 pN/s. In protein unfolding, k0 denoted the average time it takes for a folded protein to unfold for the first time, starting from the native state. As described by the Kramers-Arrhenius theory, the rate associated with this time scale increases exponentially with the height of the activation barrier separating the folded and unfolded states, k0 = Aexp(–∆G0/kBT), with A being the Arrhenius prefactor, representing the natural attempt frequency. Based on this expression, under the


10

Page 11 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

assumption that every transition occurring in the EspA is of two-state nature, the activation energy for this transition can be accessed via27, 47 (3)

k  ∆G0 = −k BT ln 0   A

A is taken as ~107 1/s, as a practical value that was generally estimated for proteins 48-50. Blue-Native (BN)-Polyacrylamide Gel Electrophoresis (PAGE). Purified protein samples (10 µg) were incubated for 5 min in a BN sample buffer (30% glycerol with 0.05% Coomassie Brilliant Blue G250) and loaded onto a 10% native gel. For electrophoresis, the cathode buffer was 15 mM Bis-Tris and 50 mM Bicine (adjusted to pH 7) and the anode buffer comprised 50 mM Bis-Tris (adjusted to pH 7). The electrophoresis was carried out over 5 – 6 h, in an electroporation cell that was immersed in ice until full separation. The gel was then subjected to Coomassie staining or western immunoblotting with an anti-His antibody. AFM imaging. Topography AFM images were collected on a commercial AFM (Asylum Research Cypher-ES, Oxford Instruments), which was operated in tapping mode. Rectangular silicon nitrate probes were used with nominal spring constant around 0.25 N/m (BL-AC40TS, Olympus) and cantilever length of 38 µm. The cantilever resonance frequency was about 26 kHz. Images were recorded with a scan rate (1 Hz) and a resolution of 512 × 512 pixel per image was chosen. For AFM imaging 10 µL of purified EspA-His were floated on a freshly cleaved mica leaf. After 10 min, the sample was gently rinsed and visualized in tapping mode in PBS buffer.

RESULTS AND DISCUSSION. Single Molecule Force Spectroscopy detection of the EspA protein in a chimeric construct. We investigated the mechanical stability of EspA protein using AFM in force-


11

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 36

extension (FX) mode. In order to identify EspA unambiguously, we used a chimera protein, (I91)4-EspA-(I91)4, composed of EspA flanked by four I91 domains, of the human cardiac Titin proteins, from both termini. To detect the EspA fingerprint within the (I91)4-EspA-(I91)4, we purify a single (I91)8 polyprotein (Figure 2a) and recorded FX traces of a single (I91)8 polyprotein measured at a pulling velocity, V = 400 nm/s, and fitted with the WLC model of polymer elasticity. The (I91)8 traces displayed the characteristic unfolding events of I91 subunits (Fig. 2b). The (I91)8-His recordings resulted in a characteristic mechanical stability of F = 215.8 ± 34 pN, ∆LC = 27.2 ± 0.42 nm and lP = 0.39 ± 0.06 nm (averaged from 94 FX unfolding traces of (I91)8 with n = 676 unfolding force events), that are in good agreement with previous studies of I9122, 25, 27, 51. The size-exclusion chromatography (SEC) analysis of purified (I91)4-EspA-(I91)4 chimera displayed a large protein peak eluted early in the size-exclusion chromatography, indicating formation of (I91)4-EspA-(I91)4 complexes that were much larger than the expected size (~100 kDa) of the monomeric (I91)4-EspA-(I91)4 protein (Figure 2c). A similar peak was not detected in the elution profile of the (I91)8 protein (Figure 2a), thus suggesting that a single EspA sequence inserted between the I91 subunits retains its ability to oligomerize. This supports our assumption that EspA is folded properly when expressed between the I91 domains. Western blot analysis of the SEC elution fractions with an antibody against the His tag of our proteins confirmed that our desired proteins are in the collected fractions (Figure 2a and 2c- marked in gray). Unfolding events of EspA from (I91)4-EspA-(I91)4 construct were identified by eight (n = 71), and then seven (n = 18) I91 unfolding events, that displayed similar pattern as presented in Figures 2 and 3 and discussed below.. Figure 2d shows a representative FX trace with eight saw-


12

Page 13 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

tooth-like unfolding peaks of I91 domains and additional two consecutive low force rupture events preceding it, occurring along the EspA protein (marked in red and blue and labeled as 1st and 2nd events). These events correspond to unfolding events within the EspA structure that are triggered at relatively low forces. Such patterns in the force trace are expected when the uncharacterized protein of interests (EspA in our case) is mechanically less stable than the welldefined unfolding fingerprint protein (I91) attached to it in tandem24, 30-31, 33, 35, 37, 52-53, 54 , 55. The full unfolding of the EspA protein was marked by the first unfolding event of the I91 subunit within the (I91)4-EspA-(I91)4 chimera. Fitting these events with the WLC model, the initial unfolding of the EspA protein resulted with a total contour length of = 100 ± 4.54 nm (see Supplementary Fig. S1). This value corresponds to the contour length of an individual EspA, (LC(EspA) = 192 a.a. × 0.38 nm/a.a.= 72.96 nm) together with the initial extension of the eight unfolded I91 domains (4.4 nm/I91 domain × 8 domains = 35.2 nm)56 and linkers between the domains and handles (23 a.a. × 0.38 nm/a.a.= 8.74 nm)23,

36

, resulting with 116.9 nm at full

stretch. At 217 pN, which is the averaged value of the force at which the first I91 domain unfolds, the WLC model estimates an extension of ~105 nm.


