Delivery of Lipid Micelles into Infarcted Myocardium Using a Lipid

Feb 2, 2015 - RGD modified and PEGylated lipid nanoparticles loaded with puerarin: Formulation, characterization and protective effects on acute myoca...
5 downloads 0 Views 5MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Delivery of Lipid Micelles into Infarcted Myocardium Using a LipidLinked Matrix Metalloproteinase Targeting Peptide Juliane Nguyen,*,† Richard Sievers,‡ J. P. Michael Motion,§ Saul Kivimaë ,§ Qizhi Fang,‡ and Randall J. Lee*,‡ †

Department of Pharmaceutical Sciences, School of Pharmacy and Pharmaceutical Sciences, University at Buffalo, The State University of New York, Buffalo, New York 14214, United States ‡ Department of Medicine, Cardiovascular Research Institute, and Institute of Regeneration Medicine, University of CaliforniaSan Francisco, San Francisco, California 94143, United States § Department of Bioengineering and Therapeutic Sciences, University of CaliforniaSan Francisco, San Francisco, California 94143, United States ABSTRACT: There is a great need for delivery strategies capable of efficiently localizing drugs to the damaged myocardium that do not require direct intramyocardial injection of therapeutic molecules. In the work discussed here, we exploited the myocardium-specific upregulation of matrix metalloproteinases (MMPs) that occurs during myocardium remodeling by designing a micellar vehicle containing an MMP-targeting peptide (MMP-TP). The binding of MMP-TP to MMP was evaluated with purified MMP-2 protein and U-937 cells induced to overexpress MMP. Inhibition of MMP-2 activity was not observed in the presence of unmodified micelles but was pronounced at a 5 mol % MMP-TP ligand density. In a FACS analysis, MMP-TP micelles containing 5 mol % of the MMP-targeting peptide showed ∼10-fold higher binding to activated U937 cells than plain micelles and micelles containing a control peptide with two amino acid replacements. MMP-TP-micelles and plain micelles were injected intravenously into C57BL/6 mice 1, 3, and 7 days after the induction of a myocardial infarction (MI). Immunohistochemistry performed on heart tissue sections revealed that MMP-TP-micelles colocalize with both MMP and infiltrating macrophages. MMP-TP micelles showed significantly enhanced accumulation to the necrotic area of the heart after MI on days 3 and 7 when compared to plain micelles and negative control peptide micelles. This is coincident with the measured temporal profile of MMP gene expression in the heart after MI. These results suggest that MMP-TP micelles are candidates for the development of targeted regenerative heart therapeutics because of their ability to target the infarcted myocardium in a MMP dependent manner. KEYWORDS: myocardial infarction, matrix metalloproteinase, targeted micellar vehicles, drug targeting

■

INTRODUCTION

the solubility of hydrophobic drugs or protecting sensitive drugs from degradation,9,10 these carriers can extend circulation half-life and improve the accumulation of therapeutic compounds at the target area.11,12 Although there have been many recent clinically useful advances in nanomedicine (particularly for the treatment of cancer), efficient deposition of nanocarriers to the heart remains a challenge. This is partially due to the relatively low permeability of coronary blood vessels13 and the heart’s poor retention of therapeutic drugs due to the extremely high blood flow.14 A targeted delivery strategy to the heart could potentially overcome these obstacles. Because matrix metalloproteinases (MMPs) play an important role in myocardial remodeling and restructuring after MI,15 we decided to exploit the inflammatory processes

With an estimated mortality rate of 7.3 million per year, coronary heart disease (CHD), which includes myocardial infarction (MI) and myocardial ischemia, is the leading cause of death worldwide.1 Based on data from the 2011 National Health Interview Survey (NHIS) and the American Heart Association (AHA), a coronary event occurs every thirty-four seconds in the United States and results in approximately one death every minute.2 Despite improvements in revascularization strategies, there is an urgent need for improved CHD treatments. Many experimental strategies aimed at treating the infarcted heart involve direct intramyocardial injection of therapeutic drugs, stem cells, or drug delivery vehicles. Although this approach can provide localized treatment to the necrotic area, it is inefficient with a very low retention rate. Additionally, it is extremely invasive, requires trained surgical personnel with high associated costs, and there may be surgical complications.3,4 Systemically administered nanoscale drug carriers are a noninvasive alternative to surgical procedures.5−8 By improving © 2015 American Chemical Society

Received: Revised: Accepted: Published: 1150

September 28, 2014 December 16, 2014 February 2, 2015 February 2, 2015 DOI: 10.1021/mp500653y Mol. Pharmaceutics 2015, 12, 1150−1157

