Article pubs.acs.org/est
Degradation of Extracellular Antibiotic Resistance Genes with UV254 Treatment Pin Hsuan Chang,† Brianna Juhrend,† Terese M. Olson,† Carl F. Marrs,‡ and Krista R. Wigginton*,† †
Department of Civil and Environmental Engineering, University of Michigan, Ann Arbor, Michigan 48109, United States Epidemiology Department, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109, United States
‡
Environ. Sci. Technol. 2017.51:6185-6192. Downloaded from pubs.acs.org by OPEN UNIV OF HONG KONG on 01/25/19. For personal use only.
S Supporting Information *
ABSTRACT: Disinfected wastewater effluent contains a complex mixture of biomolecules including DNA. If intact genes conveying antibiotic resistance survive the disinfection process, environmental bacteria may take them up. We treated plasmid pWH1266, which contains ampicillin resistance gene blaTEM‑1 and tetracycline resistance gene tetA, with UV254 doses up to 430 mJ/cm2 and studied the ability of those genes to be acquired by Acinetobacter baylyi. The plasmids required approximately 20−25 mJ/cm2 per log10 loss of transformation efficiency. We monitored plasmid DNA degradation using gel electrophoresis and qPCR with both short amplicons (∼200 bps, representative of ARG amplicon lengths commonly used for environmental monitoring) and long amplicons (800−1200 bps, designed to cover the entire resistance genes). The rate of transformability loss due to UV254 treatment was approximately 20× and 2× larger than the rate of gene degradation measured with the short and long amplicons qPCR, respectively. When extrapolated to account for the length of the entire pWH1266 plasmid, the qPCR rate constants were 2−7× larger than the rate constants measured with transformation assays. Gel electrophoresis results confirmed that DNA cleavage was not a major inactivating mechanism. Overall, our results demonstrate that qPCR conservatively measures the potential for a gene to be transformed by environmental bacteria following UV254 treatment.
■
INTRODUCTION The proliferation of bacterial resistance to antibiotics results in more than two million illnesses and 23 000 deaths each year in the U.S. alone.1 To combat the continued emergence and spread of resistant bacteria, the World Health Organization (WHO) announced a global action plan in 2015 that urges international participants to take action in controlling and monitoring the spread of all forms of antimicrobial resistance.2 Although links between the release of antibacterial resistance genes into the environment and the emergence of new resistant pathogens in the clinic are not fully developed, resistant bacteria can transfer resistance genes to human pathogenic species, compromising antibiotic treatment effectiveness.3,4 Experts therefore recommend minimizing the release of antibacterial resistance to the environment. Municipal wastewater and livestock wastes have been identified as significant sources of antibiotic resistant bacteria and their associated antibiotic resistance genes (ARGs) in the environment,5,6 with wastewater treatment plant (WWTP) effluent leading to increased levels of resistance genes and resistant bacteria downstream of effluent discharges.7−9 Antibiotic resistance is passed by either vertical gene transmission, where genetic information is inherited from parent cells, or horizontal gene transfer (HGT), where a bacterium without resistance acquires the necessary genes from © 2017 American Chemical Society
mobile genetic elements. HGT can occur by conjugation (in which DNA is passed from a donor cell to an acceptor cell through direct cell−cell contact), transduction (where bacteriophage introduce ARGs into microbial cells), or transformation (where competent microbes take up free DNA from their surroundings).10,11 Wastewater carries different forms of ARGs, including DNA carried within bacteria and viruses, and extracellular DNA.12 Each form has the potential to transfer resistance by the different mechanisms described above. For either vertical gene transmission or conjugation to occur, the bacterium carrying the gene must be viable so that it can pass the gene onto its daughter cells or to another organism. Likewise, for transduction to occur, the virus containing the genes must be infective.13 Transformation, however, does not require a viable or infective donor microorganism; in this case, competent bacteria in the environment may pick up a gene present in extracellular DNA. Consequently, wastewater treatment processes that kill bacteria containing ARGs do not necessarily eliminate the potential for ARG transfer downstream. Indeed, most wasteReceived: Revised: Accepted: Published: 6185
March 1, 2017 April 28, 2017 May 5, 2017 May 5, 2017 DOI: 10.1021/acs.est.7b01120 Environ. Sci. Technol. 2017, 51, 6185−6192
Article
Environmental Science & Technology
Figure 1. Schematic depicting experimental approach. Purified plasmids containing ARGs are treated with UV254. The treated plasmids are subjected to transformation assays in Acinetobacter baylyi to measure the extent that UV254 treatment has reduced the transformation efficiency of the ARGs on the plasmids. The treated plasmid samples are also analyzed with short amplicon- and long amplicon-qPCR to measure the reaction kinetics of ARGs on the plasmids. The qPCR and transformation reaction kinetics are compared. Gel electrophoresis is applied to assess the extent of plasmid DNA breaks following UV254 treatment.