13

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 36

Figure 2. Mechanical signature of (I91)4-EspA-(I91)4 chimera protein in force-extension (FX) mode. (a) SEC analysis of purified (I91)8-His. The protein is eluted according to its expected size (~82 kDa). (b) Characteristic FX unfolding trace of (I91)8, showing WLC fit for eight unfolding peaks (orange lines) followed by the detachment of the chain. Illustration of the measurement (not to scale) is shown left of the trace, where (I91)8 polyprotein (purple) is tethered between the cantilever tip and a cold-coated coverslip. (c) SEC analysis of purified (I91)4-EspA-(I91)4. The protein elutes at a volume that indicates formation of large protein complexes. (d) Schematic cartoon of the (I91)4-EspA-(I91)4 construct used to identify the mechanical properties of EspA in the AFM experimental setup, where the (turquoise) EspA domain with unknown structure is flanked between four (purple) I91 domains. FX curve of the (I91)4-EspA-(I91)4 construct. Two peaks at low pulling force corresponding to EspA protein precede the unfolding events of the


14

Page 15 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

eight I91 domains. The continuous curves are fitting to the WLC model from where we measure ∆LC and lP of the first and second EspA and I91 unfolding events (red, blue and orange lines, respectively).

From 89 recorded FX traces with initial extension of ~100 nm before the first I91 unfolding events, 18 traces displayed two consecutive force events in the EspA region (Fig. 2d and Fig. 3a, upper panel), 63 traces displayed a single force event (Fig. 3a, two middle panels). The last eight traces did not possess any force event, but displayed mere elastic extension (Fig. 3a lower panel). The fitted values, obtained for the I91 domains from the (I91)4-EspA-(I91)4 chimera protein traces were consistent with the fitted values of the single (I91)8 unfolding traces, with F = 217.8 ± 41.6 pN (n = 763), ∆LC = 27.6 ± 0.86 nm and lP = 0.38 ± 0.02 nm (n = 89). The force probability density functions of the force events were analyzed to gain information on the mechanical stability of EspA. The force event traces showed a bimodal distribution, which was deconvoluted into two populations with Gaussian distribution with mean forces of with F1 = 35.9 pN and F2 = 59.4 pN (see Fig. SI1). Based on these deconvoluted distributions, the single force events and their corresponding contour length increments, ∆LC, were distributed to form two force distributions with F1 = 37.8 ± 4.35 pN (n = 49) and F2 = 65.8 ± 5.10 pN (n = 32) (Fig. 3b). Compared to forces required to unfold the I91 monomers, EspA displays a relatively low mechanical stability (at the same loading rate). These low forces imply that the applied loading rate (r ~ 2,800 pN/s) was considerably high compared to the low mechanical stability of EspA, thus resulting with traces that display two force events and less. Fitting these force events with the WLC model resulted in a characteristic persistence length of lP1,2 ~ 0.4 nm for both the I91 and EspA domains. We


15

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 36

measure a widely distributed length increments, with similar value of ∆LC1,2 ~ 19.5 nm that follows the two transitional events within the EspA (Fig. 3c). Although the wide distributions may suggest the possibility of heterogeneous unfolding pathways, the distribution of the forces collected solely from single event traces display a bimodal behavior, indicating the presence of two populations. Hence, the low forces that were measured for the unfolding events of EspA may suggest that they are related to intermediate states in the global unfolding of EspA that are proportional to the energy barrier associated with its conformational transition.

Figure 3. Mechanical stability of EspA recorded from the (I91)4-EspA-(I91)4 chimeric construct. (a) Unfolding FX traces displaying the force event populations recoded for the EspA, denoting from bottom to top no force event, 1st and 2nd force events of the EspA and the I91 (red, blue, black and orange, respectively). Probability distribution functions calculated from the FX measurements of the EspA-I91 chimera protein (V = 400 nm/s) for the force (b) and contour length increments between the events (c) The continuous lines are fitting to a normal distribution, from which the mean and standard deviation were estimated.


16

Page 17 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Gradual refolding of EspA protein after urea treatment. Due to the scattering of the ∆LC values obtained for the FX-SMFS of the (I91)4-EspA-(I91)4 chimera protein, we attempted to perform FX measurements on a native EspA protein. This posed a substantial challenge due to the high tendency of the EspA protein to oligomerize when overexpressed12, 57. AFM images of purified EspA-His protein, containing a cysteine residue at position 2 and a hexa-His tag at the C-terminus of the sequence, confirmed formation of long filamentous structures (Fig. 4a), as previously reported for the EspA protein14,

