Dendrimer-Functionalized Self-Assembled Monolayers as a Surface

thickness of the AUT SAM base layer on the gold substrates was determined to ... capacity, compared to AUT SAM sensor surfaces without dendrimer molec...
0 downloads 0 Views 213KB Size
Download PDF
6808

Langmuir 2004, 20, 6808-6817

Dendrimer-Functionalized Self-Assembled Monolayers as a Surface Plasmon Resonance Sensor Surface Sonny S. Mark,*,† Neelakantapillai Sandhyarani,‡,§ Changcheng Zhu,‡ Christine Campagnolo,† and Carl A. Batt‡ Department of Microbiology and Department of Food Science, Cornell University, Ithaca, New York 14853 Received February 23, 2004. In Final Form: May 21, 2004 We report here a multistep route for the immobilization of DNA and proteins on chemically modified gold substrates using fourth-generation NH2-terminated poly(amidoamine) dendrimers supported by an underlying amino undecanethiol (AUT) self-assembled monolayer (SAM). Bioactive ultrathin organic films were prepared via layer-by-layer self-assembly methods and characterized by fluorescence microscopy, variable angle spectroscopic ellipsometry, atomic force microscopy (AFM), X-ray photoelectron spectroscopy (XPS), and attenuated total internal reflection Fourier transform infrared spectroscopy (ATR-FTIR). The thickness of the AUT SAM base layer on the gold substrates was determined to be 1.3 nm from ellipsometry. Fluorescence microscopy and AFM measurements, in combination with analyses of the XPS/ATR-FTIR spectra, confirmed the presence of the dendrimer/biopolymer molecules on the multilayer sensor surfaces. Model proteins, including streptavidin and rabbit immunoglobulin proteins, were covalently attached to the dendrimer layer using linear cross-linking reagents. Through surface plasmon resonance measurements, we found that sensor surfaces containing a dendrimer layer displayed an increased protein immobilization capacity, compared to AUT SAM sensor surfaces without dendrimer molecules. Other SPR studies also revealed that the dendrimer-based surfaces are useful for the sensitive and specific detection of DNADNA interactions. Significantly, the multicomponent films displayed a high level of stability during repeated regeneration and hybridization cycles, and the kinetics of the DNA-DNA hybridization process did not appear to be influenced by surface mass transport limiting effects.

I. Introduction Within the past few years, the use of optical evanescent wave-based analytical instruments such as surface plasmon resonance (SPR) biosensors to study macromolecular interactions has become popular.1 SPR is an optoelectronic phenomenon arising from the total internal reflection of light at a surface coated with a conductive metal film. At a specific angle of incidence (“resonance angle”) the polarized light couples into a surface plasmon mode; at this angle, the reflectance from the surface will be a minimum. The resonance angle strongly depends on the local refractive index of the medium in close proximity to the metal surface, and this dependence opens a way to study macromolecular interactions in a sensitive manner. To date, SPR biosensors have been used for the real time and label-free detection of many types of biomolecular recognition phenomena1 including small analyte/ligandreceptor interactions, protein-protein interactions, protein-DNA interactions, and DNA-DNA hybridizations. A powerful technique, SPR allows accurate measurement of both kinetic rate constants as well as equilibrium affinity constants for a given ligand-target reaction. In commercially developed analytical systems, experiments are usually performed using disposable chips, with a protein ligand (or DNA probe) immobilized on the sensor chip while buffer containing the target binding partner (analyte) continuously flows over the surface. We report here the fabrication of two-dimensional, activated poly(amidoamine) (PAMAM) dendrimer films * Corresponding author. Phone: 607 255-7902. Fax: 607 2558741. E-mail: [email protected]. † Department of Microbiology. ‡ Department of Food Science. § Present address: Birla Institute of Technology & Science, Pilani, Rajasthan 333031, India. (1) Homola, J. Anal. Bioanal. Chem. 2003, 377, 528-39.

on gold surfaces for the immobilization of proteins and DNA for SPR studies. The use of prefabricated (“Starburst”) dendrimer macromolecules, instead of in situ generated dendritic macromolecules, was chosen in order to obtain a sensor surface with a well-defined theoretical structure that would simplify interpretation of the thin-film characterization data. Dendrimers are highly branched, nearly size monodisperse polymers possessing a very well defined molecular architecture constructed around a multifunctional central core via iterative, or stepwise, chemical synthesis methods.2,3 Of particular importance, the synthetic procedures developed for the preparation of PAMAM dendrimers permit nearly complete control over critical molecular design parameters (CMDPs), such as size, shape, surface/interior chemistry, and topology.4 Furthermore, functional groups found on the surface of such dendrimers tend to show remarkably higher chemical reactivity in comparison to their activity when present in other macromolecules.5 Recently, new perspectives for the development of novel enzyme/protein immobilization strategies for biosensor applications were opened in connection with a report on the use of SAMs of amine-terminated Generation 4 (G4NH2) PAMAM dendrimers directly adsorbed onto gold substrates as an immobilization matrix for glucose oxidase (GOX) in an amperometric-based device for glucose detection.6 Regarding the immobilization of nucleic acids for DNA microarray applications, Benters and co-work(2) Tomalia, D. A.; Nalor, A. M.; Goddard, W. A., III Angew. Chem., Int. Ed. Engl. 1990, 29, 138-175. (3) Esfand, R.; Tomalia, D. A. Drug Discovery Today 2001, 6, 427436. (4) C¸ agin, T.; Wang, G.; Martin, R.; Breen, N.; Goddard, W. A., III Nanotechnology 2000, 11, 77-84. (5) Singh, P. Bioconjugate Chem. 1998, 9, 54-63. (6) Svobodova´, L.; Sˇ nejda´rkova´, M.; Hianik, T. Anal. Bioanal. Chem. 2002, 373, 735-741.

10.1021/la0495276 CCC: $27.50 © 2004 American Chemical Society Published on Web 06/29/2004

SPR Sensor Surface

ers7,8 have reported on the generation of a novel linker system comprising PAMAM dendrimers covalently linked to planar glass substrates. Specifically, G4 dendrimers originally containing primary amino groups are first covalently attached to silylated glass supports and, subsequently, the dendrimers are modified with glutaric anhydride and activated with N-hydroxysuccinimide. This linker system was shown to give a very high immobilization efficiency for amino-modified DNA oligomers; in addition, DNA microarrays prepared by using the dendritic chemistry displayed a remarkably high level of stability during repeated regeneration and rehybridization cycles. In the present paper, a multilayered organic thin film fabricated on a gold surface with the incorporation of amino-terminated G4 PAMAM dendrimers is examined as a prototypical SPR biosensor matrix. As part of these exploratory studies, we examined the nucleic acid hybridization characteristics of a single-stranded 20-mer oligonucleotide probe covalently immobilized onto a dendrimer surface. In addition, we also investigated the application of dendrimer-based surfaces for the immobilization of model proteins such as IgG antibodies and streptavidin. Streptavidin was chosen for study since it is one of the most prevalent and important proteins used in current affinity-based diagnostics and separations technologies. The studies described herein demonstrate that it is feasible to synthesize stable, covalently linked dendrimer-based SPR sensor matrixes that (1) permit increased ligand immobilization capacity and (2) can be used for the specific and sensitive detection of both protein-protein and DNA-DNA interactions.