Article

Molecular Pharmaceutics

using a 70 min gradient from 20 to 100% acetonitrile (ACN) in the presence of 0.1 vol % trifluoroacetic acid (TFA). The MMP-TP-PEG-DSPE peak eluted at about 60% ACN. MALDITOF (Bruker Biosciences Corp., Billerica, MA) analysis showed a broad peak with average spacing of 44.2 g/mol and an average mass of 4400 g/mol, as expected. Sinapinic acid was used as the matrix. Preparation of Micellar Vehicles. Plain micelles, NCP micelles and MMP-TP micelles were prepared as follows: PEGDSPE/DiD (99.7/0.3), PEG-DSPE/Peptide-PEG-DSPE/DiD (94.7/5/0.3), or PEG-DSPE/Peptide-PEG-DSPE/DiD (96.7/ 3/0.3) were dried in a glass tube to a thin film and rehydrated in phosphate buffered saline (PBS). The lipid mixture was sonicated for 5 min at RT until all components were dispersed in the buffer. DiD is a fluorescent lipid (ex/em 644/665) that is incorporated into the lipid mixture for labeling. The particle sizes of the MMP-TP micelles, the plain micelles and NCP micelles were measured by dynamic light scattering (DLS) using the Nanobrook Omni (Brookhaven). The zeta potential of the micelles was determined using the Nanobrook Omni (Brookhaven) in phosphate buffered saline at pH 7.4. The following nomenclature is used for the formulations tested:

that occur during MI and design MMP-targeted micelles. MMPs belong to the family of zinc-dependent metalloendopeptidases that play an important role in the degradation of the extracellular matrix and tissue remodeling.16 MMPs are divided into subgroups based on their substrate specificity and structural similarity.17 Among the MMPs, MMP-2 and MMP-9 are key players in left ventricle remodeling; they are activated in the myocardium after an infarct and are responsible for the degradation of collagen, laminin, elastin, and fibronectin.18 Both of them contain type II fibronectin-like domains and have high substrate specificity for gelatinases.19 Thus, MMP-2 and MMP-9 are also known as gelatinases A and B. Studies have shown the importance of MMP-2 and MMP-9 in left ventricle remodeling after myocardial infarction. MMP-2 and MMP-9 knockout mice showed less adverse left ventricular remodeling and a higher survival rate after MI.20,21 Similar effects were observed when pharmacological inhibitors of MMP-2 or MMP9 were administrated post MI21,22 A major cellular source of MMPs are the macrophages that infiltrate the necrotic myocardium in a time-dependent manner as part of the inflammatory response to damaged and necrotic tissue. They synthesize MMPs and at the same time remove necrotic and apoptotic cardiomyocytes from the infarcted area.23 We, therefore, designed nanoscale carriers that could specifically accumulate in ischemic areas of the heart while sparing noninfarcted myocardium by exploiting the fact that MMPs are upregulated in the infarcted and border zones of the heart after MI.24 We designed carriers consisting of lipid micellar vehicles and an MMP-targeting peptide (MMP-TP) and tested these in vivo, hypothesizing that there would be specific accumulation of the lipid micelles in the necrotic areas of infarcted myocardium enriched in MMPs and macrophages.

MMP-TP M = MMP-TP Micelles NCP M = Negative Control Peptide Micelles Plain M = Plain Micelles Binding of MMP-TP Micelles to MMP-2. Binding of MMP-TP micelles to MMP-2 and inactivation of its protease activity were assayed using the SensoLyte 520 MMP-2 Activity Kit *Fluorimetric*. Briefly, MMP-2 was incubated with increasing concentrations of MMP-TP micelles for 10 min. Plain micelles were used as a control. Then, 50 μL of MMPsubstrate was added and the reagents were thoroughly mixed by shaking (for 15 s). The reaction was kept at 37 °C for 30 min. The fluorescence was measured at ex/em wavelengths of 490 nm/520 nm. Binding of MMP-TP Micelles to Activated U937 Cells. Flow cytometry was used to quantify the binding and internalization of rhodamine-labeled MMP-TP, plain micelles, and NCP micelles to U937 cells. U937 cells were activated with phorbol 12-myristate 13-acetate (PMA; 200 ng/mL) for 30 min,27 after which the medium was replaced with serum-free medium. Cells were incubated with micelles for 1 h, followed by thorough washing at least three times. Cells were trypsinized and resuspended in PBS. A total of 5000 cells were analyzed. Measurements were performed with a FACS-array cell sorter (BD Biosciences, Franklin Lakes, NJ) at ex/em wavelengths of 550 nm/575 nm. Flow cytometry data were analyzed with FlowJo software (Tree Star Inc., Ashland, OR). Experiments were performed in triplicate and data represented as mean ± SD. Myocardial Infarction. Myocardial infarcts were generated in male C57BL/6-mice (10−12 weeks) as described previously.28 Briefly, after anesthesia with isoflurane, mice were intubated and connected to a small animal volume control ventilator. After exposing the heart via sternotomy, the left anterior descending artery (LAD) was permanently occluded with a suture. The sternum incision was closed and the mice were allowed to recover. The study protocol was approved by the Committee for Animal Research of the University of California San Francisco (San Francisco, CA) and was performed in accordance with the recommendations of the