58-59

. To overcome the high tendency of the EspA

protein to oligomerize and promote dissociation of the filament into individual EspA subunits, we developed a strategy to unfold purified EspA in urea. The denatured proteins were attached to a coverslip in their enriched monomeric form and then were gradually refolded by a series of diluted urea solutions to a final buffer, which is used for the SMFS measurements. To examine the feasibility of this strategy, we first examined whether EspA-His can undergo a refolding process using 8 M urea. For this purpose, we examined the elution profile of purified EspA-His loaded on a SEC before and after the refolding process. The protein elution profile was monitored by UV detection and was recorded as function of eluted volume. The elution profile of the untreated EspA-His sample revealed one major protein peak corresponding to large protein complexes, eluting at volume 9-12 mL (Fig. 4b). Analysis of the elution fractions, by SDSPAGE and Coomassie staining, confirmed the presence of EspA-His in these fractions. Refolded EspA-His after urea treatment obtained a similar elution profile as the untreated EspA-His, with a major peak corresponding to large protein complexes (volume 9-12 mL) and an additional small peak corresponding to monomeric/dimeric EspA (17-20 mL) (Fig. 4c). The latter peak was absent from the elution profile of the untreated sample. To confirm, that the refolding process allowed most of the protein to retain its original folding, we analyzed the untreated and treated


17

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 36

EspA-His samples by Blue Native (BN)-PAGE and Coomassie staining or western immunoblotting with an anti-His antibody. The untreated EspA-His sample formed very large complexes, which migrated slowly in the BN-PAGE, while the EspA-His in 8 M urea migrated as monomeric and tetrameric complexes, as indicated by its fast run on the BN-PAGE (Fig. 4d). The refolded sample showed similar running profile as the untreated EspA-His on the BNPAGE, thus suggesting that most of the protein refolded properly to its original structure after the 8 M treatment. Refolding of (I91)8 using this procedure showed no difference in the unfolding traces of the FX experiments (see Supplementary Fig. S2).

Figure 4. EspA-His protein refolds after urea treatment. (a) AFM image of purified EspA-His on mica surface. Long filamentous structures are observed. (b) SEC analysis of purified EspA-His


18

Page 19 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

shows formation of high molecular weight complexes. The eluted fractions, collected from 8 mL and on every 0.5 mL, were analyzed by SDS-PAGE and Coomassie staining. EspA-His (21.6 kDa marked at the right of the gel) was found in fraction eluted between 9-12 mL. These fractions (marked with black arrows at the bottom of the gel) were used for SMFS analysis. (*) An un-related protein that is purified with EspA-His. SM = starting material, which applied for SEC analysis. (c) SEC analysis of purified EspA-His after treatment in 8 M urea and refolding procedure. The eluted fractions, collected from 8 mL and on every 0.5 mL, were analyzed by SDS-PAGE and Coomassie staining. (d) Purified samples of EspA-His before urea treatment, in 8 M urea, and after refolding procedure were incubated in BN sample buffer and then subjected to BN-PAGE and Coomassie Blue staining or western blot analysis using anti-His antibody. EspA-His shows formation of high molecular weight protein complexes while smaller protein complexes, including the monomeric protein, are observed in 8 M urea. The refolding procedure reconstitutes EspA-His complexes. FX measurements of single EspA monomers. To gain insight into the structurally forceinduced events shown above, we used the urea treatment protocol to bind purified EspA-His protein, in its monomeric form, to a gold-coated glass coverslip and record its dynamics in the FX mode. The recorded traces were identified as monomeric EspA protein, displaying one and two force events that were similar to these recorded with the (I91)4-EspA-(I91)4 chimera protein. Exemplary traces of monomeric EspA protein is shown in Fig. 5a.


19

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 36

Figure 5. Force spectroscopy of EspA monomer reveals its mechanical stability and kinetics. (a) FX traces of three representing population of EspA monomer displaying double force events followed by a detachment peak, fitted with the WLC model. (b) Force events distribution during the unfolding of monomeric EspA. (c) Contour lengths increments that follows force events (red and blue) and contour length distribution of the detachment peak (green). (d) Cumulative distribution functions of the first and second EspA force events in the EspA monomer (empty red circles and blue squares, respectively) and in the EspA from the (I91)4-EspA-(I91)4 construct (filled red circles and blue squares, respectively) fitted according to Eq. (2). Cdf of I91 (orange triangles), also fitted according to Eq. (2) is plotted for perspective. All the fitting parameters (Fi, ∆LCi, k0i and ∆xi) are listed in Table 1.

As with the force events collected from the (I91)4-EspA-(I91)4 chimera constructs, we calculated the pdf for all the force events recorded from the 38 monomeric EspA traces, out of which from 10 traces had two consecutive force events and 28 with a single force event. All the