Langmuir, Vol. 20, No. 16, 2004 6809 wafers (see Supporting Information). Gold sensor chips for SPR experiments were prepared by sequential electron-beam evaporation of 1 nm chromium followed by 50 nm of high-purity gold onto BK7 glass microscope slides obtained from Fisher Scientific (Pittsburgh, PA). The glass slides were precleaned with piranha solution for 30 min, rinsed and sonicated (10 min) in DI H2O, and then transferred to the evaporation setup. After metal evaporation, the substrates were cut into 12.5 × 12.5 mm pieces with a diamond-tipped stylus and stored in a desiccator at room temperature. Before these gold surfaces were modified with the dendrimer immobilization chemistry, the blank SPR chips were cleaned with acetone (15 min) and ethanol (15 min) and rinsed in DI H2O. (3) DNA Oligonucleotides and Proteins. Nonlabeled streptavidin and tetramethylrhodamine-conjugated streptavidin were both purchased from Molecular Probes (Eugene, OR). Rabbit immunoglobulin G (IgG) protein and anti-streptavidin antibody were obtained from Sigma Chemical Co. (St. Louis, MO). All modified and unmodified DNA oligonucleotides were HPLCpurified and purchased from Integrated DNA Technologies, Inc. (Coralville, IA). The 20-base probe DNA oligomer used for immobilization was modified with an Amino Modifier C6 [-(CH2)6-NH2] group at the 5′ end. For the fluorescence microscopy experiments, an additional TAMRA-CPG fluorescent dye label was also added at the 3′ end of the probe oligomers. The sequence of the probe DNA was: 5′ GAAGATCGCACTCCAGCCAG 3′. For the DNA hybridization studies, two different 30base target DNA oligomers were used (both unmodified). Their sequences are as follows:

complementary target DNA: 5′ TGTACCGTACCTGGCTGGAGTGCGATCTTC 3′ noncomplementary target DNA: 5′ GGGAAAAGGGATCCGAAAAAAAGGGGTACG 3′

II. Experimental Section Materials. (1) Reagents and Other Chemicals. The following chemicals were used as received: 11-amino-1-undecanethiol, hydrochloride (AUT; >99% purity) was purchased from Dojindo Laboratories (Kumamoto, Japan). Ethylenediamine (EDA) core poly(amidoamine) (PAMAM Starburst) dendrimers (Generation 4 with 64 surface primary amino groups; 14 215 MW) were obtained from Aldrich Chemical Co. (Milwaukee, WI) as a 10% (w/w) (≈5.7 mM) stock solution in methanol. The solutions were stored at 4 °C and used as received. Bis[sulfosuccinimidyl]suberate (BS3) and EZ-Link sulfo-NHS-LCbiotin were purchased from PierceEndogen (Rockford, IL). All aqueous solutions were prepared by using reagent grade (18 MΩ cm resistivity) deionized water (DI H2O) purchased from Stephens Scientific Co. (Riverdale, NJ). Unless stated otherwise, all other reagents were of analytical grade or better, were purchased either from Aldrich Chemical Co. (Milwaukee, WI) or from Sigma Chemical Co. (St. Louis, MO), and were used as received without further purification. (2) Gold Substrates. Gold-patterned silicon (Si) substrates for the fluorescence microscopy studies were prepared by using standard photolithography and microfabrication techniques (see Supporting Information). Nonpatterned gold substrates for the ellipsometry, attenuated total internal reflection Fourier transform infrared (ATR-FTIR) spectroscopy, and X-ray photoelectron spectroscopy (XPS) studies were prepared by sequential electronbeam evaporation of 20 nm of chromium followed by 200 nm of high-purity gold onto clean, polished Si wafers. Before these gold surfaces were modified with dendrimer immobilization chemistry, the substrates were cleaned with piranha etch solution (7:3 v/v H2SO4/30% H2O2) for 30 min and rinsed several times in DI H2O. (CAUTION: piranha solution is a powerful oxidizing agent and reacts violently with organic compounds.) Template stripped gold (TSG) substrates9 for the atomic force microscopy (AFM) studies were prepared by electron-beam evaporation of 200 nm on Si (7) Benters, R.; Niemeyer, C. M.; Wo¨hrle, D. ChemBioChem 2001, 2, 686-694. (8) Benters, R.; Niemeyer, C. M.; Drutschmann, D.; Blohm, D.; Wo¨hrle, D. Nucleic Acids Res. 2002, 30, e10.

Analyses of the above DNA sequences using the mFold 3.0 software program (available through the IDT, Inc., Internet web site at: http://www.idtdna.com/biotools/mfold/mfold.asp) revealed that none of the oligonucleotides possessed ∆G values for spontaneous hairpin formation lower than -2.27 kcal mol-1 under ionic strength conditions of 320 mM Na+ and a temperature of 25 °C (corresponding to typical conditions used in our experiments when monitoring DNA hybridizations with SPR). Surface Modifications. (1) Fabrication of Amino Undecanethiol SAMs on Gold Surfaces. The amino undecanethiol (AUT) self-assembled monolayers (SAMs) were formed on the gold surfaces by incubating the substrates in 1 mM ethanolic solutions of the thiol compound between 18 and 22 h (room temperature, no agitation). Although 10-12 h is usually sufficient for chemisorption of thiol compounds onto gold surfaces,10 a longer incubation time was used here in order to allow the molecular films to self-assemble into a crystalline-like solid phase and also to allow desorption of any physisorbed and chemisorbed contaminants from the gold surface into the solution phase. Upon removal from the ethanol/thiol solutions, the gold substrates were rinsed repeatedly in excess ethanol and blown dry in a stream of nitrogen gas. AUT SAM-modified substrates were then used immediately for fabrication of the PAMAM dendritic linker systems. (2) Fabrication of PAMAM Dendritic Linker System on AUT SAM-Modified Gold Surfaces. Gold surfaces with the AUT SAM were activated by incubating the substrates in a 10 mM solution of BS3 in PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4‚7H2O, 1.4 mM KH2PO4, pH 7.2) for 30 min at room temperature. The BS3-activated SAMs were washed with DI H2O and blown dry with nitrogen. Subsequently, the substrates were incubated overnight in a 10% (w/w) methanolic solution of the PAMAM dendrimers. The substrates were then washed with methanol to remove excess dendrimers and blown dry with a nitrogen stream. (9) Wagner, P.; Hegner, M.; Guntherodt, H.-J.; Semenza, G. Langmuir 1995, 11, 3867-3875. (10) Ulman, A. Chem. Rev. 1996, 96, 1533-1554.