ARG regions. Short amplicon qPCR was conducted to represent qPCR assays that are commonly conducted to track ARGs in water treatment and the environment. Long amplicon qPCR was conducted to track the modification of entire resistance genes. The same samples were analyzed by gel electrophoresis to detect plasmid nicks and breaks following UV treatment. Ultimately, the kinetics of the ARG transformation loss and qPCR amplicon reactions were compared to assess the effectiveness of qPCR at tracking the destruction of ARG transformation ability. Model Transformation System. We adopted a model transformation system to mimic environmental transformation events downstream of WWTP effluents. The system (kindly provided by Dr. Chuanwu Xi, University of Michigan) was comprised of the A. baylyi strain AC811, a derivative of Acinetobacter sp. strain BD413,20,23 and plasmid pWH1266 which is a construct of the E. coli plasmid pBR322 (4.4 kbps) and the cryptic plasmid pWH1277 (4.5 kbps) isolated from A. lwof f i (Figure 2).24 The pBR322 portion of the plasmid carries
water treatment and animal waste processes are not designed to destroy nucleic acids in the waste. To track antibacterial resistance through wastewater treatment, both culture-based and molecular-based methods are employed.14 Culture methods, like broth dilution, disk diffusion, and selective plating, detect the presence of culturable antibiotic resistance bacteria.15,16 These methods do not detect ARGs in viruses, extracellular DNA, or nonculturable bacteria. Molecular-based quantitative PCR (qPCR), on the other hand, detects pieces of the ARGs, regardless of whether they are in a viable cell.17 However, qPCR amplicons rarely encompass the entire ARG, not to mention regions outside of the gene that are necessary for gene transfer pathways.18 Furthermore, qPCR may not detect certain damaged ARGs that can be repaired by the bacteria that pick up the DNA. Finally, enzymes involved with the ARG transfer pathways in the cells may have different fidelities to damaged DNA than polymerase enzymes used in qPCR.19 The relationship between concentrations of ARGs detected by qPCR and the concentration of ARGs present in extracellular DNA capable of transformation by bacteria in the environment is unknown. To address this, we compared the kinetics of ARG inactivation by ultraviolet (UV254) disinfection using qPCR and transformation assays. UV254 is increasingly used to treat wastewater effluent and is known to target nucleic acids. We studied plasmid transformation in Acinetobacter species as a proxy for transformation of extracellular DNA in the environment. Acinetobacter species are ubiquitous in soil and aquatic environments, undergo spontaneous gene transformation at high frequency,20,21 and can be opportunistic human pathogens.22
Figure 2. Plasmid 1266, which is a construct of E. coli plasmid pBR322 and A. calcoaceticus cryptic plasmid pWH1277 (gray portion).
■
EXPERIMENTAL METHODS General Experimental Approach. Solutions of purified plasmids that contain ARGs were exposed to different doses of UV254 (Figure 1). The treated plasmids were then subjected to transformation assays to establish the reaction kinetics for the loss of ARG transformation ability. The same samples were assayed by qPCR to track the reaction kinetics of the plasmid
the tetA tetracycline resistance gene and the ampicillin resistance gene blaTEM‑1 that encodes TEM-1 beta-lactamase (Figure 2).24−26 The pWH1266 was propagated in E. coli strain TOP10. Plasmid Extraction. Host E. coli TOP10 cells carrying the plasmid were incubated in 5 mL LB broth (Sigma-Aldrich, St. 6186
DOI: 10.1021/acs.est.7b01120 Environ. Sci. Technol. 2017, 51, 6185−6192
Article
Environmental Science & Technology Table 1. Primers Used in This Study primer
sequence (5′- 3′)
primer length
amplicon size
annealing temperature (°C)
melting temperature (°C)
tetA Long FW tetA Long RV tetA Short FW tetA Short RV blaTEM‑1 Long FW blaTEM‑1 Long RV blaTEM‑1 Short FW blaTEM‑1 Short RV
CGTGTATGAAATCTAACAATGCGCT CCATTCAGGTCGAGGTGGC GACTATCGTCGCCGCACTTA ATAATGGCCTGCTTCTCGCC TTACCAATGCTTAATCAGTGAGGC ATGAGTATTCAACATTTCCGTGTCG AATAAACCAGCCAGCCGGAA TTGATCGTTGGGAACCGGAG
25 19 20 20 24 25 20 20
1200
51.9
216
53.9
861
51.4
209
53.8
56.9 60.6 58.9 59.8 56.6 56.4 58.8 59.2
Louis, MO) containing 20 μg/L tetracycline with shaking (180 rpm) at 37 °C until they reached stationary growth phase (∼16 h). The cells were then treated with QIAprep Spin Miniprep Kits (Qiagen, Valencia, CA) 15 per the manufacturer’s instruction. Several extractions were conducted concurrently to prepare the plasmid stocks. The resulting purified plasmid solutions contained 20−60 ng/μL plasmid DNA, as measured by a NanoDrop ND-1000 (SI Figure 1; ThermoFisher Scientific, Waltham, MA). Transformation Assays. Transformation assays were conducted to quantify the ability of A. baylyi to acquire antibiotic resistance from the plasmid.15 Transformation efficiency of the plasmid/A. baylyi system was determined as the ratio of the antibiotic resistant bacteria (ARB) colonies detected on selective plates to the total colonies detected on nonselective plates, as expressed by the following equation: transformation efficiency =
transformant CFU total CFU