20

Page 21 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

force events (n = 48) yielded a bimodal distribution (See Fig. S3), which was deconvoluted into two peaks, who set a sorting criterion similarly for the EspA within the (I91)4-EspA-(I91)4 chimera constructs, according to which the single force events were distributed among the two previously observed populations (events from traces containing two consecutive events). Force events from the single event traces of the EspA monomers were distributed with the forces from the traces with two events into two sub-populations, with n = 23 for F1 and n = 25 for F2, which were fitted with mean and standard deviation 37.8 ± 4.5 and 67.9 ± 18.4 pN respectively (Fig. 5b). The first force event recorded from the EspA monomer experiments (provided in Table 1) is consistent with the one measured for the EspA within the EspA-I91 chimera protein (1.59% difference), while the second force peak of the EspA monomer is larger by 21.6% from the second peak of EspA within the EspA-I91 chimera. Although these values are in relatively good proximity to each other, their low values show that the EspA protein does not possess any unique or outstanding mechanical stability. The corresponding length increments at each force, were also distributed accordingly. Figure 5c shows these distributions, together with the overall contour length distribution of the monomeric EspA. The EspA monomer measured LC = 71.3 ± 7.33 nm (n = 38), which is consistent with the expected contour length of an EspA protein, where segments of it may be attached to the cantilever or surface, and a persistence length, lp = 0.40 ± 0.14 nm, characteristic of unfolded proteins21-22, 60-61. The increase in ∆LC shows good agreement for the first force events for the EspA in both monomeric and chimeric forms (6.2%), whereas for the second force event, the monomeric EspA shows a decrease in size (34%). These differences are accompanied with high variance, resulting from the low stability structures,


21

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 36

which were measured under high loading rates (~3000 pN/s), combined with the limited statistics. Structural characterization of EspA in complex with its chaperone protein, CesA, revealed that in their hetero-dimeric complex, EspA contains two α-helixes between residues 31-59 and 14819012, that correspond to nominal lengths of 11 nm and 16 nm (by multiplying the number of residues with 0.38 nm/residue23). If the monomeric EspA retains the two α-helixes that it has in complex with his chaperon (although the conformation of a monomeric EspA might be different than the one obtained within the EspA-CesA complex), the F1 falls within the regime documented for the unfolding of α-helixes in previous studies, typically around 30 pN31, 62-63. Using the WLC approximation (given by equation 1), we calculate a length of 19.54 nm for the nominal length of the two α-helixes (~27 nm) with respect to the recorded value of the first event, F1 (~38 pN). This value is in good agreement with the length increment measured for the first event (∆LC,1 = 20.6 ± 5.9 nm). This can serve as a reasonable indication that the first unfolding event is related to the unfolding of the α-helixes domains within the EspA protein, and that these domains exist in the monomeric EspA conformation (i.e., without its chaperone, CesA). The second force peak is most probably related to the rupture of other structural interactions that holds the EspA protein in its native conformation.

Table 1. Mechanical and kinetic parameters of single EspA and I91 domains from FX experiments (values correspond to mean value and standard deviation). Event , i

Fi, pN

∆LC,i, nm

k0,i, 1/s

∆xi, nm

∆G0,i, kBT

EspA-I91

1

37.8 ± 4.35

19.4 ± 3.42

8.07 ± 0.01

0.32 ± 0.37

14.0 ± 0.01

chimera

2

65.8 ± 5.10

19.5 ± 3.77

2.26 ± 0.22

0.26 ± 0.01

15.3 ± 0.40


22

Page 23 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

EspA monomer

1

38.4 ± 7.63

20.6 ± 5.9

10.7 ± 1.05

0.31 ± 0.01

13.7 ± 0.40

2

80.0 ± 24.3

12.8 ± 5.95

3.34 ± 0.71

0.17 ± 0.01

14.9 ± 0.87

The length release of ∆LC after every force event designates the presence of a mechanical barrier. With the intention of quantifying the mechanical and kinetic properties of the EspA protein, we calculated the cumulative distribution functions of the first and second force events of EspA from its monomeric form and within the (I91)4-EspA-(I91)4 chimera, and fitted them with Eq. (2) (Fig. 5d). The fitted parameters are given in Table 1. From the fitted off rates we estimated the activation energy barrier for each of the force events (Table 1). The same procedure was performed for the I91 unfolding events, resulting with k0 = 2.56.10-4 ± 8.57.10-5 1/s, ∆x = 0.26 ± 0.01 nm and ∆G0 = 24.4 ± 1.37 kBT in high propinquity with the measurements of I91 under force ramp27. While there is a difference in the distances to transition between the first and second EspA events in the single EspA and within the I91 construct, the calculated freeenergy barriers of these two events agree with each other with ~14 kBT for the first event and ~15 kBT for the second event. These values scale with the forces at each event, and reflect the low mechanical stability of the individual EspA protein. On the other hand, the forces measured within the EspA complexes were considerably higher. These results suggest that the mechanical durability of the T3SS filament arises not from the strength of the individual EspA monomer, which shows low mechanical stability, but most probably from the interactions between the EspA monomers. This sets a reasonable scenario, according to which, the filament is able to endure physical stress, by local structural flexibility of its building blocks, otherwise its integrity would have been impaired.