■

EXPERIMENTAL SECTION Materials. mPEG-DSPE and PEG-DSPE-succinyl were obtained from Avanti Polar Lipids (Alabaster, AL). The MMP-targeting peptide (NH2−GGGGCTTHWGFTLC− CONH2) and the negative control peptide (NCP) with two amino acid replacements (NH2−GGGGCTTHAGATLC− CONH2) were purchased from Abgent Inc. (San Diego, CA). Rat anti-mouse CD68 antibody was purchased from Abd Serotec Inc. (Raleigh, NC), and rabbit anti-mouse MMP2 antibody was obtained from Novus Biologicals (Oakville, ON). Mouse anti-troponin I antibody was obtained from Abcam (Cambridge, U.K.). Fluorescently labeled secondary antibodies (Alexa Fluor 488 and Alexa Fluor 555) were obtained from Molecular Probes (Eugene, OR). Micelles were labeled with 1,1-dioctadecyl-3,3,3,3-tetramethylindodicarbocyanine (DiD) with excitation/emission (ex/em) wavelengths of 644/665 nm from Invitrogen Life Technologies (Carlsbad, CA). Hoechst stain 33258 (ex/em 352/461 nm) (Invitrogen) was used to label nuclei. Synthesis of Lipid−Peptide Conjugate. The MMP-TPPEG-DSPE and NCP-PEG-DSPE conjugate was synthesized as follows: 35 μmol of PEG-DSPE-succinyl was dissolved in 2 mL of anhydrous N-methyl-2-pyrrolidone (NMP) and 0.5 mL of dichloromethane (DCM) and activated with 35 μmol of HOBT/HBTU/NMP at room temperature (RT) for 30 min. Then, 50 μmol of peptide (NH2−GGGGCTTHWGFTLC− CONH2 = MMP-TP or NH2−GGGGCTTHAGATLC− CONH2 = NCP)25,26 was added, and the reaction was continued for 24 h at RT under argon gas. MMP-PEG-DSPE was purified on a C4 semipreparative column at 3 mL/min 1151

DOI: 10.1021/mp500653y Mol. Pharmaceutics 2015, 12, 1150−1157

Article

Molecular Pharmaceutics

Figure 1. (A) MALDI-TOF spectrum for MMP-TP (black), (B) PEG-DSPE-succinyl (blue), and (C) MMP-TP PEG-DSPE (green) conjugate.

Histology and Microscopy. To determine (i) the distribution of the DiD-labeled micelles in the heart after systemic administration, (ii) the macrophage infiltration, and (iii) the overexpression of MMP after MI, immunofluorescence staining was performed. C57BL/6 mice were administered with DiD-labeled micelles 3 days after MI. Hearts were removed 5 h postadministration, washed with saline, and embedded immediately in OCT compound. Then, 10 μm sections of the hearts were prepared using a cryostat, mounted on glass slides, and fixed in −20 °C acetone for 5 min. After washing three times in PBS and blocking with Rodent Block (Biocare Medical, Concord, CA), sections were incubated with primary antibodies targeting macrophages (CD68), MMP-2, and troponin I at 1:100 dilution for 1 h at RT. Incubation with secondary antibodies (1:200 dilution) was for 1 h at RT. Nuclei were stained with Hoechst nuclear dye for 20 min. Cryosections were visualized with a widefield Nikon highthroughput 6D microscope using Plan Apo 10x/0.45 and 20x/ 0.75 objectives (Nikon, Tokyo, Japan). Image stitching was performed using NIS Elements 4.12 (Nikon). The Yokagawa CSU22 spinning disk confocal microscope (Yokagawa Electric, Tokyo, Japan) was used to acquire images with a Plan Apo VC 60x/1.4 oil objective. Fluorescence was detected with 405, 491, 594, and 640 nm lasers using ET460/50 m, ET 525/50m, and ET 645/65m emission wheels. Statistical Analyses. One-way analysis of variance (ANOVA) followed by Bonferroni posthoc tests for multiple group comparisons were used for analysis of the micelle deposition in the heart and colocalization studies. Data are represented as mean ± SD.

American Association for Accreditation of Laboratory Animal Care. Quantifying MMP-TP Micelles, NCP Micelles, and Plain Micelles in the Heart after MI. MMP-TP micelles composed of PEG-DSPE/MMP-TP-PEG-DSPE/DiD (94.7/5/ 0.3), NCP micelles composed of PEG-DSPE/NCP-PEGDSPE/DiD (94.7/5/0.3), and plain micelles composed of PEG-DSPE/DiD (99.7/0.3) were systemically administered into C57BL/6 mice (n = 4 per group) by tail vein injection at day 1, 3, and 7 post-MI. Five hours postadministration, the hearts were removed and homogenized by bead beating (Bead Beater, Biospec, Bartlesville, OK) at 5000 rpm in 90% isopropanol acidified with HCl. Samples were processed as previously described.29 Briefly, the homogenized heart samples were stored overnight at 4 °C to extract the DiD-labeled micelles. The samples were then centrifuged at 14 000 rpm for 15 min. The supernatant (300 μL) was transferred to a cuvette containing 1.7 mL of acidified isopropanol and C12E10. A calibration curve was prepared for DiD-labeled micelles in acidified alcohol. The fluorescence was measured using a Spex Fluorolog Fluorimeter (Horiba Scientific, Edison, NJ) at ex/em wavelengths of 644/665 nm. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR). MMP-9 and MMP-2 mRNA expression were measured by extracting total RNA from the heart using the RNeasy Mini Kit (Qiagen, Hilden, Germany). mRNA was reverse-transcribed into cDNA using the SuperScript III FirstStrand Synthesis System for RT-PCR using oligo(dT)20 primers (Invitrogen). RT-PCR was performed using the Stratagene Mx3005P thermal cycler using the Power SYBR Green PCR Master Mix (Invitrogen). The primers for β-actin were TGGAATCCTGTGGCATCCATGAAAC (forward) and TAAAACGCAGCTCAGTAACAGTCCG (reverse). The primers for MMP-2 were GACATACATCTTTGCAGGAGACAAG (forward) and TCTGCGATGAGCTTAGGGAAA (reverse). The primers for MMP-9 were CCTGGAACTCACACGACATCTTC (forward) and TGGAAACTCACACGCCAGAA (reverse).30 MMP-2 and MMP-9 mRNA expression levels were normalized to β-actin. Measurements were performed in triplicate and results are expressed as mean ± SD.