visualized by SYBR Safe DNA gel staining (Life Technologies, Carlsbad, CA) alongside the GeneRuler 1kb DNA ladders (ThermoFisher Scientific, Waltham, MA). qPCR Measurements. The tetA gene (1191 bps) and blaTEM‑1 gene (861 bps) on the pWH1266 plasmid were quantified with both short amplicon and long amplicon qPCR (Table 1). The short amplicons covered a fraction of the resistance genes (∼200 bps), whereas the long amplicons were designed to cover the entire tetA and blaTEM‑1 gene sequences. Amplicon and primer sequences were identified using the plasmid pBR322 sequence, which is the portion of plasmid pWH1266 that carries both resistance genes. Sequences were acquired from the NCBI GenBank database (J01749.1). All primers were designed with NCBI Primer-BLAST tool. The qPCR measurements were performed on a Mastercycler RealPlex 2 (Eppendorf, Hamburg, Germany) using a Fast EvaGreen qPCR Master Mix (Biotium). Standard curves were conducted in triplicate, with 10-fold dilutions covering 5 orders of magnitude. Each 10 μL qPCR reaction contained 5 μL of 2X Master Mix, 0.5 μL of forward and reverse primers at 100 μM, 0.1 μL of DNA template, and 4.4 μL sterile DNase free water. The temperature profile included one cycle at 95 °C for 2 min, 40 cycles at 95 °C for 5 s, the annealing temperature (TA, Table 1) for 15 s, 72 °C for either 15 s (short amplicons) or 60 s (long amplicons), and then a melting curve to verify specificity. qPCR assays amplifying short and long amplicons were successfully developed for both tetA and blaTEM‑1 genes. The amplification efficiency was 0.90 ± 0.05 for tetA short amplicon (216 bps), 0.82 ± 0.08 for blaTEM‑1 short amplicon (209 bps), 0.71 ± 0.05 for tetA long amplicon (1200 bps), and 0.74 ± 0.04 for blaTEM‑1 long amplicon (861 bps). The average R2 value across all qPCR assays was 0.995 ± 0.003 (mean ± SD). UV Disinfection Experiments. The UV disinfection experiments were conducted in a collimated beam reactor (SI Figure S3) housing four lamps that emit 254 nm germicidal UV (Philips TUV G15T8, Amsterdam, Netherlands). The UV irradiance was 0.18 ± 0.01 mW/cm2 (mean ± SD) as determined with chemical actinometry using potassium iodide.29 The chemical actinometry and UV experiments were conducted in the same 96-well plates and the UV intensity was similar across all plate wells. For UV experiments, the plasmid stocks were diluted to 10 ng/μL in 50 μL DNase free water in 96-well plates. At this concentration and sample depth, the transmittance of UV254 was approximately 93%, thus shielding corrections were not deemed necessary. The samples were exposed to UV254 for 1, 3, 5, 10, 20, and 40 min, corresponding to UV254 doses of 11, 32, 54, 108, 215, and 430 mJ/cm2. At each sample point, the remaining ARG amplicon concentration was quantified with qPCR and the remaining transformation efficiency was measured with transformation assays. Inactivation kinetics were established for the transformation and qPCR
(1)
where CFU stands for colony forming units. Experiments were conducted to establish the optimal transformation efficiencies, including plasmid concentration, the time point in the A. baylyi growth curve to spike in plasmids, and the time to incubate the plasmids with the bacteria. Details of these experiments are reported in the SI. Once optimized, the transformation assays were always conducted in the same manner. In brief, aliquots of A. baylyi strain AC811 stored at −80 °C were thawed and streaked on LB agar plates, and incubated overnight at 30 °C. Three colonies of A. baylyi were inoculated in 5 mL LB broth and incubated for 18 h at 30 °C and 140 rpm in order to reach stationary growth phase (SI Figure S2). Subsequently, 0.5 mL of the cell suspension was diluted 10× in LB broth and incubated at 30 °C and 140 rpm for another 8 h to reach late exponential phase. In a sterile glass tube, 480 μL of the bacteria was combined with 20 μL untreated or UV-treated plasmid solution (10 ng/μL), resulting in a final ARG concentration of 0.4 ng/μL. The mixture was incubated at 30 °C and 140 rpm for 24 h. Serial dilutions of the suspension were plated onto selective media plates (10 μg/mL tetracycline or 100 μg/mL ampicillin) for transformant counts27,28 and onto LB plates for total cell counts. Gel Electrophoresis. Potential plasmid breakage after UV254 treatment and enzyme digestion was assessed with DNA gel electrophoresis. The pWH1266 plasmids were incubated with restriction enzymes BamHI and PvuI (Thermo Fisher Scientific, Waltham, MA) at 37 °C for 1 h to cut the plasmids inside and outside of the tetA gene, respectively. Gel electrophoresis of the plasmid DNA before and after UV254 treatment and restriction enzyme treatment was conducted on 0.5% agarose gels at 3 V/cm for 60 min. The bands were 6187
DOI: 10.1021/acs.est.7b01120 Environ. Sci. Technol. 2017, 51, 6185−6192
Article
Environmental Science & Technology data. Kinetics were expressed as first-order (ln C/C0 versus UV254 dose). Statistical Analyses. Statistical analyses were conducted in Microsoft Excel 2016 and StatPlus (AnalystSoft Inc., Walnut, CA). Data from replicate experiments were pooled for linear regression analyses. The first order reaction rate constants from different types of experiments were compared with multiple linear regression analyses using StatPlus (AnalystSoft Inc., Walnut, CA). The null hypothesis in all of the experimental comparisons (e.g., transformation assay vs long amplicon qPCR) was that the first order rate constants were not significantly different. The P values were computed at a confidence level of 95%.