6810

Langmuir, Vol. 20, No. 16, 2004

(3) Covalent Attachment of DNA and Proteins to Dendrimer-Modified Gold Surfaces. For the immobilization of proteins, the dendrimer-coated substrates were incubated in 10 mM BS3 (in PBS, 30 min), rinsed with DI H2O, and dried under nitrogen. Following this, the substrates were treated with a protein solution (5 µM in PBS, pH 7.2) for 2 h at room temperature, rinsed with PBS and then DI H2O, and dried under nitrogen. In the case of streptavidin, 10 mM sulfo-NHS-LC-biotin (in PBS, 1 h) was used in selected cases instead of BS3 to bind the protein to the dendrimer surface. For the attachment of DNA molecules, the dendrimer layer was first activated with 10 mM BS3 (in PBS, 30 min), rinsed with DI H2O, and blown dry with nitrogen. Subsequently, the activated substrates were covered with a solution of probe DNA oligomer (50 µM in DI H2O) and incubated 12-16 h at room temperature. Quenching of any remaining reactive NHS esters was carried out by incubating the derivatized substrates in 50 mM Tris (pH 7.5) for 15 min at room temperature. After being rinses with DI H2O, the substrates were blown dry under nitrogen and used for the SPR studies or stored at 4 °C in a desiccator. Instrumentation Setup for Surface Analyses. (1) Fluorescence Microscopy Imaging. Fluorescence microscopy of dendrimer-immobilized biomolecules on gold-patterned silicon substrates was performed on a Nikon Labophot-2 microscope (Nikon Inc., Melville, NY) equipped with a Peltier thermoelectriccooled CCD camera (Diagnostic Instruments Inc., Sterling Heights, MI). Images were acquired (10-s exposure) using the SPOT RT Software version 3.1 (Diagnostic Instruments). (2) Atomic Force Microscopy Imaging. A Dimension 3100 AFM (Digital Instruments, Santa Barbara, CA) equipped with a Nanoscope IIIa controller and Type DP14 HI’RES silicon tips (MikroMasch USA, Portland, OR; manufacturer’s stated typical radius of curvature is e1 nm) was used for the topographic imaging of gold surfaces modified with the dendritic linker chemistry. The Nanoscope IIIa software (version 4.42r1) was used to process/analyze the resulting tapping mode images offline. In AFM, topographical height imaging of globular objects generally results in bell-shaped profiles; in the current study, the apparent diameter of an object was determined as the width of its bell-shaped image measured at half-height. The root-meansquare (rms) roughness (Rq) and mean roughness (Ra) parameters11 were calculated by analyzing selected regions of interest (ROIs) within each scanned image; for each sample, the mean ( standard deviation values derived from measurements of three nonoverlapping areas (250 × 250 nm) are reported. (3) Ellipsometry. The ellipsometric thickness of the AUT SAM assembled onto gold substrates (2.54 × 2.54 cm) was estimated using a vacuum ultraviolet variable angle spectroscopic ellipsometer (VUV-VASE, J.A. Woollam Co., Inc., Lincoln, NE). Measurements were performed using a range of wavelengths (400-1700 nm) and multiple angles of incidence (70°, 75°, 80°). The ellipsometric parameters Ψ and ∆ were determined for both the bare clean substrate and the self-assembled films. The WVASE program (version 3.416z, J.A. Woollam) was employed for data analysis and the determination of thickness values. For the AUT SAMs, the refractive index of the organic film was modeled using a Cauchy dispersion relationship.12 (4) X-ray Photoelectron Spectroscopy. XPS spectra of the thin-film samples were obtained using an Axis Ultra spectrometer (Kratos Analytical, Inc., Chestnut Ridge, NY) equipped with a monochromatized Al KR X-ray radiation source (photon energy 1486.6 eV). A takeoff angle of 45° was used for all measurements. The typical X-ray spot size was 700 × 350 µm. XPS quantification was performed by applying the appropriate relative sensitivity factors for the Kratos instrument to the integrated peak area data. For each sample an initial survey scan was performed, followed by high-resolution scans of the Au 4f, N 1s, S 2p, C 1s, O 1s, and P 2p regions. All binding energies were referenced with respect to the Au 4f7/2 peak energy of 84.0 eV. (5) Attenuated Total Reflection Fourier Transform Infrared Spectroscopy. ATR-FTIR measurements were per(11) Veiseh, M.; Zareie, M. H.; Zhang, M. Langmuir 2002, 18, 66716678. (12) Tompkins, H. G.; McGahan, W. A. Spectroscopic Ellipsometry and Reflectometry: a User’s Guide; John Wiley: New York, 1999.

Mark et al. formed on an Equinox 55 FTIR spectrometer (Bruker Optics Inc., Billerica, MA) equipped with a germanium crystal based ATR accessory unit and a liquid nitrogen cooled CCD detector. For each sample, a total of 1064 scans were taken at a resolution of 2 cm-1. A clean, unreacted gold-coated silicon wafer was used to acquire the background spectrum. All spectra were collected in the absorbance mode. Biospecific Interaction Analysis using Surface Plasmon Resonance. SPR measurements were performed on a model AR700 BioRefractometer Instrument (Reichert, Inc., Depew, NY). The adsorption of biomolecules to the sensor surface resulted in a shift in the resonance angle/refractive index that was reported in pixel units, where a change in one pixel unit corresponds to a change in refractive index (RI) of approximately 10-6 RI units. The change in pixel units as a function of time was monitored in real time using the SPR instrument’s custom LabVIEW-based software program, and the data were plotted using the Origin 5.0 software program (Microcal, Northampton, MA) to give a sensorgram profile. Typically, the biomolecular interaction experiments (25 °C) were carried out in buffer for 15 min using a constant flow rate of 180 µL min-1. For investigations of protein-protein interactions, PBST (PBS plus 0.05% v/v Tween 20) was used as both the sample and wash buffers. For the DNADNA hybridization experiments, the sample and wash buffers were typically both 2x SSPE (300 mM NaCl, 20 mM NaH2PO4, 2 mM EDTA, pH 7.4)/0.2% (w/v) SDS (sodium dodecyl sulfate)/ 8.3% (v/v) Liquid Block (Amersham Biosciences Corp., Piscataway, NJ). The protein-derivatized surfaces were regenerated after each binding experiment using 40 mM NaOH, whereas the DNA-derivatized surfaces were regenerated using 8.3 M urea after each hybridization experiment.