■

RESULTS Peptide-PEG Lipid Conjugate Analysis by MALDI-TOF. The identity of the purified MMP-TP PEG-DSPE conjugate was confirmed using MALDI-TOF (Figure 1). The peptide is shown in black with a peak at 1396 g/mol (Figure 1A). The blue line (Figure 1B) represents the unmodified PEG-DSPEsuccinyl with an average mass peak of 2500 g/mol. After attaching the MMP-targeting peptide to PEG-DSPE, the average mass peak shifted by ∼1400 g/mol to 3900 g/mol 1152

DOI: 10.1021/mp500653y Mol. Pharmaceutics 2015, 12, 1150−1157

Article

Molecular Pharmaceutics

Figure 2. (A) Inhibition of MMP-2 activity by MMP-TP micelles and plain micelles analyzed by a FRET-based assay. (B) and (C) Binding of MMPTP micelles, plain micelles, and NCP micelles to activated U937 cells (measured using flow cytometry). (D) Particle size and zeta potential of MMPTP micelles, NCP micelles, and plain micelles (PEG-DSPE micelles).

Figure 3. (A) MMP-9 and MMP-2 gene expression as a function of time after MI (measured using RT-PCR). (B) Accumulation of MMP-targeting micelles (MMP-TP M), plain micelles (Plain M), and negative control peptide micelles (NCP M) in the heart after MI. Statistical analyses were performed with one-way ANOVA followed by Bonferroni post hoc tests (****p < 0.001, ***p < 0.01).

MMP-expressing cell lines, such as HT1080 cells.32 The binding of MMP-TP micelles to U937 cells was dependent on the amount of targeting ligand incorporated into the micelles (Figure 2B, C). The highest binding was observed when the micelles were decorated with 5 mol % targeting ligand. MMPTP micelles showed ∼10-fold higher binding to activated U937 cells compared to plain micelles or NCP micelles. The binding decreased with decreasing amounts of targeting peptide. The NCP and plain micelles showed a slight increase (∼2-fold) in cell associated fluorescence compared to untreated cells. This is most likely due to nonspecific binding. MMP Upregulation after MI. Because the extent of targeting of MMP-TP micelles to the heart is likely to be dependent on local concentrations of MMP, we determined the degree of upregulation of MMP-2 and MMP-9 in the heart after MI using quantitative RT-PCR. MMP-9 was maximally expressed 3 days after MI with 4-fold upregulation compared to day 1 (Figure 3A). MMP-2 expression levels were significantly greater than MMP-9, and peaked 1 week after MI with 30-fold upregulation compared to day one (Figure 3A). This is in line with studies performed by Cleutjens et al. and Chen et al.30,33 They observed a similar time-dependent upregulation of MMP-9 and MMP-2 in the infarcted region of the myocardium. Expression levels reached a maximum at day 2

(Figure 1C). Both showed average spacing peaks of approximately 44.2 g/mol that are characteristic for PEG. Binding of MMP-TP Micelles to MMP-2. A FRET-based MMP-2 inhibition assay was next used to confirm that the MMP-TP was still active after coupling to PEG-DSPE and forming micelles. Micelles were generated as described under experimental methods. The MMP-TP micelles containing the targeting ligand show similar size and zeta potential compared to the micelles containing the negative control peptide (NCP micelles) and plain micelles that consisted of PEG-DSPE (Figure 2B). The activity of the MMP-MMP-TP micelles (IC50 of 10 μmol; Figure 2A) was comparable to the unmodified MMP-TP.31 Plain PEG-DSPE micelles (Plain M) did not inhibit the activity of MMP-2. The protease substrate was 100% cleaved when MMP-2 was incubated with plain micelles. Binding of MMP-TP Micelles to Activated Macrophages. Macrophages are a major source of MMPs after myocardial infarction,23 with MMPs both partially secreted and partially bound to the cell membrane. Because the necrotic heart is infiltrated with macrophages after MI, we investigated whether MMP-TP micelles were able to bind to PMA-activated macrophages. The U937 cell line was used as a model as it is able to produce MMP upon activation. Kinnunen and colleagues have reported binding of MMP-TP to other 1153