contains 8.9 kbps. For context, a multidrug resistant Pseudomonas aeruginosa bacterial strain required 2 mJ/cm2 UV254 to achieve 1-log10 inactivation and a Vancomycinresistant Enterococcus faecium bacterial strain required 8 mJ/cm2 to achieve 1-log10 inactivation.17 The genomes of P. aeruginosa and E. faecium are approximately 6500 and 3000 kbp, respectively. The dsDNA adenoviruses and polyomaviruses require approximately 40−60 mJ/cm2 per log10 inactivation.30−32 Interestingly, the adenovirus genome is much larger than the polyomavirus genome (∼35 kbps and ∼5 kbps, respectively), but they have similar UV inactivation kinetics. The discrepancies may be due to differences in the ability of host cells to repair the DNA or due to the different ways that adenovirus and polyomavirus infectivity is assayed. More UV254 irradiance is required to inactivate polyomavirus than to inactivate the extracellular plasmids tested here, despite polyomavirus having fewer DNA base pairs. The reason for this is not known, but may be because encapsulation of the virus DNA in the protein capsids impacts the DNA reactivity with UV254. To elucidate the mechanisms behind the transformation efficiency loss, we studied reactions that took place in the plasmid DNA by gel electrophoresis and short and long amplicon qPCR. Plasmid Damage Measured with DNA Gel Electrophoresis. UV254 can cause several types of modifications in double stranded DNA, including DNA backbone breaks.33,34 Hypothetically, the observed loss of transformation efficiency could be due to nicking, linearization or fragmentation on the pWH1266 DNA plasmids. To detect plasmid conformation changes in our system, we conducted gel electrophoresis before and after UV treatment, and also after treatment with the restriction enzymes BamHI and PvuI, which cut the plasmid inside and outside the tetA gene, respectively (Figure 2). Gels of the untreated pWH1266 exhibited a major band at approximately 4.6 kb, and a minor band at approximately 9.8 kb (Figure 4). These two bands were identified as the
■
RESULTS AND DISCUSSION After optimization, the transformation efficiencies of both tetracycline resistance from tetA and ampicillin resistance from blaTEM‑1 were consistently between 10−4 and 10−5. In other words, one out of 10 000 or 100 000 A. baylyi cells attained resistance when exposed to the plasmids. Loss of Transformation Efficiency During UV Treatment. Transformation efficiencies of both tetracycline and ampicillin resistance decreased with increasing UV254 doses (Figure 3). At 54 mJ/cm2, the transformation efficiencies
Figure 3. tetA and blaTEM‑1 degradation versus UV dose measured with qPCR short amplicon (SA), long amplicon (LA), and transformation assays. The error bars indicate one standard deviation from the mean (n ≥ 3). For visibility, data has been pooled.
dropped to approximately 10−7 or lower, and beyond this dose, they were below the assay detection limit ( 0.1. Deviations from first order kinetics measured with qPCR have previously been reported with UV treatment.17,39 Reaction kinetics measured with qPCR did not change with replicate experiments on different days. For this reason, qPCR data was pooled to find the first order rate constants. For both genes, the LA first-order rate constants were larger than the SA first-order rate constants (Figure 5). This was expected due to the larger number of targets in the LA sequence compared to the SA sequence. Both SAs and LAs had reaction kinetics that were slower than the inactivation kinetics of antibiotic resistance transformation. For example, at a dose of 108 mJ/cm2, the tetA SA had decreased about 0.25 log10 units, whereas the LA had decreased about 1.5 log10 units; extrapolating the inactivation kinetics of tetracycline resistance transformation to this dose results in a 5-log10 loss in the gene transformation efficiency. These results highlight that qPCR of the entire resistance gene will underestimate the loss in a gene’s ability to be transformed. Ultimately, the results demonstrate that using qPCR results to track ARGs through a UV treatment process will provide conservative conclusions on the ability of DNA to transfer resistance. For the case of our two ARGs, this is true even when the entire ARG is covered by the selected amplicon. The slower LA-qPCR reaction kinetics compared to that of the antibiotic resistance transformation could be explained by the fact that modifications outside the tetA and blaTEM‑1 genes are critical for ARG transformation and expression. In an earlier study of the shuttle plasmid pWH1266, deletion and insertion analyses were conducted to identify specific plasmid regions that were necessary for the transformation of ampicillin and tetracycline resistance in A. calcoaceticus BD413.23 They identified a 1350-bp region in the cryptic pWH1277 portion of the pW1266 plasmid construct that was critical for transformation of blaTEM‑1 and tetA in A. calcoaceticus BD413. The study did not attempt to identify elements on the pBR322 region of the pW1266 plasmid construct that were critical for transformation in A. calcoaceticus BD413. The rate of transformation efficiency loss with UV treatment was the same for ampicillin and tetracycline resistance genes on the same plasmid, despite the fact that the blaTEM‑1 and tetA genes degraded at different rates, based on LA-qPCR results (Figure 5 and SI Table S2). This suggests that the transformation inactivation mechanism may be the same for both resistance types.
