Dendritic Cell Targeted Nanovaccine Delivery System Prepared with

Subscriber access provided by University of Sussex Library

Biological and Medical Applications of Materials and Interfaces

Dendritic Cell Targeted Nanovaccine Delivery System Prepared with an Immune-Active Polymer. Mrigendra K.S. Rajput, Siddharth Kesharwani, Sunny Kumar, Pratik Muley, Susmitha Narisetty, and Hemachand Tummala ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b02019 • Publication Date (Web): 26 Jul 2018 Downloaded from http://pubs.acs.org on July 26, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Dendritic Cell Targeted Nanovaccine Delivery System Prepared with an Immune-Active Polymer Mrigendra K.S. Rajput1, 2#, Siddharth S. Kesharwani1#, Sunny Kumar1, Pratik Muley1, Susmitha Narisetty1 and Hemachand Tummala1* 1

Department of Pharmaceutical Sciences, South Dakota State University, Box 2202C, Brookings, SD-57007, USA. 2

#

Department of Biological Sciences, Arkansas Tech University, Russellville, AR 72801.

Authors contributed equally, joint first authors

* Corresponding author: Associate Professor Department of Pharmaceutical Sciences South Dakota State University SAV#255, Box 2202C Brookings, South Dakota 57007, United States Phone no. +1-605-688-4236 Fax +1-605-688-5993 E-mail: [email protected]

1 ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 44

ABSTRACT Targeting dendritic cells (DCs) either ex-vivo (Ex. Sipuleucel-T) or in-vivo, for stimulating cellular immunity has been a leading approach for cancer vaccines. We have rationally engineered a nanoparticle-based delivery system for vaccines (InAc-NPs) using inulin acetate (InAc) as the polymer to target DCs. The material and the antigen-encapsulated InAc-NPs (~190 nm in diameter) were characterized for their physicochemical properties. As a potent vaccine adjuvant, InAc-NPs activated TLR4 on multiple immune cells including DCs and primary swine and human cells to secrete various cytokines as detected by ELISA and quantitative-PCR. In addition, InAc-NPs promoted the maturation of DCs as observed by a decreased phagocytic ability and enhanced capability to activate various maturation markers (MHC-I, MHC-II, CD40, and CD80) quantified using flow-cytometry. In mice, the InAc-NPs produced strong serum antibody titers (total IgG, IgG1, and IgG2a) against the encapsulated antigen (ovalbumin) similar to Complete Freund’s adjuvant. Additionally, as a dose-sparing delivery system, antigen delivered through InAc-NPs generated higher antibody titers (IgG1, 1.57 times; IgG-total, 1.66 times; and IgG2a, 29.8 times) even at 100 times less antigen dose. High amounts of cytokines representing both humoral (IL4 and IL10) and cell-mediated immunity (IL2 and IFN-g) were secreted from splenocytes of mice immunized with InAc-NPs. Importantly, InAc-NPs provided complete protection in 100 % of the vaccinated mice from metastasis of intravenously injected melanoma cells (B16-F10) to lungs. In addition, the InAc-NPs were cleared from the injection site within 30 h of injection (in-vivo imaging) and displayed no toxicity at the injection site (histology). The current study demonstrates that the multifunctional InAc-based nano-vaccine delivery system has potential applications in cancer immunotherapy and delivering vaccines against various infectious diseases. 2 ACS Paragon Plus Environment

Page 3 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


KEYWORDS: Dendritic cell targeting, Cancer immunotherapy, Nanoparticulate vaccine, Humoral and Cellular immunity, Inulin acetate, Toll-like receptor- 4 agonists.