DOI: 10.1021/mp500653y Mol. Pharmaceutics 2015, 12, 1150−1157

Article

Molecular Pharmaceutics

Figure 4. Immunofluorescence microscopy showing that MMP-TP micelles colocalize with MMP-2 in the infarcted area of the heart. Analysis was performed at day 3 post-MI. (A) DiD labeled MMP-targeting peptide micelles (MMP-TP M), negative control peptide micelles (NCP M), and plain micelles (plain M) red, (B) MMP-2 labeled with Alexa Fluor 555, yellow (C) merged image, (D) colocalization was analyzed by ImageJ and shown as white pixels, (E). Comparison of the average Pearson correlation coefficient shows that there is significantly greater colocalization between MMPTP micelles and MMP-2 than plain micelles and NCP micelles. 1 = perfect correlation, 0 = no correlation, and −1 = perfect inverse correlation. Scale bar: 100 μm. Statistical analyses were performed with one-way ANOVA followed by Bonferroni posthoc tests (***p < 0.01).

Figure 5. Localization of MMP-targeting peptide micelles (MMP-TP M), negative control peptide micelles (NCP M), and plain micelles (plain M) in the heart on day three after MI. MMP-TP micelles accumulate in the necrotic areas of the heart, as shown by immunofluorescence staining. Images show areas of macrophage infiltration and MMP-TP micelle accumulation with (A) CD68 for macrophages, (B) DiD-labeled MMP-TP, NCP, and plain micelles, (C) nuclei stained with Hoechst, and (D) cardiomyocytes stained with troponin I: necrotic areas characterized by the absence in troponin I staining are indicated with white arrows. (E) Merged image displaying accumulation of MMP-TP in areas of macrophage infiltration. Scale bar: 100 μm.

to day 7 after MI. Using zymography studies they also showed that mRNA expression levels of MMP-9 and MMP-2 corresponds to their proteolytic activity.30,33 Accumulation of MMP-TP Micelles in the Heart. Systemic injection of MMP-TP micelles, NCP micelles, and plain micelles at day 1, day 3, and day 7 after MI resulted in 3fold and 2-fold increases in MMP-TP micelles in the heart compared to control on day 3 and 7, respectively (Figure 3B). There was no enhanced accumulation of MMP-TP micelles on the first day after MI, consistent with the measured temporal profile of MMP gene expression in the heart after MI (Figure

3A). There was an overall decrease in micelle accumulation on day 7 after MI. Colocalization of MMP-TP Micelles with MMP-2. Because MMP-TP micelles were able to bind to MMP-2 in vitro and to MMP-producing cells, we next determined their localization in vivo using immunofluorescence. MMP-2 was labeled with MMP-2 antibodies and the micelles labeled with DiD. Colocalization of MMP-TP micelles, plain micelles, and NCP micelles was analyzed by ImageJ (Figure 4). The Pearson correlation coefficient (PCC) was used to quantify the degree of colocalization between the micelles and MMP-2 across the 1154

DOI: 10.1021/mp500653y Mol. Pharmaceutics 2015, 12, 1150−1157

Article

Molecular Pharmaceutics

treatments are extremely short and in case of emergencies would need to be delivered very quickly for them to be effective. Here, driven by the finding that matrix metalloproteinases (MMPs) play a critical role in heart remodeling after MI,15 we designed nanocarriers that specifically target necrotic areas of the heart. By targeting MMP, as proposed in this study, it may be possible to deliver drug compounds to the ischemic area of the heart after MI with a larger therapeutic window. The MMP-TP micelles display dual functionality by binding to MMP and, at the same time, inhibiting protease activity of MMP (Figure 2). Thus, in future studies they could be used for selective inhibition of MMP after MI. Inhibition of MMP can prevent progression of left ventricle dilation and promote angiogenesis.22 The engineered MMP-TP micelles are able to accumulate in the infarcted area while sparing healthy tissue of the heart. Immunohistochemistry studies showed that MMP-TP micelles accumulate in areas where cardiomyocytes are undergoing necrosis as shown by loss of staining with troponin. MMP-TP micelles showed enhanced accumulation in the infarcted area of the heart compared to plain micelles. MMP-TP micelles colocalize with macrophages and MMP-2. Importantly, MMPTP micelles were not found in the intact (noninfarcted) heart tissue. This implies a high specificity in accumulation that may reduce undesired side-effects when delivering therapeutic drugs. The targeting of micelles to the infarcted area was timedependent. No micelles were observed immediately after MI on day one. This corresponds to the measured expression of MMPs, as determined by RT-PCR. As shown by other studies, the protein expression of MMP measured as proteolytic activity correlates well with the gene expression profile.30,33 There was increased accumulation of MMP-TP micelles on day 3 and day 7 after MI. The overall lower accumulation of micelles at day 7 is most likely caused by changes in perfusion and the regeneration of the leaky vasculature over time. Enhanced permeability for macromolecules caused by coronary vascular injury was reported to persist in the first few days after MI, with almost complete recovery within 1 week.39