intensities of the two bands and no new bands appeared. For reference, a UV254 dose of 108 mJ/cm2 corresponded to approximately 5 log10 loss of the tetracycline resistance transformation efficiency in our experiments. To visualize a 3-log10 loss of transformation efficiency due to strand breaks, the pWH1266 was digested with BamHI and PvuI to a point that the tetA transformation efficiency had decreased from 5 × 10−5 to 2 × 10−8 and 4 × 10−8, respectively. Gels of both digests consisted of a single band at approximately 9.0 kbps, representing the linearized plasmid (Figure 4). These enzyme restriction experiments demonstrate that DNA breaks outside the tetA gene substantially reduce transformation efficiency of tetracycline resistance. A similar observation was reported in a previous study where a pGV1 plasmid with kanamycin resistance was cut with a variety of enzymes and the transformation efficiencies following each treatment dropped by 2−3 log10.28 Our gel electrophoresis results also suggest that the mechanism of transformation efficiency loss with UV254 treatment was not due to DNA backbone breaks. This agrees with a previous study where high doses of UV254 were needed for dsDNA breaks;35 in that study with human P3 cell DNA, one double strand DNA break per kbp of DNA corresponded to a UV254 dose of approximately 2000 mJ/cm2. Reactions Measured with qPCR. In environmental water samples, antibiotic resistance cannot be readily monitored with transformation assays; therefore, qPCR is typically employed to quantify the prevalence of ARG sequences. Amplicon sizes are typically in the range of 70−200 bps for optimized PCR efficiency and to avoid inhibitor effects reported in larger amplicons,36 but amplicons greater than 1000 bps have been developed to detect DNA damage.17,37,38 Here, we analyzed short amplicons (SA, ∼200 bps) that covered a fraction of the ARG, and long amplicons (LA, 800−1200 bps) that covered the whole ARG sequence, before and after UV254 treatment, and compared the reaction kinetics to those measured with transformation assays. As expected, the short and long ARG amplicons measured by qPCR decreased in concentration as UV doses increased (Figure 3). The reaction kinetics of the short amplicons followed first order kinetics over the entire range of doses measured, but the long amplicon reaction kinetics deviated from first order kinetics at doses corresponding to >90% reductions in concentration (SI Figure S6). For this reason, rate constants for the qPCR experiments were determined using 6189
DOI: 10.1021/acs.est.7b01120 Environ. Sci. Technol. 2017, 51, 6185−6192
Article
Environmental Science & Technology Table 2. Number of Neighboring Pyrimidine Bases in Amplicons dimer counta
a
dimer count/amplicon length (%)
amplicon name (size bps)
TT
TC
CT
CC
total
TT
TC
CT
CC
total
blaTEM‑1 short (209) tetA short (216) blaTEM‑1 long (861) tetA long (1200)
30 18 123 80
21 32 106 149
35 26 105 132
41 26 97 199
127 102 431 560
14.4 8.3 14.3 6.7
10.0 14.8 12.3 12.4
16.7 12.0 12.2 11.0
19.6 12.0 11.3 16.6
60.8 47.2 50.1 46.7
The TTTT sequence was counted as 3 neighboring thymidines (T1T2T3T)
reaction rate constants overestimate the reaction rate constant of the entire plasmid. It is also possible that the A. baylyi cells repair the UV-damaged DNA upon uptake; if this is the case, then the damage we detect with qPCR does not necessarily inactivate the plasmid’s ability to be transformed in A. baylyi. Bacteriophage DNA damaged by UV254 can be repaired when it enters its host cell40 and the same may occur with plasmid DNA that enters the bacterial cell. A number of potential DNA repair mechanisms have been identified in Acinetobacter species.41,42 When qPCR is applied to predict the inactivation of ARGs, we assume that the polymerase enzymes in the qPCR technique (Taq polymerase in this study) detect the same DNA modifications that inhibit the cellular mechanisms responsible for plasmid transformation and ARG expression. Research on the chemistry of DNA photolysis with UV254 suggests that cyclobutane-pyrimidine dimers (CPDs) and 6−4 photoproduct (6−4PP) are the major DNA products.43 Both modifications occur between two adjacent pyrimidines, with thymine−thymine (T−T) CPDs being the most prevalent product.43,44 The ability of polymerase enzymes in qPCR to read over DNA adducts depends on the type of modification, with T−T dimers having the biggest impact on amplification efficiency.45 It is also dependent on the polymerase used for amplification; Taq polymerases, which were used here, do not read over pyrimidine dimers.46 The impacts of specific photoproducts on DNA transformation mechanisms have not been