Page 4 of 44

1. INTRODUCTION The influence of nanotechnology has profoundly changed the direction of the future medicine especially in the field of disease diagnosis, and vaccine/drug delivery1. For the rationale designing of vaccines, it is important to recognize that many pathogens share the characteristic of being particulate in nature. Therefore, a logical strategy to deliver an antigen/vaccine would be to use an insoluble particulate carrier that closely resembles a pathogen in multiple attributes such as, size, physical characteristics and/or biological functionalities2. This would allow us to take advantage of the natural pathogen recognition and processing ability of the immune system without the risk of causing an infection. In addition, nanoparticle carriers have been shown to stimulate humoral and cell-mediated immunity in an efficient manner by delivering significantly higher amounts of antigen to the immune cells3-6. Therefore, numerous particulate delivery systems with different physicochemical characteristics have been explored as vaccine delivery systems5-9. Most of the nanoparticulate vaccines contain the antigen either encapsulated within the nanoparticles or decorated on their surface. Some of these delivery systems apart from being efficient antigen delivery vehicles act as immune-simulators (vaccine adjuvants)5, 10-14. Apart from delivering the antigen to the antigen presenting cells (APCs), the initiation of necessary signaling in DCs for their activation and maturation of is critical for strong antigenspecific immune

3-8, 15-16

. Depending on the mode of antigen delivery and their subsequent

interactions with the vaccine material, APCs direct the adaptive immunity towards either a specific nature of immune response (humoral and/or cell mediated) or induce tolerance17-21. Therefore, the selection of appropriate material for preparing nanovaccines and their physicochemical properties have been the center of the current vaccine delivery research. Various materials have been explored as carriers for vaccine delivery as reviewed previously5, 8,


Page 5 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


22-23

. These include but are not limited to lipids, polymers, metals, carbohydrates, self-assembled

proteins, vector viruses etc. Polysaccharides provide an exciting new platform to interact with the innate immune system due to their abundance in pathogens and their relative non-toxic properties. Various polysaccharides as biomaterials for vaccine carriers have been explored including pullulan, hyaluronic acid, alginate, chitosan, inulin etc. as reviewed in the references3, 24-27

. With the advancements in material sciences, drug delivery and immunology, the interest

of nanovaccine development has been to select an appropriate material or design a delivery system with unique physicochemical properties that promote their interaction with the innate immune component such as DCs. These interactions should efficiently direct the antigen to necessary endocytic compartments for improved antigen presentation, and importantly, signal for a desired immune stimulation. The recognition of the unique pathogen associated molecular patterns (PAMPs) is carried out by immune cells using pattern recognition receptors (PRRs). TLRs belong to an important group of PRRs with great implications in pathogen recognition or vaccine efficiency28-31. TLR4 has been investigated greatly for the designing of vaccine adjuvants32. Monophosphoryl lipid-A (MPLA), a small molecule-based TLR4 agonist, has become the main component of an emulsion-based modern vaccine delivery system for preventing HPV infection (Cervarix). The current study focused on rationally engineering a novel and safe nano-vaccine delivery system that stimulates TLR4 receptors on the surface of DCs thereby produce robust humoral and/or cellular immune responses. The novelty of the design is that the polymer (inulin acetate, InAc) used to prepare the nanoparticles was recently reported from our laboratory as a novel TLR4 agonist28. InAc is synthesized from a natural plant-based polysaccharide inulin. The



Page 6 of 44

InAc-based nanovaccine delivery system (InAc-NPs) was recognized by DCs through TLR4InAc interactions, similar to the natural recognition of pathogens, which led to an efficient vaccine uptake, antigen presentation and importantly, TLR4 based signaling for a strong DC activation and maturation. The activation and maturation of DCs was demonstrated through enhanced release of inflammatory cytokines and increased expression of various maturationrelated cell surface proteins. In mouse studies, InAc-NPs generated robust humoral and cellular immunity. In addition, InAc-NPs protected 100% of vaccinated mice from the metastasis of intravenously administered melanoma (skin cancer) cells to lungs. Importantly, InAc-NPs were safe as shown by the cytotoxicity, skin histochemistry, and in-vivo imaging techniques. In conclusion, InAc based DC-targeted nanovaccine delivery system revealed a unique and safe platform technology that has applications for vaccine delivery against pathogens as well as against cancer.