entire cross-section of the heart. A PCC of 1 indicates perfect correlation, a PCC of 0 means no correlation, and a PCC of −1 means perfect inverse correlation.34,35 The PCC shows a significantly greater colocalization between MMP-TP micelles (PCC 0.65 ± 0.2) and MMP-2 as compared to plain micelles (PCC 0.09 ± 0.03) and NCP micelles containing the negative control peptide (PCC 0.07 ± 0.02). MMP-TP Micelles Accumulate in Areas of Ischemia. To understand the fate of MMP-TP micelles and NCP micelles after systemic administration, fluorescence imaging of immunohistochemically labeled tissue sections was used to localize the micelles in different areas of the heart. Cardiac troponin I antibody was used to visualize the cardiomyocytes and their integrity; areas of ischemia would be expected to contain necrotic cardiomyocytes without troponin expression. Histologically, infarcted areas were characterized by necrotic cardiomyocytes and the replacement of cardiomyocytes with inflammatory cells, particularly macrophages, as expected.36 In Figure 5D, necrotic areas are indicated with white arrows and confirmed by a lack of cardiac troponin expression. As shown in representative cryo-sections, targeting MMP-TP micelles only accumulated in infarcted areas (Figure 5B), and not to the intact (noninfarcted) areas of the heart (Figures 5 and 6); they were primarily localized to the same locations as

Figure 6. Cryosections showing the distribution of monocytes/ macrophages; CD68 (macrophages) (A), MMP-2 (yellow) (B), and MMP-TP micelles labeled with DiD (red) (C) in whole section images of the heart. Scale bar: 1000 μm.

accumulating macrophages. NCP micelles were also seen in the ischemic area of the heart; however, as shown by whole heart fluorescence quantification, the signal intensity was lower compared to MMP-TP micelles (Figures 3B and 5). MMP-TP targeting therefore has preferential localization. To demonstrate the distribution of MMP-TP micelles in the heart, whole-section imaging of the heart was performed. MMP-TP micelles were located in similar regions to infiltrating macrophages and MMP-2 (Figure 6).

■

CONCLUSION MMP-TP micelles can be intravenously delivered to specifically target infarcted areas of the heart. The MMP-TP micelles predominantly colocalize with MMP and infiltrating macrophages in necrotic areas. These carriers may therefore prove to be useful for cardiac regenerative therapy through delivery of reprogramming factors capable of genetically modifying macrophages and optimizing tissue remodeling.

■

DISCUSSION This study demonstrates that a micellar carrier that displays a MMP binding peptide on its surface has the ability to specifically target the injured myocardium. Further, it did this over 7 days after MI. This is significant because the time window to effectively deliver drug carriers to the infarcted myocardium is limited by two factors: (a) the low permeability of the vasculature for macromolecules and (b) the short-lived upregulation of cardiac markers (i.e., myosin and P-selectin) primarily found during the initial days after MI.37 Strategies using anti-P-selectin immunoliposomes for example have been reported to be effective only when administered within 1 h and 4 h after MI. At 24 h after MI, there was no enhanced accumulation of P-selectin immunoliposomes compared to nontargeted liposomes.38 Thus, the time span for these

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: julianen@buffalo.edu. Phone: 716-645-4817. Address: Department of Pharmaceutical Sciences, SUNY Buffalo, 303 Kapoor Hall Buffalo, New York 14214. *E-mail: [email protected]. Phone: 415-476-5708. Address: Cardiovascular Research Institute, University of CaliforniaSan Francisco, 500 Parnassus Avenue, San Francisco, California 94143. Notes