III. Results and Discussion The approach we used in this work to generate a biosensor matrix suitable for immobilizing native proteins and amino-modified oligonucleotides for study by SPR is outlined in Figure 1. An anchoring base layer SAM was first prepared by immersing the gold-coated glass substrates overnight in a solution of AUT. After being rinsed with ethanol and dried under a nitrogen stream, the substrates were activated with BS3, a water-soluble, noncleavable cross-linker with amino-reactive groups at both ends. The surfaces were then exposed to a methanolic solution of G4-PAMAM dendrimers overnight and rinsed in ethanol. For the preparation of the nucleic acid sensor surfaces, a second round of activation with BS3 was carried out in order to covalently immobilize amino-modified probe DNA oligonucleotides to the dendrimer layer. For the fabrication of the protein sensor surfaces, model proteins were typically linked to the dendrimer layer via BS3. However, because of its well-known rapid and almost irreversible binding to biotin-linked molecules,13 streptavidin protein was in selected cases linked to the dendrimer layer using sulfo-NHS-LC-biotin instead of BS3. Fluorescence Microscopy Studies. In our preliminary characterization studies of the multicomponent films using fluorescence microscopy, dendrimer-modified AUT monolayers were initially prepared on a gold-patterned silicon substrate. The surfaces were further modified with either BS3 or sulfo-NHS-LC-biotin. Tetramethylrhodaminelabeled streptavidin was then immobilized onto the biotin surfaces, whereas TAMRA-labeled amino-modified DNA oligomers were attached to the BS3-activated surfaces. After the surfaces were washed to remove any loosely bound biomolecules, the fluorescence from the surfaces was recorded in air using a fluorescence microscope setup. In both the protein and DNA cases, relatively strong fluorescence was observed mostly at locations corre(13) Green, N. M., Avidin and Streptavidin. In Methods in Enzymology; Wilchek, M., Bayer, E. A., Eds.; Academic Press: New York, 1990; Vol. 184, pp 51-67.

SPR Sensor Surface

Langmuir, Vol. 20, No. 16, 2004 6811

Figure 1. Schematic representation of the general procedure for immobilizing proteins or DNA on gold surfaces using a monolayer of amino-terminated PAMAM dendrimer molecules as an intermediate coupling layer. (Molecules are not drawn to scale.) For the immobilization of streptavidin protein (surface 7), sulfo-NHS-LC-biotin was used in selected experiments (instead of a second round of activation with BS3, as shown) to attach the protein to the underlying dendrimer layer.

sponding to the gold-patterned areas of the silicon wafer substrate (see Supporting Information, Figure S1). In some of the areas without any gold pattern, there were less intense fluorescence signals arising from small levels of nonspecific binding of biomolecules to the substrate. The fluorescent images thus demonstrate that the DNA and protein ligand molecules were successfully immobilized at the appropriate areas of the metal-patterned silicon substrate. Further analyses were conducted to verify that other components of the multilayer film were also present. Ellipsometry. VUV-VASE measurements were taken from 146 to 1700 nm (0.73 to 8.5 eV) and at multiple angles of incidence (70°-80° in increments of 5°). Measurement at multiple angles generally improves confidence, as light travels different paths through the sample film.14 To estimate the AUT SAM thickness, analysis of the VUV data was limited to wavelengths >400 nm as the AUT molecules that comprise the monolayer should be optically transparent in this region of the spectrum.15 The results of theoretical modeling studies to fit the raw experimental data (Ψ and ∆) suggest that the optical thickness of the SAM is 13.0 Å (see Supporting Information, Figure S2). The 90% confidence limits for the calculated thickness value were determined to be (0.2 Å. The measured value of 13.0 Å obtained in this study for the thickness of the AUT SAM is within the range of

ellipsometric thickness values that Bain and co-workers16 have observed previously for monolayers of similar-sized n-alkanethiols (i.e., CH3(CH2)xSH with x ) 11) on gold. Assuming that the AUT in our case is tilted by 30° from the surface normal with a trans (“zigzag”) conformation as is typically the case for aliphatic monothiolate SAMs on gold,10 the thickness of a fully covered AUT monolayer is estimated to be 17.5 Å using known bond lengths (obtained from ref 17), an average tetrahedral bond angle of 109.5°, and a value of 1.5 Å as the approximate distance between the sulfur atom and the gold surface.16 The present thickness measurement value thus suggests that a single monolayer of AUT molecules is assembled on the gold substrates when a 1 mM AUT ethanolic solution is used as the adsorption medium. AFM. Atomic force microscopy images of dendrimermodified TSG surfaces were recorded in order to characterize in further detail the surface morphology of the multicomponent films (see Supporting Information, Figure S3). The resulting topographic images were primarily used as a qualitative tool to address the spatial distribution and degree of ordering of the dendrimer macromolecues and DNA/proteins on the sensor surface. Upon modification of a TSG surface with both the AUT SAM and dendrimer layers, the surface becomes much rougher than the bare TSG surface. In particular, a large number of globular-shaped, randomly distributed particles with a

(14) Bu-Abbud, G. H.; Bashara, N. M.; Woollam, J. A. Thin Solid Films 1986, 138, 27-41. (15) Campbell, D. J.; Herr, B. R.; Hulteen, J. C.; Van Duyne, R. P.; Mirkin, C. A. J. Am. Chem. Soc. 1996, 118, 10211-10219.

(16) Bain, C. D.; Troughton, D. B.; Tao, Y.-T.; Evall, J.; Whitesides, G. M.; Nuzzo, R. G. J. Am. Chem. Soc. 1989, 111, 321-335. (17) Lide, D. R. CRC Handbook of Chemistry and Physics, 3rd Electronic ed.; CRC Press: Boca Raton, FL, 2000.