identified. To summarize the qPCR and transformation results, the ARG transformation inactivation rate constants did not correspond to the ARG rate constants measured by LAqPCR. In this case, the LA-qPCR results underestimated ARG transformation loss. The transformation inactivation rate constants also did not correspond to the qPCR reaction rate constants when the results were extrapolated to the size of entire plasmid. In this case, the extrapolated qPCR results overestimated ARG transformation loss. As mentioned above, the blaTEM‑1 gene first order reaction rate measured with qPCR was faster than the first order reaction rate of the tetA gene, despite the fact that the tetA gene is larger than the blaTEM‑1 gene. Previously, McKinney and Pruden studied reactions in ARGs due to UV254 radiation using qPCR and demonstrated that the disappearance of ARG amplicons correlated strongly with the number of adjacent T-T bases in the amplicon targets (r = −0.93).17 In their analysis, neighboring thymidine bases on one of the two DNA strands were enumerated. We applied the same approach, but summed up adjacent pyrimidine bases on both DNA strands due to the fact that qPCR measures both strands (Table 2). Interestingly, the blaTEM‑1 gene contains ∼1.5× the number of adjacent T−T bases than tetA, but is only 72% the length of tetA. The higher T−T base content of blaTEM‑1 explains the LA-qPCR results; the blaTEM‑1 gene reacted ∼1.2× faster than tetA (Table 2; p
0.05), t tests on replicate data collected at the largest tested dose (54 mJ/cm2) did suggest that the extrapolated SA-qPCR overestimated the loss of gene transformation (p-values = 3.4 × 10−3 for tetA comparison and 5.0 × 10−3 for blaTEM‑1 comparison). In summary, extrapolating any of the four amplicon first order rate constants measured by qPCR to the entire plasmid overestimated the loss in a gene’s ability to be transformed. The overestimation of the extrapolated qPCR results in predicting ARG transformation loss could be due to certain regions of the plasmid not being critical for the effective transformation of the antibiotic resistance genes.23 Another possible explanation is that the 25% of the plasmid measured by qPCR is much more sensitive to UV254 than the rest of the plasmid, and thus our extrapolated 6190
DOI: 10.1021/acs.est.7b01120 Environ. Sci. Technol. 2017, 51, 6185−6192
Article
Environmental Science & Technology
(2) Global action plan on antimicrobial resistance; World Health Organization: Geneva, 2015; http://www.wpro.who.int/entity/drug_ resistance/resources/global_action_plan_eng.pdf. (3) Threlfall, E. J.; Ward, L. R.; Frost, J. A.; Willshaw, G. A. The emergence and spread of antibiotic resistance in food-borne bacteria. Int. J. Food Microbiol. 2000, 62 (1−2), 1−5. (4) Barton, M. D. Impact of antibiotic use in the swine industry. Curr. Opin. Microbiol. 2014, 19, 9−15. (5) Munir, M.; Wong, K.; Xagoraraki, I. Release of antibiotic resistant bacteria and genes in the effluent and biosolids of five wastewater utilities in Michigan. Water Res. 2011, 45 (2), 681−693. (6) Heuer, H.; Schmitt, H.; Smalla, K. Antibiotic resistance gene spread due to manure application on agricultural fields. Curr. Opin. Microbiol. 2011, 14 (3), 236−243. (7) Pei, R.; Kim, S. C.; Carlson, K. H.; Pruden, A. Effect of River Landscape on the sediment concentrations of antibiotics and corresponding antibiotic resistance genes (ARG). Water Res. 2006, 40 (12), 2427−2435. (8) Czekalski, N.; Gascón Díez, E.; Bürgmann, H. Wastewater as a point source of antibiotic-resistance genes in the sediment of a freshwater lake. ISME J. 2014, 8 (7), 1381−1390. (9) Amos, G. C. A.; Gozzard, E.; Carter, C. E.; Mead, A.; Bowes, M. J.; Hawkey, P. M.; Zhang, L.; Singer, A. C.; Gaze, W. H.; Wellington, E. M. H. Validated predictive modelling of the environmental resistome. ISME J. 2015, 9 (6), 1467−1476. (10) Thomas, C. M.; Nielsen, K. M. Mechanisms of, and barriers to, horizontal gene transfer between bacteria. Nat. Rev. Microbiol. 2005, 3 (September), 711−721. (11) Levy, S. B.; Marshall, B. Antibacterial resistance worldwide: causes, challenges and responses. Nat. Med. 2004, 10 (1078−8956 (Print)), S122−S129. (12) Colomer-Lluch, M.; Jofre, J.; Muniesa, M. Antibiotic resistance genes in the bacteriophage DNA fraction of environmental samples. PLoS One 2011, 6 (3), e17549. (13) Vettori, C.; Gallori, E.; Stotzky, G. Clay minerals protect bacteriophage PBS1 of Bacillus subtilis against inactivation and loss of transducing ability by UV radiation. Can. J. Microbiol. 