23

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 36

SUMMARY AND CONCLUSIONS. Recent studies characterized the EspA structure when found in complex with the CesA chaperone or in its filamentous organization12, 57. In this study, we report for the first time single molecule measurements of monomeric EspA, which is involved in the formation of bacterial T3SS filament, but so far has unresolved structure. We identified EspA unfolding signature by constructing a chimera protein with (I91)4 flanking the EspA protein from both termini. The force extension traces obtained for EspA within this chimera protein showed two unfolding events occurring at low forces, thus suggesting low mechanical stability of monomeric EspA. Using a novel protocol for binding individual EspA unfolded monomers to the coverslips and refolding them by series of diluted solutions, we were able to follow the unfolding of an individual EspA protein using SMFS. The EspA monomer traces displayed similar features (length and force events) as the EspA within the EspA-I91 chimera. The first force event was in accord with the two α-helixes that were identified for the EspA when in complex with its chaperone, and the second force event is assumed to be involved in internal interactions that structurally stabilize the EspA protein in its folded conformation. The EspA monomers constructing the T3SS filament could be constrained from unfolding by interactions with other EspA monomers, giving the filament elastic properties that enable it to maintain mechanical durability of the T3SS filament. In the future, we plan to provide further mechanical and kinetic information by using constant force experiments in the force-ramp mode. With calibrated and controlled applied force load, considerably lower loading rates can be achieved, that can disclose more subtle details with higher precision. Additionally, based on our interpretation that the strength of the filament is coming from the inter-EspA interactions, we intend to further characterize EspA-EspA


24

Page 25 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

interactions by adhesion measurements in a dynamic force spectroscopy mode. Better understanding of structural organization of the EspA filament and the forces involved in its stability might allow the development of inhibitors of EspA oligomerization that can be used as potent anti-microbial drugs64-66.

ASSOCIATED CONTENT Supporting Information. Additional information concerning estimation of the force acting on the T3SS filament and other related data analysis (PDF).

AUTHOR INFORMATION Corresponding Authors * E-mail: [email protected] (N.S.). * E-mail: [email protected] (R.B.). Author Contributions N.S. and R.B. designed the study and wrote the manuscript. L.S. and N.S. cloned, purified and biochemically characterized the proteins discussed in the manuscript. H.N., Y.B., M.M., J.J. and R.B. performed the SMFS measurements and analysis. L.S., J.J. and N.S. performed the AFM imaging of the EspA protein. ‡ These authors contributed equally (H.N. and L.S.).


25

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 36

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT. This research was supported by the I-CORE Program of the Planning and Budgeting Committee and The Israel Science Foundation Grant No. 152/11 (R.B.), the Israel Science Foundation grant number 559/15 (N.S), and by a grant from the FOHS-FOE, Ben-Gurion University of the Negev (R.B. and N.S.). We thank J. Allegre-Cebollada for valuable discussion as well as for the I91 plasmid and for the discussion on cloning the EspA between the I91 domains.

REFERENCES. 1.

Kubori, T.; Matsushima, Y.; Nakamura, D.; Uralil, J.; Lara-Tejero, M.; Sukhan, A.;

Galán, J. E.; Aizawa, S. I., Supramolecular structure of the Salmonella typhimurium type III protein secretion system. Science 1998, 280 (5363), 602-5. 2.

Cornelis, G. R., The type III secretion injectisome. Nat. Rev. Microbiol. 2006, 4 (11),

811-825. 3.

Bhavsar, A. P.; Guttman, J. A.; Finlay, B. B., Manipulation of host-cell pathways by

bacterial pathogens. Nature 2007, 449 (7164), 827-834. 4.

Croxen, M. A.; Finlay, B. B., Molecular mechanisms of Escherichia coli pathogenicity.

Nat. Rev. Microbiol. 2009, 8 (1), 26-26.


26

Page 27 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

5.

Cornelis, G. R.; Van Gijsegem, F., Assembly and Function of Type III Secretory

Systems. Annu. Rev. Microbiol. 2000, 54 (1), 735-774. 6.

Aizawa, S. I., Bacterial flagella and type III secretion systems. FEMS Microbiol. Lett.

2001, 202 (2), 157-164. 7.

Nataro, J. P.; Kaper, J. B., Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11

(1), 142-201. 8.

Daniell, S. J.; Takahashi, N.; Wilson, R.; Friedberg, D.; Rosenshine, I.; Booy, F. P.;

Shaw, R. K.; Knutton, S.; Frankel, G.; Aizawa, S.-I., The filamentous type III secretion translocon of enteropathogenic Escherichia coli. Cell. Microbiol. 2001, 3 (12), 865-871. 9.

Knutton, S.; Rosenshine, I.; Pallen, M. J.; Nisan, I.; Neves, B. C.; Bain, C.; Wolff, C.;

Dougan, G.; Frankel, G., A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. The EMBO journal 1998, 17 (8), 2166-76. 10. Sekiya, K.; Ohishi, M.; Ogino, T.; Tamano, K.; Sasakawa, C.; Abe, A., Supermolecular structure of the enteropathogenic Escherichia coli type III secretion system and its direct interaction with the EspA-sheath-like structure. Proc. Natl. Acad. Sci. U.S.A. 2001, 98 (20), 11638-11643. 11. Ogino, T.; Ohno, R.; Sekiya, K.; Kuwae, A.; Matsuzawa, T.; Nonaka, T.; Fukuda, H.; Imajoh-Ohmi, S.; Abe, A., Assembly of the type III secretion apparatus of enteropathogenic Escherichia coli. J. Bacteriol. 2006, 188 (8), 2801-11.