6812

Langmuir, Vol. 20, No. 16, 2004

Mark et al.

mean height of 1.2 ( 0.2 nm and a mean width of 11.5 ( 1.4 nm are seen. The surface density of these particles, which most likely corresponds to individual dendrimer molecules, was calculated to be approximately 5 × 1011 particles cm-2. Upon immobilization of the 20-base ssDNA probe molecules to the dendrimer surface, the roughness of the surface becomes increased even further. Similar to the case for the DNA-derivatized surfaces, the immobilization of streptavidin proteins resulted in an increased level of surface roughness over that observed for the TSG surfaces modified with only the AUT/ dendrimer layers. In this case, the streptavidin molecules assembled onto the dendrimer-modified surfaces to form a dense protein layer that did not present any obvious degree of ordering. (See Supporting Information, Supplementary Results and Discussion of AFM Data for further details.) XPS. XPS was used to obtain quantitative information about the elemental composition of the multicomponent films in order to confirm the immobilization of each organic layer. Specifically, XPS spectra of the following sample surfaces were collected: (1) blank gold (surface 1), (2) AUT monolayer (surface 2), (3) BS3-activated AUT monolayer (surface 3), (4) dendrimer-AUT multilayer film (surface 4), (5) dendrimer-immobilized DNA multilayer film (surface 6), and (6) dendrimer-immobilized streptavidin multilayer film (surface 7). Preliminary survey scans of the various thin-film samples indicated the presence of all the expected elements (viz., C, S, N, O, Au, and also P in DNA-containing samples), but no extraneous elements. Importantly, scans of the blank gold surface indicated the presence of mostly elemental Au, with only minor amounts of C and O. This result confirmed that the gold surfaces we used for the monolayer preparations were of high purity and did not have any significant amount of contamination. High-resolution XPS spectra surrounding the regions corresponding to the N 1s and Au 4f signals are shown in Figure 2. The N 1s peak appeared at 399.5 eV (Figure 2A). The monotonic increase observed for the nitrogen peak intensities in samples 1 through 5 is consistent with the stepwise addition of the AUT, dendrimer, DNA, and protein film components on the respective surfaces. This trend in peak intensity correlates with the expected overall increase in nitrogen content that accompanies the addition of each subsequent organic layer and provides further evidence for the successful immobilization of the dendrimers/biomolecules at the surface. Figure 2B shows that the intensities of the Au 4f peaks concomitantly decrease in a monotonic fashion; this is again fully consistent with the increased attenuation of the gold photoelectrons as they pass through an increasing number of organic layers. As previously demonstrated by others, the attenuation level of Au 4f photoelectrons can generally be used to calculate the thickness of organic layers assembled on gold substrates.18 Typically in XPS, the thickness of a thin overlayer is related to the sample signal intensity by the formula

( )

t(nm) ) -λ(KEAu) cos(θd) ln

IAu

IAu0

(1)

where t is the thickness of the organic film concerned, λ(KEAu) is the inelastic mean free path of the gold electrons with a kinetic energy KEAu through the organic medium, and θd is the takeoff angle between the normal to the sample and the detector. IAu and IAu0 are the integrated (18) Bramblett, A. L.; Boecki, M. S.; Hauch, K. D.; Ratner, B. D.; Sasaki, T.; Rogers Jr., J. W. Surf. Interface Anal. 2002, 33, 506-515.

Figure 2. XPS scans of the gold substrate after various surface modification steps: (A) The N 1s region of the high-resolution XPS spectra acquired for the blank and modified surfaces. The N 1s peak occurs at 399.5 eV. (B) The Au 4f region of the highresolution XPS spectra acquired for the blank and modified surfaces. The Au 4f7/2 peak occurs at 84.0 eV, whereas the Au 4f5/2 peak occurs at 87.6 eV. Au, gold surface; AUT, 11-amino1-undecanethiol; BS3, bis[sulfosuccinimidyl]suberate; Den, PAMAM dendrimer; ssDNA, single-stranded probe DNA; NHSLC-Biotin, EZ-Link sulfo-NHS-LC-biotin; SA, streptavidin protein.

intensities of the Au peak measured for the film-covered surface and the blank gold substrate with no overlayer, respectively. In the present study, the collected spectral data for the Au 4f7/2 signals arising from the AUT (surface 2) and dendrimer-AUT samples (surface 4) were fitted with a Gaussian function to obtain the integrated peak intensities. For calculations of the thickness of the dendrimer-AUT multilayer film, the intensity of the Au 4f peak from the underlying AUT layer was taken as IAu0. Note that we did not treat the BS3 cross-linker as a separate, distinct layer; instead, any attenuation effects arising from the BS3 molecules were simply lumped in with the dendrimer thickness calculations. The values of the inelastic mean free path, λ, of the Au electrons through each organic layer were obtained using the NIST Electron Inelastic-Mean-Free-Path Database software program.19 Specifically, theoretical λ values for the dendrimer and AUT layers were calculated using the predictive formulas available through the NIST software. The calculated thicknesses of the organic films obtained through eq 1 were 1.33 and 1.84 nm for the AUT layer (surface 2) and (19) Powell, C. J.; Jablonski, A. NIST Electron Inelastic-Mean-FreePath Database, version 1.1; National Institute of Standards and Technology: Gaithersburg, MD, 2000.

SPR Sensor Surface

Langmuir, Vol. 20, No. 16, 2004 6813

the dendrimer layer within the dendrimer-AUT multilayer film (surface 4), respectively. Although thickness information of increased accuracy is typically obtained more directly by acquiring XPS spectra at variable angles of incidence, the calculations of the multilayer film thicknesses as performed here using the attenuation data for the gold photoelectrons gave satisfactory results that are in good agreement with the thickness data measured using ellipsometry and AFM techniques. To further examine the extent of surface coverage by the AUT SAM and the immobilized dendrimer layer, estimates of the surface concentration were calculated using the thickness values derived from the XPS data. In general, the measured thickness (t) of an organic layer can be related to its surface concentration (Γ) using18

Γmonolayer(molecules cm-2) ) 10-7(cm nm-1) t(nm) F(g cm-3) NAV(molecules mol-1) MW(g mol-1)

(2)

where F is the density of the organic compound. In this case, the density of the G4 PAMAM dendrimers was taken to be 0.49 g cm-3,20 whereas that of the AUT SAM was assumed to be the same as the bulk density of dodecylamine (0.806 g cm-3).21 By use of eq 2, the surface concentration of the AUT monolayer was determined to be approximately 3 × 1014 molecules cm-2. It is well established through various experimental methods that in self-assembled monolayers of typical long chain alkanethiols on gold, each thiol chain occupies ∼22 Å2.10 The expected surface concentration of such a monolayer can thus be calculated to be 5 × 1014 molecules cm-2. Therefore, the calculated surface concentration obtained in the present study for the AUT SAM corresponds well with the literature values reported for other types of alkanethiols. The use of eq 2 further suggests that the surface concentration of dendrimers was 4 × 1012 molecules cm-2. The AFM data, however, shows that the dendrimer coverage was approximately 5 × 1011 molecules cm-2; the difference in this value with the particle density calculated here using the XPS data may be due to inaccurate assumptions regarding the contributions of the BS3 cross-linker molecules to the inelastic electron mean free path value of the dendrimer layer within the multicomponent thin film structure. ATR-FTIR. Vibrational IR spectroscopy is a useful technique that provides structural information about the conformational ordering of organic monolayers assembled on gold substrates.22 We will first discuss some of the features appearing in the high-frequency regions of the spectra acquired for the various functionalized surfaces. Generally, the position of certain C-H stretching modes can often be used to determine the degree of crystallographic ordering (packing) of n-alkanethiol monolayers on a surface. Solid (close-packed) alkanes, for example, typically exhibit bands at 2850 and 2920 cm-1 corresponding to the symmetric (d+) and asymmetric (d-) C-H stretches of the methylene group, respectively. In the case of liquidlike (less ordered) alkanes, these bands usually undergo a shift to 2856 and 2927 cm-1.23 In the AUT (20) Rar, A.; Curry, M.; Barnard, J. A.; Street, S. C. Tribol. Lett. 2002, 12, 87-94. (21) Knovel Knovel Critical Tables. Knovel: Norwich, NY, 2003. (22) Laibinis, P. E.; Whitesides, G. M.; Allara, D. L.; Tao, Y. T.; Parikh, A. N.; Nuzzo, R. G. J. Am. Chem. Soc. 1991, 113, 7152-7167. (23) Snyder, R. G.; Strauss, H. L.; Elliger, C. A. J. Phys. Chem. 1982, 86, 5145-5150.