Page 7 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2. EXPERIMENTAL METHODS 2.1 Chemicals Inulin and poly (lactic-co-glycolic acid), PLGA were purchased from MP Biomedicals LLC (Santa Ana, CA, USA) and Sigma Aldrich (St Louis, MO, USA), respectively. Solvents, chemicals and biochemical reagents were obtained from Fisher Scientific (Pittsburgh, PA. USA). Cell surface marker antibodies, the ELISA kits and other secondary antibodies were purchased from e-Biosciences, Inc. (San Diego, CA, USA). 2.2 Cell lines The source of cell lines utilized in the study and the culture conditions including the medium utilized have been reported previously28-29. 2.3 Synthesis and Chemical Characterization of InAc InAc was obtained by synthetic modification of inulin using the procedure reported previously2829

. The formation and the consistency of InAc was confirmed using various analytical and

chromatographic techniques. The detailed methodologies for these techniques were reported previously28-29. 2.4 Preparation of Inulin Acetate Nanoparticles (InAc-NPs) InAc-NPs were prepared as reported previously with InAc microparticles, however, with slight modifications28-29. In preparing NPs, we have used 600 RPM for stirring the emulsions. The blank InAc-NPs were prepared in the similar manner without the addition of ova in the preparation. Nanoparticles were also prepared with PLGA as a polymer instead of InAc by employing similar method (PLGA-NPs). The complete procedure for particle preparation was performed with extreme caution to minimize microbial contamination.



Page 8 of 44

2.5 Determination of Antigen Loading Micro BCA™ Protein Assay was employed for the estimation of ovalbumin content in NPs. As described elsewhere28-29. A standard curve was utilized for calculating the protein concentration by using blank-InAc-NPs spiked with a known concentrations of antigen (ovalbumin). 2.6 Physicochemical Characterization of InAc-NPs The measurements for determining the size, surface charge and surface morphology were performed using dynamic light scattering (DLS) (Malvern Zeta-Sizer), scanning electron microscopy and atomic force microscopy. The detailed methodology and the instrumentation has been described in sufficient details elsewhere29, 33. 2.7 Determination of Endotoxin Levels The endotoxin levels in the formulations was determined using ToxinsensorTM kit (Genscript, Piscataway, NJ, USA) 28-29,33. 2.8 In-vitro Activation and Maturation of Naïve Dendritic Cells (DCs) DC2.4 (500,000) cells were activated with MPLA (2 µg/ml) or blank InAc-NPs (without antigen) at various concentrations (10-100 µg/ml) for 48 h. In another experiment, to study the role of TLR4 in InAc-NPs dependent activation of DCs, DC2.4 cells were pre-incubated LPS-RS (TLR4 antagonist) (10-60 ng/ml) for 1 h before treating with 100 µg/ml of InAc-NPs for 48 h. In both the assays, the activation was evaluated by estimating the levels of interleukin-8 secreted into the into the medium28. The effect of InAc-NPs on the maturation of naïve DCs was studied by quantifying the levels of cell surface protein markers representing the mature dendritic cells (CD40/CD86 and MHC-I/MHC-II) after the treatment using flow-cytometry. In brief, after 48 h of treatment, cells were washed 3-4 times, incubated with antibodies against the abovementioned cell surface markers (1:100) for 1 h, followed by incubation with fluorescence


Page 9 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


isothiocyanate (FITC)-labeled secondary antibody (1:1000) for 2 h. The cells were processed by for flow cytometry and analyzed as previously reported 28-29. 2.9 TLR4 activation The activation of TLR4 by InAc-NPs was confirmed by using genetically modified human kidney epithelial cells HEK-TLR4YFPMD2 cells. The detailed experiment procedure was reported in the previous manuscript 28. 2.10 Activation of Human and Swine PBMCs Treatment of PBMCs, cDNA synthesis and measurement of gene expression of various cytokines: The blood collection and the human PBMCs treatment procedure is similar to the previously reported methodology28. The cytokines estimated include IL6, IL12 and TNF-a. The forward

primers

used

were

GGGGTCCTTGGGTTTGGATT,

IL6-AGATGCCAAAGCTGATGC,

IL12-AATCCTCAACCACTCCCAA,

GGCGTAAAGCTGCTACCCTC.

The

ACAAGACCGGTGGTGATTCTCA,

TNF-a-

reverse

primers

TNF-a-

and

RPL4-

include

IL6-

TTGGAACCCAAGCTTCCCTG,

GGCAACTCTCATTCGTGGCT, and RPL4- GGATCTCTGGGCTTTTCAAGATT.