The authors declare no competing financial interest. 1155

DOI: 10.1021/mp500653y Mol. Pharmaceutics 2015, 12, 1150−1157

Article

Molecular Pharmaceutics

■

ACKNOWLEDGMENTS

■

REFERENCES

(17) Nagase, H.; Visse, R.; Murphy, G. Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc. Res. 2006, 69 (3), 562−573. (18) Matsumura, S.; Iwanaga, S.; Mochizuki, S.; Okamoto, H.; Ogawa, S.; Okada, Y. Targeted deletion or pharmacological inhibition of MMP-2 prevents cardiac rupture after myocardial infarction in mice. J. Clin. Invest. 2005, 115 (3), 599−609. (19) Massova, I.; Kotra, L. P.; Fridman, R.; Mobashery, S. Matrix metalloproteinases: structures, evolution, and diversification. FASEB J. 1998, 12 (12), 1075−1095. (20) Hayashidani, S.; Tsutsui, H.; Ikeuchi, M.; Shiomi, T.; Matsusaka, H.; Kubota, T.; et al. Targeted deletion of MMP-2 attenuates early LV rupture and late remodeling after experimental myocardial infarction. Am. J. Physiol.: Heart Circ. Physiol. 2003, 285 (3), H1229−1235. (21) Peterson, J. T.; Hallak, H.; Johnson, L.; Li, H.; O’Brien, P. M.; Sliskovic, D. R.; et al. Matrix metalloproteinase inhibition attenuates left ventricular remodeling and dysfunction in a rat model of progressive heart failure. Circulation 2001, 103 (18), 2303−2309. (22) Lindsey, M. L.; Gannon, J.; Aikawa, M.; Schoen, F. J.; Rabkin, E.; Lopresti-Morrow, L.; et al. Selective matrix metalloproteinase inhibition reduces left ventricular remodeling but does not inhibit angiogenesis after myocardial infarction. Circulation 2002, 105 (6), 753−758. (23) Vanhoutte, D.; Schellings, M.; Pinto, Y.; Heymans, S. Relevance of matrix metalloproteinases and their inhibitors after myocardial infarction: A temporal and spatial window. Cardiovasc. Res. 2006, 69 (3), 604−613. (24) Spinale, F. G. Myocardial matrix remodeling and the matrix metalloproteinases: influence on cardiac form and function. Physiol. Rev. 2007, 87 (4), 1285−1342. (25) Kormann, M. S.; Hasenpusch, G.; Aneja, M. K.; Nica, G.; Flemmer, A. W.; Herber-Jonat, S.; et al. Expression of therapeutic proteins after delivery of chemically modified mRNA in mice. Nat. Biotechnol. 2011, 29 (2), 154−157. (26) Reunanen, J.; Ranta, T. M.; Penate-Medina, O.; Suojanen, J.; Sorsa, T.; Salo, T.; et al. A chimera of green fluorescent protein with gelatinase binding and tumor targeting peptide. Protein Expression Purif. 2010, 72 (2), 234−237. (27) Hu, X.; Janssen, W. E.; Moscinski, L. C.; Bryington, M.; Dangsupa, A.; Rezai-Zadeh, N.; et al. An IkappaBalpha inhibitor causes leukemia cell death through a p38 MAP kinase-dependent, NFkappaB-independent mechanism. Cancer Res. 2001, 61 (16), 6290− 6296. (28) Takagawa, J.; Zhang, Y.; Wong, M. L.; Sievers, R. E.; Kapasi, N. K.; Wang, Y.; et al. Myocardial infarct size measurement in the mouse chronic infarction model: comparison of area- and length-based approaches. J. Appl. Physiol. 2007, 102 (6), 2104−2111. (29) Huang, Z.; Jaafari, M. R.; Szoka, F. C., Jr. Disterolphospholipids: nonexchangeable lipids and their application to liposomal drug delivery. Angew. Chem. 2009, 48 (23), 4146−4149. (30) Chen, J.; Tung, C. H.; Allport, J. R.; Chen, S.; Weissleder, R.; Huang, P. L. Near-infrared fluorescent imaging of matrix metalloproteinase activity after myocardial infarction. Circulation 2005, 111 (14), 1800−1805. (31) Koivunen, E.; Arap, W.; Valtanen, H.; Rainisalo, A.; Medina, O. P.; Heikkila, P.; et al. Tumor targeting with a selective gelatinase inhibitor. Nat. Biotechnol. 1999, 17 (8), 768−774. (32) Medina, O. P.; Soderlund, T.; Laakkonen, L. J.; Tuominen, E. K.; Koivunen, E.; Kinnunen, P. K. Binding of novel peptide inhibitors of type IV collagenases to phospholipid membranes and use in liposome targeting to tumor cells in vitro. Cancer Res. 2001, 61 (10), 3978−3985. (33) Cleutjens, J. P.; Kandala, J. C.; Guarda, E.; Guntaka, R. V.; Weber, K. T. Regulation of collagen degradation in the rat myocardium after infarction. J. Mol. Cell. Cardiol. 1995, 27 (6), 1281−1292. (34) Adler, J.; Parmryd, I. Quantifying colocalization by correlation: the Pearson correlation coefficient is superior to the Mander’s overlap coefficient. Cytometry, Part A 2010, 77 (8), 733−742.

We gratefully acknowledge the DFG (German Research Foundation, NG 103/1-1) (J.N.), NIH R01 EB003008 (J.P.M.), NIH-R01 GM061851 (S.K.) and the program for Biomedical Breakthrough at UCSF for funding. The authors wish to thank Dr. Francis Szoka (UCSF) for his helpful discussions during the project and his input in editing the manuscript. We thank Kurt Thorn and DeLaine Larsen for assistance with microscopy.