27

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 36

12. Yip, C. K.; Finlay, B. B.; Strynadka, N. C. J., Structural characterization of a type III secretion system filament protein in complex with its chaperone. Nat. Struct. Mol. Biol. 2005, 12 (1), 75-81. 13. Yonekura, K.; Maki-Yonekura, S.; Namba, K., Complete atomic model of the bacterial flagellar filament by electron cryomicroscopy. Nature 2003, 424 (6949), 643-650. 14. Neves, B. C.; Knutton, S.; Trabulsi, L. R.; Sperandio, V.; Kaper, J. B.; Dougan, G.; Frankel, G., Molecular and ultrastructural characterisation of EspA from different enteropathogenic Escherichia coli serotypes. FEMS Microbiol. Lett. 1998, 169 (1), 73-80. 15. Delahay, R. M.; Knutton, S.; Shaw, R. K.; Hartland, E. L.; Pallen, M. J.; Frankel, G., The coiled-coil domain of EspA is essential for the assembly of the type III secretion translocon on the surface of enteropathogenic Escherichia coli. J. Biol. Chem. 1999, 274 (50), 35969-74. 16. Dahan, S.; Knutton, S.; Shaw, R. K.; Crepin, V. F.; Dougan, G.; Frankel, G., Transcriptome of enterohemorrhagic Escherichia coli O157 adhering to eukaryotic plasma membranes. Infect. Immun. 2004, 72 (9), 5452-9. 17. Muza-Moons, M. M.; Koutsouris, A.; Hecht, G., Disruption of cell polarity by enteropathogenic Escherichia coli enables basolateral membrane proteins to migrate apically and to potentiate physiological consequences. Infect. Immun. 2003, 71 (12), 7069-78. 18. Shaw, R. K.; Daniell, S.; Frankel, G.; Knutton, S., Enteropathogenic Escherichia coli translocate Tir and form an intimin–Tir intimate attachment to red blood cell membranes. Microbiology 2002, 148 (5), 1355-1365.


28

Page 29 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

19. Frankel, G.; Phillips, A. D.; Rosenshine, I.; Dougan, G.; Kaper, J. B.; Knutton, S., Enteropathogenic and enterohaemorrhagic Escherichia coli : more subversive elements. Mol. Microbiol. 1998, 30 (5), 911-921. 20. Roberts, F. G.; Smith, H. A.; Low, A. G.; Ellis, P. R., Influence of wheat breads containing guar flour supplements of high and low molecular weights on viscosity of jejunal digesta in the pig. In Dietary Fibre. Chemical and Biological Aspects . A volume in Woodhead Publishing Series in Food Science, Technology and Nutrition, Southgate, D. A. T.; Waldron, K.; Johnson, I. T.; Fenwick, G. R., Eds. Woodhead Publishing Limited: 2005; pp 164-168. 21. Rief, M.; Gautel, M.; Oesterhelt, F.; Fernandez, J. M.; Gaub, H. E., Reversible unfolding of individual titin immunoglobulin domains by AFM. Science 1997, 276 (5315), 1109-12. 22. Carrion-Vazquez, M.; Oberhauser, A. F.; Fowler, S. B.; Marszalek, P. E.; Broedel, S. E.; Clarke, J.; Fernandez, J. M., Mechanical and chemical unfolding of a single protein: a comparison. Proc. Natl. Acad. Sci. U.S.A. 1999, 96 (7), 3694-9. 23. Carrion-Vazques, M.; E. Marszalek, P.; F. Oberhauser, A.; Fernandez, J. M., Atomic force microscopy captures length phenotypes in single proteins. Proc. Natl. Acad. Sci. U.S.A. 1999, 96 (September), 11288-11292. 24. Best, R. B.; Li, B.; Steward, A.; Daggett, V.; Clarke, J., Can Non-Mechanical Proteins Withstand Force? Stretching Barnase by Atomic Force Microscopy and Molecular Dynamics Simulation. Biophys. J. 2001, 81 (4), 2344-2356.


29

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 36

25. Brockwell, D. J.; S. Beddard, G.; Clarkson, J.; C. Zinober, R.; W. Blake, A.; Trinick, J.; D. Olmsted, D. A.; Smith, P.; Sheena E, R., The Effect of Core Destabilization on the Mechanical Resistance of I27. Biophys. J. 2002, 83 (1), 458-472. 26. Schlierf, M.; Li, H.; Fernandez, J. M., The unfolding kinetics of ubiquitin captured with single-molecule force-clamp techniques. Proc. Natl. Acad. Sci. U.S.A. 2004, 101 (19), 7299-304. 27. Valbuena, A.; Oroz, J.; Hervás, R.; Vera, A. M.; Rodríguez, D.; Menéndez, M.; Sulkowska, J. I.; Cieplak, M.; Carrión-Vázquez, M., On the remarkable mechanostability of scaffoldins and the mechanical clamp motif. Proc. Natl. Acad. Sci. U.S.A. 2009, 106 (33), 137916. 28. Jollymore, A.; Lethias, C.; Peng, Q.; Cao, Y.; Li, H., Nanomechanical Properties of Tenascin-X Revealed by Single-Molecule Force Spectroscopy. J. Mol. Biol. 2009, 385 (4), 12771286. 29. Garcia-Manyes, S.; Badilla, C. L.; Alegre-Cebollada, J.; Javadi, Y.; Fernández, J. M., Spontaneous Dimerization of Titin Protein Z1Z2 Domains Induces Strong Nanomechanical Anchoring. J. Biol. Chem. 2012, 287 (24), 20240-20247. 30. Perez-Jimenez, R.; Alonso-Caballero, A.; Berkovich, R.; Franco, D.; Chen, M.-W.; Richard, P.; Badilla, C. L.; Fernandez, J. M., Probing the Effect of Force on HIV-1 Receptor CD4. ACS Nano 2014, 8 (10), 10313-10320. 31. Wolny, M.; Batchelor, M.; Knight, P. J.; Paci, E.; Dougan, L.; Peckham, M., Stable Single α-Helices Are Constant Force Springs in Proteins. J. Biol. Chem. 2014, 289 (40), 2782527835.