2000, 46 (8), 770−773. (14) Bouki, C.; Venieri, D.; Diamadopoulos, E. Detection and fate of antibiotic resistant bacteria in wastewater treatment plants: a review. Ecotoxicol. Environ. Saf. 2013, 91, 1−9. (15) Modali, L. A. The use of laboratory and agent-based models to evaluate the role of natural transformation in biofilms in the formation and spread of antibiotic resistant bacteria in water systems; Ph.D. Dissertation, University of Michigan, Ann Arbor, MI, 2014. (16) Palmen, R.; Hellingwerf, K. J. Uptake and processing of DNA by Acinetobacter calcoaceticus - a review. Gene 1997, 192 (1), 179−190. (17) McKinney, C. W.; Pruden, A. Ultraviolet disinfection of antibiotic resistant bacteria and their antibiotic resistance genes in water and wastewater. Environ. Sci. Technol. 2012, 46 (24), 13393− 13400. (18) Pecson, B. M.; Ackermann, M.; Kohn, T. Framework for using quantitative PCR as a nonculture based method to estimate virus infectivity. Environ. Sci. Technol. 2011, 45, 2257−2263. (19) Palmen, R.; Buijsman, P.; Hellingwerf, K. J. Physiological regulation of competence induction for natural transformation in Acinetobacter calcoaceticus. Arch. Microbiol. 1994, 162 (5), 344−351. (20) Vaneechoutte, M.; Young, D. M.; Ornston, L. N.; Baere, T.; De Nemec, A.; Reijden, T.; Van Der Carr, E.; Tjernberg, I.; Dijkshoorn, L. Naturally transformable Acinetobacter sp. Strain ADP1 belongs to the newly described species Acinetobacter baylyi. Appl. Environ. Microbiol. 2006, 72 (1), 932−936. (21) Fondi, M.; Bacci, G.; Brilli, M.; Papaleo, M. C.; Mengoni, A.; Vaneechoutte, M.; Dijkshoorn, L.; Fani, R. Exploring the evolutionary dynamics of plasmids: the Acinetobacter pan-plasmidome. BMC Evol. Biol. 2010, 10 (1), 59. (22) Chen, T. L.; Siu, L. K.; Lee, Y. T.; Chen, C. P.; Huang, L. Y.; Wu, R. C. C.; Cho, W. L.; Fung, C. P. Acinetobacter baylyi as a
0.05). Our analysis demonstrates that the T−T base content of DNA is arguably more important than DNA size when predicting a genome’s reactivity with UV254. Environmental Implications. In this study, qPCR underestimated the loss of the DNA’s ability to be transformed into the Acinetobacter species, even when the entire resistance gene was amplified. In other words, qPCR detection of an ARG represents a conservative assessment of the gene’s ability to be transformed when it is released into the environment. When the qPCR results were extrapolated to the length of the entire plasmid, the results overestimated the loss of transformation efficiency. Future research should expand to other transformation models to see if the inactivation kinetics differs among bacterial species or types of extracellular DNA carrying the genes. When qPCR is employed to track the loss of ARGs capable of being transformed into competent bacterial cells, amplicons should cover the entire gene sequence when possible. Although this will result in conservative estimates of the ability of the gene to be transformed, it will be far less conservative than when only a fragment of the gene is monitored.
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.est.7b01120. Details on how plasmid concentrations were measured including figure of Qubit and Nanodrop measurement comparison; details of the transformation assay optimization experiments including figure of A. baylyi growth curve, figure of plasmid concentration vs transformation efficiency, and figure of transformation efficiency vs incubation time; schematic of the UV disinfection apparatus; figure of ARG reaction kinetics measured with qPCR; tables of measured first-order rate constants and corresponding P-values from multiple linear regressions (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*Phone: (734) 763-9661; fax. (734) 764-4292; e-mail: kwigg@ umich.edu. ORCID
Pin Hsuan Chang: 0000-0001-7410-0432 Terese M. Olson: 0000-0002-4728-742X Krista R. Wigginton: 0000-0001-6665-5112 Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS Funding for this research was provided through the University of Michigan MCubed program. We acknowledge the laboratory of Dr. Chuanwu Xi’s for assistance with transformation assays. The findings in this study do not represent the views of the sponsors.
■
REFERENCES
(1) Antibiotic resistance threats in the United States, 2013; Centers for Disease Control and Prevention: Atlanta, GA, 2013; https://www.cdc. gov/drugresistance/threat-report-2013/pdf/ar-threats-2013-508.pdf. 6191
DOI: 10.1021/acs.est.7b01120 Environ. Sci. Technol. 2017, 51, 6185−6192
Article