IL12The

details of the PCR conditions were reported previously28. 2.11 Phagocytosis Assay Murine macrophage cell (NR-9456) (1.0 ×105 cells/well) were treated with MPLA or InAc-NPs. After 48 h, PBS was used to wash the cells three times and further incubated with fluorescent polystyrene beads (0.2 µm in size) at 1:10 cells (effector) to beads (target) ratio. The cells were then incubated for 1 h and subsequently processed and analyzed using BD FACSCaliburTM for phagocytosis of the beads.



Page 10 of 44

2.12. Quantitative and Qualitative Determination of Delivery of Antigen to DCs The efficiency of antigen delivery to DCs by InAc-NPs was compared with antigen delivered in solution or through PLGA-NPs using flow-cytometry as reported previously28. Intracellular distribution of InAc-NPs was determined by confocal laser scanning microscopy. DC2.4 cells (25,000/well) were incubated on coverslips for 24 h. The cells were processed for imaging as reported previously28. The images were acquired using Olympus FV1200 scanning confocal microscope. 2.13 Animals: Male BALB/C mice (6-8-week-old) were used in the immunization and safety studies. The mice were procured from Charles River laboratories (Wilmington, MA)). The C57BL/6J mice were selected for metastasis studies as they are syngeneic to the tumor cells (B16F10-Ova) used in this study and therefore, would not reject the cells. 2.14 Safety of InAc-NPs 2.14.1 In-vitro cytotoxicity: The InAc-NPs were evaluated for their cytotoxic potential on DC2.4 cells by investigating the cell viability using the MTT assay. Brieﬂy, DC2.4 cells (5000/well) were incubated with InAc-NPs (0-500 µg/ml) for 48 h in 96 well plates. After 48 h, the cell viability was compared with the untreated cells using MTT-assay. 34 2.14.2 Skin Toxicity: The skin toxicity of InAc-NPs (2 mg) or CFA at the injection site was evaluated by assessing the gross structural damage after 21 days of subcutaneous (s.c.) injection using haematoxylin and eosin (H&E) staining. 2.14.3 Injection-site Clearance and Safety of InAc-NPs: Mice were injected subcutaneously with 1 mg of InAc-NPs containing near infrared dye carbocyanine-DiOC18 into the foot pad. The


Page 11 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


retention time of InAc-NPs at the injection site was determined by imaging with Bruker-Xtreme in-vivo imager at excitation/emission wavelengths of 750/780 nm at different time points. 2.15 Immunization Studies Mice were immunized subcutaneously with various doses (1, 10 or 100 µg) of ova in saline without adjuvant, with CFA or ova encapsulated inside InAc-NPs (~1 mg) as delivery system. Two doses were given with 3 weeks apart as primary and booster immunization. The method of collecting sera and measuring antibody titers using ELISA are reported previously29. 2.16 Splenocytes Culture The detailed procedure for splenocytes culture has been reported previously29. 2.17 Cytokine Analysis Mouse Th1/Th2 (IL-2, IL-4, IL-10, and IFN-γ) ELISA kit was utilized for analyzing the cytokines as described previously29. 2.18 Study of Metastasis C57BL/6J mice were immunized with saline, ova without an adjuvant or ova-loaded InAc-NPs at 50 µg ova dose twice on day 0 and day 14. On day 21, mice were injected intravenously with 2×105 B16-F10-Ova melanoma cells. On day 49, the mice were euthanized and the black tumor foci on the lungs were counted under the microscope. 2.19 Statistics All experiments were performed in multiples of triplicates or more for appropriate statistical analysis. Statistical analysis was performed using Instat, Graph Pad software, CA or Microsoft Excel.