30

Page 31 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

32. Popa, I.; Berkovich, R.; Alegre-Cebollada, J.; Badilla, C. L.; Rivas-Pardo, J. A.; Taniguchi, Y.; Kawakami, M.; Fernandez, J. M., Nanomechanics of HaloTag Tethers. J. Am. Chem. Soc. 2013, 135 (34), 12762-12771. 33. Li, H.; Linke, W. A.; Oberhauser, A. F.; Carrion-Vazquez, M.; Kerkvliet, J. G.; Lu, H.; Marszalek, P. E.; Fernandez, J. M., Reverse engineering of the giant muscle protein titin. Nature 2002, 418, 998. 34. Brockwell, D. J.; Paci, E.; Zinober, R. C.; Beddard, G. S.; Olmsted, P. D.; Smith, D. A.; Perham, R. N.; Radford, S. E., Pulling geometry defines the mechanical resistance of a β-sheet protein. Nat. Struct. Biol. 2003, 10 (9), 731-737. 35. Sandal, M.; Valle, F.; Tessari, I.; Mammi, S.; Bergantino, E.; Musiani, F.; Brucale, M.; Bubacco, L.; Samorì, B., Conformational Equilibria in Monomeric α-Synuclein at the SingleMolecule Level. PLoS Biol. 2008, 6 (1), e6-e6. 36. Alegre-Cebollada, J.; Badilla, C. L.; Fernandez, J. M., Isopeptide Bonds Block the Mechanical Extension of Pili in Pathogenic Streptococcus pyogenes. J. Biol. Chem. 2010, 285 (15), 11235-11242. 37. Aggarwal, V.; Kulothungan, S. R.; Balamurali, M. M.; Saranya, S. R.; Varadarajan, R.; Ainavarapu, S. R. K., Ligand-modulated parallel mechanical unfolding pathways of maltosebinding proteins. The Journal of biological chemistry 2011, 286 (32), 28056-65. 38. Taniguchi, Y.; Brockwell, D. J.; Kawakami, M., The Effect of Temperature on Mechanical Resistance of the Native and Intermediate States of I27. Biophys. J. 2008, 95 (11), 5296-5305.


31

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 36

39. Botello, E.; Harris, N. C.; Sargent, J.; Chen, W. H.; Lin, K. J.; Kiang, C. H., Temperature and Chemical Denaturant Dependence of Forced Unfolding of Titin 127. J. Phys. Chem. B 2009, 113 (31), 10845-10848. 40. Rico, F.; Gonzalez, L.; Casuso, I.; Puig-Vidal, M.; Scheuring, S., High-Speed Force Spectroscopy Unfolds Titin at the Velocity of Molecular Dynamics Simulations. Science 2013, 342 (6159), 741-743. 41. Cossio, P.; Hummer, G.; Szabo, A., Kinetic Ductility and Force-Spike Resistance of Proteins from Single-Molecule Force Spectroscopy. Biophys. J. 2016, 111 (4), 832-840. 42. Gibson, D. G.; Young, L.; Chuang, R.-Y.; Venter, J. C.; Hutchison, C. A.; Smith, H. O., Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 2009, 6 (5), 343-345. 43. Florin, E. L.; Rief, M.; Ehmann, L. H.; Ludwig, M.; Dornmair, C.; Moy, V. T.; Gaub, H. E., Sensing specific molecular interactions with the atomic force microscope. Biosens. Bioelectron. 1995, 10 (9-10), 895-901. 44. Bustamante, C.; Marko, J. F.; Siggia, E. D.; Smith, S., Entropic elasticity of lambdaphage DNA. Science 1994, 265 (5178), 1599-600. 45. Marko, J. F.; Siggia, E. D., Stretching DNA. Macromolecules 1995, 28, 8759-8770. 46. Dudko, O. K.; Hummer, G.; Szabo, A., Theory, analysis, and interpretation of singlemolecule force spectroscopy experiments. Proc. Natl. Acad. Sci. U.S.A. 2008, 105 (41), 1575560.