Figure 3. ATR-FTIR scans of the gold substrate after various surface modification steps. Absorption bands occurring in the low-frequency regions of the IR spectra are shown. Inset shows a magnified view of the boxed region of the Au + AUT spectrum (line 1) from 1620 to 1670 cm-1. Au, gold surface; AUT, 11amino-1-undecanethiol; BS3, bis[sulfosuccinimidyl]suberate; Den, PAMAM dendrimer; ssDNA, single-stranded probe DNA; NHS-LC-Biotin, EZ-Link sulfo-NHS-LC-biotin; SA, streptavidin protein.

monolayers (surface 2) studied here, the bands appeared at 2849 and 2918 cm-1 (see Supporting Information, Figure S5), indicating a solidlike ordering of the AUT molecules on the gold substrate surface. However, the d+ and dbands became slightly shifted toward higher wavenumbers upon subsequent (covalent) cross-linking of the AUT surfaces via BS3 to the dendrimer/biopolymer layers; this effect may be attributable to the presence of methylene groups adjacent to amide functional groups within the multicomponent films. In the low-frequency regions of the IR spectra, the most informative features of particular relevance to the present study are the stretching and bending mode signals arising from amine and amide functional groups. The spectrum for the AUT monolayer (surface 2) shows only a relatively weak absorption band centered at 1649 cm-1 (Figure 3); this band is assigned to the N-H bending mode. A subsequent scan of the BS3-modified AUT surface (surface 3) (see Supporting Information, Figure S6) showed the appearance of a sulfonate (SO3-) symmetric stretching mode24 at 1040 cm-1, providing evidence for the presence of the BS3 cross-linker at the surface. The occurrence of the sulfonate band is consistent with our expectation that those linear BS3 molecules attached to the underlying AUT SAM through only one end should be presenting a reactive sulfo-NHS group available for attachment of the dendrimer layer. Since numerous secondary amide groups are present within the molecular framework of PAMAM dendrimers, the increased intensity levels of the amide I (CdO asymmetric stretching) and amide II (C-N stretching and N-H bending) bands at 1670 and 1541 cm-1 (Figure 3), respectively, provide additional evidence for the attachment of dendrimer molecules (surface 4). The observation of even stronger amide absorption bands in the ATR-FTIR scan of the AUT-dendrimer-streptavidin multilayer film (surface 7) is consistent with the presence of surface-immobilized proteins. In the fingerprint region of this spectrum, there are two main features occurring at 1655 and 1543 cm-1 that are attributable to the amide I and II stretchings, respectively. Additional peaks due to the CH2 scissoring deformation of alkane chains are also observed at 1456 cm-1. The significant increase in the (24) Colthup, N. B.; Daly, L. H.; Wiberley, S. E. Introduction to Infrared and Raman Spectroscopy; Academic Press: New York, 1975.

6814

Langmuir, Vol. 20, No. 16, 2004

Figure 4. Experimental SPR reflectivity curves of the gold substrate observed after performing various surface modification steps in situ (i.e., on-line). Au, gold surface; AUT, 11-amino1-undecanethiol; BS3, bis[sulfosuccinimidyl]suberate; Den, PAMAM dendrimer; ssDNA, single-stranded probe DNA.

Mark et al.

Figure 5. SPR sensorgrams obtained with 5 µM streptavidin protein interacting with sulfo-NHS-LC-biotin linked directly either to an AUT self-assembled monolayer (sensorgram 1) or to a dendrimer-functionalized AUT monolayer (sensorgram 2). Au, gold surface; AUT, 11-amino-1-undecanethiol; BS3, bis[sulfosuccinimidyl]suberate; Den, PAMAM dendrimer; NHSLC-Biotin, EZ-Link sulfo-NHS-LC-biotin.

intensity of the amide bands in surface 7, compared to the surface modified with the dendrimer layer alone (surface 4), correlates well with the large amount of amide groups present within the chemical structure of the protein backbone. In the spectrum acquired for the DNA-derivatized sample (surface 6), the characteristic phosphate symmetric and asymmetric stretching vibrations are present at 1090 and 1234 cm-1, respectively (see Supporting Information, Figure S6); these signals confirm the presence of DNA on the surface. In this case, the expected double bond stretching vibrations at 1650-1680 cm-1 arising from the DNA bases have likely become obscured by the prominent amide I band of the mediating dendrimer layer. SPR. Since SPR monitors the change in refractive index of the medium immediately adjacent to the gold-sensing surface, this optical technique was also used in preliminary experiments to confirm the presence of the various organic layers on the surface. On a clean gold film, there is a dramatic drop in the reflectivity observed at 51.8° (Figure 4). This drop corresponds to the well-described coupling of the incident polarized light beam with the surface plasmon polaritons on the 50 nm thick gold film.25 It was found that the minimum of the curve of reflected light intensity was shifted from lower to higher angles upon immobilization of the AUT SAM on a blank gold surface and, as expected, an even larger shift was observed when both the AUT and dendrimer layers were sequentially deposited. Figure 4 shows representative examples of the reflectivity curves measured for a gold sensor surface before and after fabrication of the AUT-dendrimer-DNA multicomponent film in situ. For these on-line experiments we first flowed deionized water across a clean blank gold surface and noted the initial value of the resonance angle. Next, we pumped in a solution of AUT in ethanol across the gold surface, and then washed the surface with ethanol. Following a second rinse with deionized water, we remeasured the value of the resonance angle. The subsequent steps in the multilayer fabrication process were all performed using the same chip, and upon immobilization of the various organic films in situ, the reflectivity minimum (SPR angle) consistently shifted toward higher angles. The above spectroscopic observations further confirmed that successful derivatization of the gold sensor surface occurred; future efforts will be aimed at mathematically modeling the observed reflec-