(1) Go, A. S.; Mozaffarian, D.; Roger, V. L.; Benjamin, E. J.; Berry, J. D.; Borden, W. B.; et al. Heart Disease and Stroke Statistics2013 Update: A Report From the American Heart Association. Circulation 2013, 127 (1), e6−e245. (2) World Health Organization. Cardiovascular Diseases (CVDs). http://www.who.int/mediacentre/factsheets/fs317/en/ (accessed Dec 2014). (3) Miyagi, Y.; Zeng, F.; Huang, X. P.; Foltz, W. D.; Wu, J.; Mihic, A.; et al. Surgical ventricular restoration with a cell- and cytokine-seeded biodegradable scaffold. Biomaterials 2010, 31 (30), 7684−7694. (4) Ravichandran, R.; Venugopal, J. R.; Sundarrajan, S.; Mukherjee, S.; Ramakrishna, S. Minimally invasive cell-seeded biomaterial systems for injectable/epicardial implantation in ischemic heart disease. Int. J. Nanomed. 2012, 7, 5969−5994. (5) Dvir, T.; Bauer, M.; Schroeder, A.; Tsui, J. H.; Anderson, D. G.; Langer, R.; et al. Nanoparticles targeting the infarcted heart. Nano Lett. 2011, 11 (10), 4411−4414. (6) Khan, R. S.; Martinez, M. D.; Sy, J. C.; Pendergrass, K. D.; Che, P. L.; Brown, M. E.; et al. Targeting extracellular DNA to deliver IGF-1 to the injured heart. Sci. Rep. 2014, 4, 4257. (7) Torchilin, V. P.; Narula, J.; Halpern, E.; Khaw, B. A. Poly(ethylene glycol)-coated anti-cardiac myosin immunoliposomes: factors influencing targeted accumulation in the infarcted myocardium. Biochim. Biophys. Acta 1996, 1279 (1), 75−83. (8) Verma, D. D.; Hartner, W. C.; Levchenko, T. S.; Bernstein, E. A.; Torchilin, V. P. ATP-loaded liposomes effectively protect the myocardium in rabbits with an acute experimental myocardial infarction. Pharm. Res. 2005, 22 (12), 2115−2120. (9) Nguyen, J.; Reul, R.; Roesler, S.; Dayyoub, E.; Schmehl, T.; Gessler, T.; et al. Amine-modified poly(vinyl alcohol)s as non-viral vectors for siRNA delivery: effects of the degree of amine substitution on physicochemical properties and knockdown efficiency. Pharm. Res. 2010, 27 (12), 2670−2682. (10) Nguyen, J.; Steele, T. W.; Merkel, O.; Reul, R.; Kissel, T. Fast degrading polyesters as siRNA nano-carriers for pulmonary gene therapy. J. Controlled Release 2008, 132 (3), 243−251. (11) Lee, R. J.; Fang, Q.; Davol, P. A.; Gu, Y.; Sievers, R. E.; Grabert, R. C.; et al. Antibody targeting of stem cells to infarcted myocardium. Stem Cells 2007, 25 (3), 712−717. (12) Mihardja, S. S.; Gao, D.; Sievers, R. E.; Fang, Q.; Feng, J.; Wang, J.; et al. Targeted in vivo extracellular matrix formation promotes neovascularization in a rodent model of myocardial infarction. PLoS One 2010, 5 (4), e10384. (13) Horwitz, L. D.; Kaufman, D.; Keller, M. W.; Kong, Y. O. TimeCourse of Coronary Endothelial Healing after Injury Due to Ischemia and Reperfusion. Circulation 1994, 90 (5), 2439−2447. (14) Wexler, L.; Bergel, D. H.; Gabe, I. T.; Makin, G. S.; Mills, C. J. Velocity of blood flow in normal human venae cavae. Circ. Res. 1968, 23 (3), 349−359. (15) Phatharajaree, W.; Phrommintikul, A.; Chattipakorn, N. Matrix metalloproteinases and myocardial infarction. Can. J. Cardiol. 2007, 23 (9), 727−733. (16) Stamenkovic, I. Extracellular matrix remodelling: the role of matrix metalloproteinases. J. Pathol. 2003, 200 (4), 448−464. 1156

DOI: 10.1021/mp500653y Mol. Pharmaceutics 2015, 12, 1150−1157

Article

Molecular Pharmaceutics (35) Hoffert, J. D.; Nielsen, J.; Yu, M. J.; Pisitkun, T.; Schleicher, S. M.; Nielsen, S.; et al. Dynamics of aquaporin-2 serine-261 phosphorylation in response to short-term vasopressin treatment in collecting duct. Am. J. Physiol.: Renal Physiol. 2007, 292 (2), F691− 700. (36) Naresh, N. K.; Xu, Y.; Klibanov, A. L.; Vandsburger, M. H.; Meyer, C. H.; Leor, J.; et al. Monocyte and/or Macrophage Infiltration of Heart after Myocardial Infarction: MR Imaging by Using T1shortening Liposomes. Radiology 2012, 264 (2), 428−435. (37) Kemp, M.; Donovan, J.; Higham, H.; Hooper, J. Biochemical markers of myocardial injury. Br. J. Anaesth. 2004, 93 (1), 63−73. (38) Scott, R. C.; Wang, B.; Nallamothu, R.; Pattillo, C. B.; Perez-Liz, G.; Issekutz, A.; et al. Targeted delivery of antibody conjugated liposomal drug carriers to rat myocardial infarction. Biotechnol. Bioeng. 2007, 96 (4), 795−802. (39) Horwitz, L. D.; Kaufman, D.; Keller, M. W.; Kong, Y. Time course of coronary endothelial healing after injury due to ischemia and reperfusion. Circulation 1994, 90 (5), 2439−2447.

1157

DOI: 10.1021/mp500653y Mol. Pharmaceutics 2015, 12, 1150−1157