32

Page 33 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

47. Schlierf, M.; Rief, M., Single-molecule unfolding force distributions reveal a funnelshaped energy landscape. Biophys. J. 2006, 90 (4), L33-5. 48. Lapidus, L. J.; Eaton, W. A.; Hofrichter, J., Measuring the rate of intramolecular contact formation in polypeptides. Proc. Natl. Acad. Sci. U.S.A. 2000, 97 (13), 7220-5. 49. Yang, W. Y.; Gruebele, M., Folding at the speed limit. Nature 2003, 423 (6936), 193197. 50. Li, M. S.; Klimov, D. K.; Thirumalai, D., Thermal denaturation and folding rates of single domain proteins: size matters. Polymer 2004, 45 (2), 573-579. 51. Marszalek, P. E.; Lu, H.; Li, H.; Carrion-Vazquez, M.; Oberhauser, A. F.; Schulten, K.; Fernandez, J. M., Mechanical unfolding intermediates in titin modules. Nature 1999, 402 (6757), 100-103. 52. Schwaiger, I.; Kardinal, A.; Schleicher, M.; Noegel, A. A.; Rief, M., A mechanical unfolding intermediate in an actin-crosslinking protein. Nature Structural &Amp; Molecular Biology 2003, 11, 81. 53. Li, L.; Huang, H. H.-L.; Badilla, C. L.; Fernandez, J. M., Mechanical Unfolding Intermediates Observed by Single-molecule Force Spectroscopy in a Fibronectin Type III Module. J. Mol. Biol. 2005, 345 (4), 817-826. 54. Hoffmann, T.; Tych, K. M.; Brockwell, D. J.; Dougan, L., Single-Molecule Force Spectroscopy Identifies a Small Cold Shock Protein as Being Mechanically Robust. The Journal of Physical Chemistry B 2013, 117 (6), 1819-1826.


33

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 36

55. Garcia-Manyes, S.; Giganti, D.; Badilla, C. L.; Lezamiz, A.; Perales-Calvo, J.; Beedle, A. E. M.; Fernández, J. M., Single-molecule Force Spectroscopy Predicts a Misfolded, Domainswapped Conformation in human γD-Crystallin Protein. J. Biol. Chem. 2016, 291 (8), 4226-35. 56. Improta, S.; Krueger, J. K.; Gautel, M.; Atkinson, R. A.; Lefevre, J. F.; Moulton, S.; Trewhella, J.; Pastore, A., The assembly of immunoglobulin-like modules in titin: Implications for muscle elasticity. J. Mol. Biol. 1998, 284 (3), 761-777. 57. Daniell, S. J.; Kocsis, E.; Morris, E.; Knutton, S.; Booy, F. P.; Frankel, G., 3D structure of EspA filaments from enteropathogenic Escherichia coli. Mol. Microbiol. 2003, 49 (2), 301-8. 58. Singh, M. P.; Shaw, R. K.; Knutton, S.; Pallen, M. J.; Crepin, V. F.; Frankel, G., Identification of amino acid residues within the N-terminal domain of EspA that play a role in EspA filament biogenesis and function. J. Bacteriol. 2008, 190 (6), 2221-6. 59. Crepin, V. F.; Martinez, E.; Shaw, R. K.; Frankel, G.; Daniell, S. J., Structural and Functional Properties of Chimeric EspA-FliCi Filaments of EPEC. J. Mol. Biol. 2008, 378 (1), 243-250. 60. Oberhauser, A. F.; Marszalek, P. E.; Erickson, H. P.; Fernandez, J. M., The molecular elasticity of the extracellular matrix protein tenascin. Nature 1998, 393 (6681), 181-185. 61. Rief, M.; Pascual, J.; Saraste, M.; E Gaub, H., Single molecule force spectroscopy of spectrin repeats: low unfolding forces in helix bundles. J. Mol. Biol. 1999, 286 (2), 553-561. 62. Schwaiger, I.; Sattler, C.; Hostetter, D. R.; Rief, M., The myosin coiled-coil is a truly elastic protein structure. Nature Materials 2002, 1 (4), 232-235.


34

Page 35 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

63. Taniguchi, Y.; Khatri, B. S.; Brockwell, D. J.; Paci, E.; Kawakami, M., Dynamics of the Coiled-Coil Unfolding Transition of Myosin Rod Probed by Dissipation Force Spectrum. Biophys. J. 2010, 99 (1), 257-262. 64. Crepin, V. F.; Shaw, R.; Knutton, S.; Frankel, G., Molecular Basis of Antigenic Polymorphism of EspA Filaments: Development of a Peptide Display Technology. J. Mol. Biol. 2005, 350 (1), 42-52. 65. Larzábal, M.; Mercado, E. C.; Vilte, D. A.; Salazar-González, H.; Cataldi, A.; NavarroGarcia, F., Designed Coiled-Coil Peptides Inhibit the Type Three Secretion System of Enteropathogenic Escherichia coli. PLoS ONE 2010, 5 (2), e9046-e9046. 66. Larzábal, M.; Zotta, E.; Ibarra, C.; Rabinovitz, B. C.; Vilte, D. A.; Mercado, E. C.; Cataldi, Á., Effect of coiled-coil peptides on the function of the type III secretion systemdependent activity of enterohemorragic Escherichia coli O157:H7 and Citrobacter rodentium. Int. J. Med. Microbiol. 2013, 303 (1), 9-15.

TOC Graphic


35

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 36


36

Deciphering the Mechanical Properties of Type III Secretion System

Recommend Documents