tivity changes in order to derive estimates of the thickness of the in situ generated organic layers. Preliminary SPR investigations were also performed to determine whether the use of a dendrimer layer significantly improves the protein immobilization capacity on a gold surface. For this we compared two sensor surfaces, one with a dendrimer-modified AUT SAM surface and the other with an unmodified AUT SAM surface. Following the derivatization of both these surfaces with sulfo-NHS-LC-biotin, we monitored (in separate experiments) the immobilization of streptavidin protein onto each surface by SPR in real time. In the resulting sensorgram plots shown in Figure 5, the mass of adsorbed protein is proportional to the difference between the SPR baseline signal before injection of the protein and the signal after reinjection of the wash buffer.26 As is evidenced by Figure 5, a 2.5-fold enhancement of signal intensity was obtained using the dendrimer-modified surface, when compared with the AUT-only surface. We have also observed a similar degree of enhancement for the immobilization of antibody (immunoglobulin G) proteins (e.g., rabbit IgG molecules; see Supporting Information, Figure S7). These results suggest that the additional presence of the dendrimer organic layer increased the amount (mass) of protein ligands that became immobilized on the sensor surface. This greater protein immobilization efficiency may have been due to a combination of two factors: (1) a net increase in the total surface-accessible area that accompanies the binding of the dendrimer particles to the sensor surface and (2) the particular three-dimensional steric arrangement of the large number of amine groups available for covalent coupling that is present on the surface of each dendrimer (64 surface primary amino groups per macromolecule). For the PAMAM G4-NH2 dendrimers used in this study, the theoretical areal density of NH2 groups localized at the surface of each macromolecue is 1.0 nm-2.20 Interestingly, in their investigations of nucleic acid immobilization strategies for microarray production, Benters et al.7 demonstrated through fluorescence techniques that dendrimer-activated glass sur-

(25) Liedberg, B.; Nylander, C.; Lundstrom, I. Biosens. Bioelectron. 1995, 10, i-ix.

(26) Fagerstam, L. G.; Frostell-Karlsson, A.; Karlsson, R.; Persson, B.; Ronnberg, I. J. Chromatogr. 1992, 597, 397-410.

SPR Sensor Surface

Figure 6. SPR sensorgrams obtained (in separate experiments) for the interaction between immobilized streptavidin protein and either anti-streptavidin antibody or bovine serum albumin (BSA): (1) upon immobilization of 5 µM streptavidin to the dendrimer/NHS-LC-biotin-derivatized sensor surface, PBST wash buffer and 2 µM anti-streptavidin antibody solutions were sequentially injected; (2) upon immobilization of 5 µM streptavidin to the dendrimer/NHS-LC-biotin-derivatized sensor surface, PBST wash buffer and 2 µM BSA solutions were sequentially injected. R-SA Ab, anti-streptavidin antibody; BSA, bovine serum albumin.

faces displayed an oligonucleotide surface coverage that was approximately 2-fold greater than that obtained with conventional microarrays containing only linear chemical linkers. It should be noted that in the present SPR studies, the absolute amount of protein ligand covalently immobilized on the dendrimer surfaces in terms of mass per unit area is not known; additional investigations (e.g., radiolabel-based assays) will need to be undertaken in order to quantitatively relate changes in refractive index (pixel units) to the mass of analyte biomolecules physically adsorbed to the sensor surface. In our investigations exploring the general applicability of the dendrimer-based surfaces for studying biomolecular interactions by SPR, we first examined the binding of anti-streptavidin antibody to surface-immobilized streptavidin protein as a model system for antigen-antibody interactions. The left sensorgram (1) shown in Figure 6 confirms that the expected interaction of anti-streptavidin antibody (Ab) with streptavidin occurred. Here, the difference in the SPR response between the initial baseline value and the baseline after the PBST buffer rinse was 49.5 pixel units. This demonstrates that the dendrimerimmobilized streptavidin is still in a biologically active form. In a separate experiment, we also investigated the specificity of the dendrimer surface by flowing bovine serum albumin (BSA) as a nonrelevant (negative control) protein over the streptavidin surface (right sensorgram (2) shown in Figure 6). In this control experiment, we confirmed that the BSA showed no significant amount of nonspecific adsorption to the streptavidin-derivatized surface. The absence of binding of this protein suggests that the dendrimer-modified surfaces are functionally specific, which is a prime requirement for an effective SPR sensor surface. As a further demonstration that the dendrimer surfaces can also be used in conjunction with SPR to detect DNADNA interactions in a specific manner, we fabricated a sensor surface containing dendrimer-immobilized 20-base ssDNA oligonucleotide probes and then monitored the binding of either fully complementary or noncomplemen-

Langmuir, Vol. 20, No. 16, 2004 6815

Figure 7. SPR sensorgrams obtained (in separate experiments) for the hybridization interaction between immobilized 20-mer probe oligonucleotides and either (1) fully complementary 30mer target ssDNA (5 µM) or (2) noncomplementary (complete mismatch) 30-mer target ssDNA (5 µM).

tary (i.e., complete mismatch) 30-base ssDNA target molecules to the surface. As in the case for the proteinprotein interaction studies, the amount of ssDNA that bound to the surface was determined by measuring the net increase in the baseline response. The left sensorgram (1) in Figure 7 shows that when a 5 µM solution of noncomplementary (negative control) ssDNA was injected and passed over the prewashed sensor surface, there was no significant binding; this indicates that the dendrimerderivatized surfaces were selective and resisted nonspecific binding by nonrelevant oligonucleotides. On the other hand, when a 5 µM solution of the complementary oligonucleotide target was injected over the surface, there was a 3.5-pixel unit increase in the response level (right sensorgram (2) shown in Figure 7). This result verifies the bioactivity of the DNA-functionalized sensor surfaces. Additionally, it was found that the surfaces could be regenerated by simply washing with 8.3 M urea at room temperature, thereby enabling consecutive hybridization studies with the same immobilized ssDNA probes. For clinical or environmental monitoring applications, sensitivity is obviously an important aspect for the labelfree detection of nucleic acids using SPR; we therefore performed a series of hybridization experiments using a range of complementary target ssDNA concentrations spanning 3 orders of magnitude (0.5 nM to 5.0 µM) and monitored the residual amount of target bound after the washing step (i.e., during the dissociation phase).27,28 In each case, the normalized response change detected after the end of the sample injection phase was plotted against the corresponding target concentration. As shown in Figure 8, the presence of the complementary ssDNA in synthetic test solutions could be reliably detected when the concentration was as low as 3.9 nM. At target concentrations lower than 3.9 nM, the response changes were found to be only slightly higher than the background values obtained by injecting a “blank” buffer solution without any target. Our sensitivity measurements are in concordance with the nanomolar range of most of the detection levels that have been reported to date for other SPR studies of DNA-DNA hybridizations that employ conventional, dextran-based chemistries for the probe (27) Kai, E.; Sawata, S.; Ikebukuro, K.; Iida, T.; Honda, T.; Karube, I. Anal. Chem. 1999, 71, 796-800. (28) Feriotto, G.; Ferlini, A.; Ravani, A.; Calzolari, E.; Mischiati, C.; Biachi, N. G., R. Hum. Mutat. 2001, 18, 70-81.