Page 12 of 44

3. RESULTS 3.1 Characterization of InAc-NPs The acetylation of the hydroxyl functional groups of inulin provided Inulin acetate (InAc). The quality and the batch-to-batch consistency of the synthesized InAc were evaluated as described previously by using FTIR, proton-NMR, DSC, PXRD and gel permeation chromatography28. InAc-NPs were prepared either with an encapsulated antigen (ovalbumin) or without any antigen (blank particles). The InAc-NPs were characterized using multiple techniques such as DLS (Figure. 1A, B), SEM (Figure. 1C) and AFM (Figure. 1D). InAc-NPs were spherical in shape. The average diameter as determined by SEM and DLS analysis were 96.11 ± 69.57 nm and 189.93 ± 1.57 respectively (Figure 1C & D). The surface charge on the InAc-NPs was close to neutral (Figure 1B). The particle size determined by DLS (a wet technique) was larger when compared to SEM (dry particles) because of the water layer around the nanoparticles. The invitro release of ovalbumin from the InAc-NPs was evaluated in 50 mM PBS, pH 7.4. The encapsulated antigen demonstrated a differential pattern of release as observed with inulin acetate microparticles29. 3.2 Formulation Optimization of InAc-NPs The effect of various formulation variables on the particle size and the antigen loading was studied by performing formulation optimization with the objectives of decreasing the particle size and increasing the antigen loading. The effect of the polymer to antigen ratio and the phasevolume ratio (organic to aqueous phase) during secondary emulsion phase were investigated on three outcomes; the particle size (nm) (Figure 2A), polydispersity index (PDI) (Figure 2B) and the antigen loading (µg/mg) (Figure 2C). Increasing the ratio of aqueous phase to the organic phase during the formation of the secondary emulsion from 3 to 9 displayed a trend of


Page 13 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


continuous reduction of the average particle diameter of InAc-NPs from ~360 nm to ~190 nm (Figure 2A). In addition, such alterations in the formulation design also decreased the polydispersity index of InAc-NPs significantly from 0.3 to 0.14 (Figure 2B).

Figure 1. Physicochemical characterization of InAc-NPs. (A) The particle size (nm) (B) ζpotential represented as total counts. The spherical morphology and size distribution in the nanometer range using (C) SEM, and (D) AFM.

These trends are consistent among all the polymer to antigen ratios evaluated (5-20). Decreasing the polymer to antigen ratio significantly enhanced the antigen loading inside the particles. Interestingly, increasing the phase-volume ratio from 1:3 to 1:9 also increased the efficiency of antigen loading at all polymers to antigen ratios. Based on these studies, the parameters of a phase-volume ratio of 1:9 with a polymer to antigen ratio of 10 were selected for further studies.



Page 14 of 44

Before investigating the efficacy or mechanisms of activation of DCs by InAc-NPs in cell culture experiments, the stability of InAc-NPs in PBS and cell culture medium were evaluated by observing changes in the particle size and polydispersity index3. This method addresses both the physical stability of the InAc-NPs (aggregation) directly and chemical stability indirectly. A possible degradation product of the polymer InAc is inulin, which is water soluble. If the polymer InAc in InAc-NPs is degraded, the size of the particles will be reduced due to the surface erosion of the particles. The results as depicted in the (Figure 2D-G) clearly demonstrate that InAc-NPs did not degrade within 60 h of incubation in PBS, however, in DMEM medium containing serum there is partial surface erosion within 12 h of incubation, which did not continue during further incubation.


Page 15 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Formulation optimization and stability of InAc-NPs. The effect of the phasevolume and the polymer-antigen ratios on (A) particle size (nm) (B) polydispersity index, and (C) antigen loading (μg/mg) of InAc-NPs. D-G) Stability of InAc-NPs. The stability of InAcNPs and InAc-OVA-NPs in PBS and DMEM medium were evaluated for a period of 60 h by measuring particle size (D-E) Polydispersity index (PDI) (G-H). All the experiments were performed in multiples of triplicates or more for appropriate statistical analysis.