Environmental Science & Technology pathogen for opportunistic infection. J. Clin. Microbiol. 2008, 46 (9), 2938−2944. (23) Wu, J.; Xi, C. Evaluation of different methods for extracting extracellular DNA from the biofilm matrix. Appl. Environ. Microbiol. 2009, 75 (16), 5390−5395. (24) Hunger, M.; Schmucker, R.; Kishan, V.; Hillen, W. Analysis and nucleotide sequence of an origin of DNA replication in Acinetobacter calcoaceticus and its use for Escherichia coli shuttle plasmids. Gene 1990, 87 (1), 45−51. (25) Cooksey, R. C.; Clark, N. C.; Thornsberry, C. A gene probe for TEM type β-lactamases. Antimicrob. Agents Chemother. 1985, 28 (1), 154−156. (26) McNicholas, P.; Chopra, I.; Rothstein, D. M. Genetic analysis of the tetA(C) gene on plasmid pBR322. J. Bacteriol. 1992, 174 (24), 7926−7933. (27) Palmen, R.; Vosman, B.; Kok, R.; van der Zee, J. R.; Hellingwerf, K. J. Characterization of transformation-deficient mutants of Acinetobacter calcoaceticus. Mol. Microbiol. 1992, 6 (13), 1747−1754. (28) Palmen, R.; Vosman, B.; Buijsman, P.; Breek, C. K.; Hellingwerf, K. J. Physiological characterization of natural transformation in Acinetobacter calcoaceticus. J. Gen. Microbiol. 1993, 139 (2), 295−305. (29) Rahn, R. O. Potassium iodide as a chemical actinometer for 254 nm radiation: use of iodate as an electron scavenger. Photochem. Photobiol. 1997, 66 (6), 885−885. (30) Thurston-Enriquez, J. a; Haas, C. N.; Riley, K.; Gerba, C. P.; Jacangelo, J. Inactivation of feline calicivirus and adenovirus type 40 by UV radiation. 2003, 69 (1), 577−582. (31) Gerba, C. P.; Gramos, D. M.; Nwachuku, N. Comparative inactivation of enteroviruses and adenovirus 2 by UV light. Appl. Environ. Microbiol. 2002, 68 (10), 5167−5169. (32) Calgua, B.; Carratalà, A.; Guerrero-Latorre, L.; de Abreu Corrêa, A.; Kohn, T.; Sommer, R.; Girones, R. UVC innactivation of dsDNA and ssRNA viruses in water: UV fluences and a qPCR-based approach to evaluate decay on viral infectivity. Food Environ. Virol. 2014, 6, 260− 268. (33) Görner, H. Photochemistry of DNA and related biomolecules: Quantum yields and consequences of photoionization. J. Photochem. Photobiol., B 1994, 26, 117−139. (34) Dietrich, G. J.; Szpyrka, A.; Wojtczak, M.; Dobosz, S.; Goryczko, K.; Zakowski; Ciereszko, A. Effects of UV irradiation and hydrogen peroxide on DNA fragmentation, motility and fertilizing ability of rainbow trout (Oncorhynchus mykiss) spermatozoa. Theriogenology 2005, 64 (8), 1809−1822. (35) Peak, J. G.; Peak, M. J. Ultraviolet light induces double-strand breaks in DNA of cultured human P3 cells as measured by neutral filter elution. Photochem. Photobiol. 1990, 52 (2), 387−393. (36) Opel, K. L.; Chung, D.; McCord, B. R. A study of PCR inhibition mechanisms using real time PCR. J. Forensic Sci. 2010, 55 (1), 25−33. (37) Jung, D.; Cho, Y.; Meyer, J. N.; Giulio, R. T. Di. The long amplicon quantitative PCR for DNA damage assay as a sensitive method of assessing DNA damage in the environmental model, Atlantic killfish (Fundulus heteroclitus). 2010, No. 919, 1−13. (38) Jia, H.; Guo, Y.; Zhao, W.; Wang, K. Long-range PCR in nextgeneration sequencing: comparison of six enzymes and evaluation on the MiSeq sequencer. Sci. Rep. 2015, 4, 5737. (39) Zhuang, Y.; Ren, H.; Geng, J.; Zhang, Y.; Zhang, Y.; Ding, L.; Xu, K. Inactivation of antibiotic resistance genes in municipal wastewater by chlorination, ultraviolet, and ozonation disinfection. Environ. Sci. Pollut. Res. 2015, 22, 7037−7044. (40) Kadavy, D. R.; Shaffer, J. J.; Lott, S. E.; Thomas, A.; Bolton, C. E.; Gallimore, W. H.; Eugene, L.; Nickerson, K. W.; Kokjohn, T. A.; Wolf, T. A.; et al. Influence of infected cell growth state on bacteriophage reactivation levels. Society 2000, 66 (12), 5206−5212. (41) Albarracín, V. H.; Pathak, G. P.; Douki, T.; Cadet, J.; Borsarelli, C. D.; Gärtner, W.; Farias, M. E. Extremophilic Acinetobacter strains from high-altitude lakes in Argentinean puna: remarkable UV-B resistance and efficient DNA damage repair. Origins Life Evol. Biospheres 2012, 42 (2), 201−221.
(42) Norton, M. D.; Spilkia, A. J.; Godoy, V. G. Antibiotic resistance acquired through a DNA damage-inducible response in Acinetobacter baumannii. J. Bacteriol. 2013, 195 (6), 1335−1345. (43) Sinha, R. P.; Häder, D.-P. UV-induced DNA damage and repair: a review. Photochem. Photobiol. Sci. 2002, 1 (4), 225−236. (44) Brash, D. E.; Haseltine, W. A. UV-induced mutation hotspots occur at DNA damage hotspots. Nature 1982, 298 (5870), 189−192. (45) Sikorsky, J. A.; Primerano, D. A.; Fenger, T. W.; Denvir, J. Effect of DNA damage on PCR amplification efficiency with the relative threshold cycle method. Biochem. Biophys. Res. Commun. 2004, 323 (3), 823−830. (46) McDonald, J. P.; Hall, A.; Gasparutto, D.; Cadet, J.; Ballantyne, J.; Woodgate, R. Novel thermostable Y-family polymerases: Applications for the PCR amplification of damaged or ancient DNAs. Nucleic Acids Res. 2006, 34 (4), 1102−1111.
6192
DOI: 10.1021/acs.est.7b01120 Environ. Sci. Technol. 2017, 51, 6185−6192