6816

Langmuir, Vol. 20, No. 16, 2004

Figure 8. Normalized affinity plot of the hybridization interaction between immobilized 20-mer probe oligonucleotides and a fully complementary 30-mer target ssDNA.

step.27,29

immobilization Our findings also compare favorably against other types of DNA-based biosensors employing alternative immobilization chemistries; for example, Minunni and co-workers recently reported that their electrochemical and piezoelectric quartz-crystal microbalance (QCM) sensors typically displayed detection limits on the order of a tenth of a micromolar when probe and target DNA sequences similar in length to those employed in the current study were used.30 Further investigations of the regenerability and stability of the dendrimer surfaces have shown that the affinity of the sensing surface remains essentially the same before and after 12 cycles of DNA hybridization/denaturation with 8.3 M urea as the regenerant solution (see Supporting Information, Figure S8). Within the past few years, biomolecular interaction studies conducted using commercially available SPR instruments have mostly entailed the use of a threedimensional, 100 nm thick carboxymethylated dextran polymer layer attached to the biosensor surface.1 Although the carboxymethylated dextran-based matrix is widely used, the important issue of whether the polymer coating itself might influence, by its very presence, the experimentally observed equilibrium and kinetic profiles of a given model system remains a topic of much discussion.31 Figure 9 shows that the initial binding rate observed for the interaction between the fully complementary target ssDNA and the dendrimer-immobilized 20-mer probe oligonucleotide was independent of flow rate under the various target concentration conditions used. This observation suggests that the DNA hybridization events taking place at the sensor surface were controlled by the intrinsic kinetics of the DNA-DNA interaction and not by mass transport. This finding is consistent with our expectation that a sensor surface comprised of probe molecules attached to a two-dimensional planar array of dendrimer molecules should be uniformly accessible by flowing target analyte species and therefore not prone to be influenced by mass transport-limiting effects. For most “all-or-none” diagnostic applications of SPR, the ability to distinguish very closely related DNA sequences such as single-base mismatches is necessary; therefore, additional experiments to evaluate the feasibility of performing nucleic acid hybridizations at elevated temperatures using the dendrimer sensor platforms are currently in progress. More detailed investigations of the (29) Persson, B.; Stenhag, K.; Nilsson, P.; Larsson, A.; Uhlen, M.; Nygren, P. Anal. Biochem. 1997, 246, 34-44. (30) Minunni, M.; Tombelli, S.; Mariotti, E.; Mascini, M.; Mascini, M. Fresenius J. Anal. Chem. 2001, 369, 589-593. (31) Wofsy, C.; Goldstein, B. Biophys. J. 2002, 82, 1743-1755.

Mark et al.

Figure 9. Initial binding responses for complementary target ssDNA injected at different concentrations and flow rates over an SPR sensor surface containing immobilized 20-mer probe oligonucleotides.

effect of analyte DNA length on the hybridization kinetics and evaluations of the differential stability of DNA-DNA complexes generated during hybridization under various buffer conditions will also be conducted to determine the optimum conditions for accurate mismatch detection. IV. Conclusion In this work, multilayer ultrathin film SPR matrixes composed of an AUT SAM, an intermediate PAMAM dendrimer mediating layer, and a biomolecular sensing layer were fabricated. Tapping mode AFM was used to image PAMAM G4 dendrimer molecules immobilized on AUT-modified gold substrates, and the topographical scan data have been used to determine the mean diameter and height of the dendrimer macromolecules. Fluorescence microscopy, ellipsometry, XPS, and ATR-FTIR data provided evidence for the successful immobilization of proteins and DNA to the dendrimer-modified surfaces, and furthermore, estimated film thickness values for the AUT and dendrimer surfaces calculated from the XPS data agreed well with the ellipsometry and AFM observations, respectively. The SPR studies have demonstrated that the dendrimer-based affinity sensor matrixes described herein (1) can increase the ligand immobilization efficiency beyond that obtained by using alkanethiol SAM surfaces without a dendrimer layer, (2) do not appear to be significantly influenced by mass transport-limiting effects, and (3) are selective, stable, and regenerable. This last finding is an important result which suggests that totally integrated optical biosensors employing dendrimerbased surface chemistries may potentially be reused multiple times, thus reducing the overall costs associated with the development and operation of such microfabricated “lab-on-a-chip” devices. In closing, we anticipate that the utilization of high-generation PAMAM dendrimers as macromolecular building components in the fabrication of ultrathin sensing films and their functionalization will find increasingly widespread application in the development of a diverse range of biosensor technologies, not just evanescent optical-based ones. Acknowledgment. This work was supported by the New York State Office of Science, Technology and Academic Research (NYSTAR) through the Alliance for Nanomedical Technologies, a New York State Center for Advanced Technology (CAT) program. Additional support was also obtained from the Nanobiotechnology Center

SPR Sensor Surface

(NBTC) at Cornell University, an STC program of the National Science Foundation under Agreement No. ECS9876771. This work was performed in part at the Cornell Nano-Scale Science & Technology Facility (a member of the National Nanofabrication Users Network) which is supported by the National Science Foundation under Grant ECS-9731293, its users, Cornell University and Industrial Affiliates. The authors thank Greg Pribil and James Hilfiker (J.A. Woollam Co., Inc.) for the ellipsometry analysis. Dr. Magnus Bergkvist is also thanked for useful discussions regarding the AFM data. Supporting Information Available: Details of fabrication of gold substrates for fluorescence microscopy and AFM,

Langmuir, Vol. 20, No. 16, 2004 6817 Figure S1 (optical micrographs of gold-patterned silicon substrates modified with the dendritic linker chemistry), Figure S2 (VUV-VASE measurement of AUT SAM on gold substrate), Figure S3 (tapping mode AFM images of TSG substrates modified with the dendritic linker chemistry), Figure S4 (tapping mode AFM images of an unmodified evaporated gold substrate, a TSG substrate modified with AUT, and a TSG substrate modified with AUT and BS3), Figure S5 (ATR-FTIR high-frequency IR spectra), Figure S6 (ATR-FTIR lowest-frequency IR spectra), Figure S7 (Immobilization of rabbit IgG protein on dendrimer surfaces), Figure S8 (Regeneration of dendrimer surfaces for DNA-DNA hybridizations), supplementary results and discussion of AFM data. This material is available free of charge via the Internet at http://pubs.acs.org.

LA0495276