Page 16 of 44

3.3 InAc-NPs Activate and Promote the Maturation of DCs and other Primary Immune Cells DCs are one of the efficient professional APCs, which are important in priming T-cells. Naïve DCs are activated when they encounter a pathogen mainly through their interaction with PAMPs, which leads to an increased secretion of various chemokines and cytokines, and enhanced expression of various maturation related cell surface markers. This process is called DC activation and maturation. DC2.4 cells utilized in this study represent APCs that are highly phagocytic in nature and depict similarity to in-vivo DCs in regards to the expression of pattern recognition receptors, activation and maturation patterns35. InAc-NPs without an antigen (blank NPs) stimulated naïve DCs to release a potent chemokine (IL-8) in a concentration dependent manner (Figure. 3A). However, this activation was prevented with LPS-RS, an antagonist for TLR-4. This suggests that InAc may stimulate DCs through the activation of TLR4 on their surface (Figure 3B). The ability of InAc-NPs to activate TLR4 receptors was further confirmed by using HEKTLR4YFP-MD236. The overexpressed TLR4 receptor on the plasma membrane these cells is functional and releases IL-8 upon ligand binding. The blank InAc-NPs and MPLA both activated the TLR4 signaling pathway in HEKTLR4YFP-MD2 cells to secrete IL-8 into the culture supernatant (Figure 3C), however, PLGA-NPs prepared with an inert polymer PLGA failed to stimulate TLR4 signaling in these unique cells. As observed with DCs, the activation of TLR4 signaling on HEKTLR4YFP-MD2 cells by InAc-NPs was prevented in presence of LPS-RS in a dose-dependent manner (Figure 3D). These observations together (Figure 3A-D) confirmed that InAc-NPs based vaccine delivery system activate the TLR4 receptors even in the absence of the antigen(s).


Page 17 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


As novel TLR4 activators, InAc-NPs also stimulated the primary immune cells (PBMCs) from swine (Figure 3E-G) and human (Figure 3H) origin to produce higher levels of RNA transcripts for various cytokines as tested by the quantitative real-time PCR technique (Figure 3E-H). InAc-NPs enhanced the expression of several cytokines such as IL-6 (10 folds), IL-12 (140 folds), and TNF-α (12 folds) folds in swine PBMCs as compared to untreated cells. These cytokines are important in generating a strong immune response. In human PBMCs, as observed with our previously reported results with inulin acetate microparticles, InAc-NPs significantly increased the expression of IL-6 gene by approximately 4.5 folds as compared to control cells with no treatment. Interestingly, the stimulation of the expression of IL-6 gene by PLGA particles may be triggered by phagocytosis process induced by particulate delivery systems. Activation and maturation of DCs are crucial for the initiation of cell-mediated immunity. The maturation of DCs is evaluated by studying the reduction in the ability to phagocytose and the increase in the expression of CD40, CD86, MHC-I, and MHC-II proteins on the surface. Indeed, InAc-NPs reduced the ability of DCs to phagocyte similar to a known TLR4 agonist MPLA (Figure. 4A). In addition, InAc-NPs also enhanced the surface expression of the CD40 protein in treated DCs compared to untreated cells (~2.42 times). InAc-NPs also showed a 117% increase in the expression of CD86 compared to medium treated DCs, while MPLA enhanced the expression of CD86 by 176%. Further, InAc-NPs significantly increased the expression of MHC-I and MHC-II molecules on the surface by 168% and 126%, respectively as compared to the medium treated cells (Figure 4B and 4C). MPLA (a TLR4 agonist) is used as a positive to control in the above assays. As a delivery system, InAc-NPs delivered significantly more antigen to dendritic cells compared to antigen delivered in solution (> 6 times) or antigen delivered through PLGA-NPs (>~ 4 times) after 12 h of incubation (Figure 4D). The results indicate that



Page 18 of 44

DCs engulf more particulate antigen when delivered through InAc-NPs as compared to the soluble antigen. We further confirmed the intracellular localization of the delivered antigen inside vesicles by the image collected through optical sectioning across z-axis using confocal laser scanning microscopy (Figure 4E). Thus, the combined results from the above functional and mechanistic studies provides clear indication that InAc-NPs based vaccine delivery system is also a potent immune stimulant, which activates naïve DC and promotes their maturation possibly through the TLR4 signaling.


Page 19 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60




Page 20 of 44

Figure 3. 3A-B InAc-NPs stimulate the mouse DC 2.4 cells through TLR4 activation. 3A. DC2.4 cells were treated with MPLA (2 µg/ml) or InAc-NPs (10-100 µg/ml) for 48 h. 3B. The TLR4 antagonist LPS-RS (0 to 60 ng/ml) was added to DC2.4 cells for 1 h before addition of InAc-NPs (100 µg/ml). After 48 h, the IL-8 levels in the supernatants were quantified using sandwich-ELISA. InAc-NPs along with MPLA activated DCs to release higher levels of IL-8, which was inhibited by pre-incubation of cells with a TLR4 antagonist. 3C-D InAc-NPs YFP

activates TLR4. 3C. HEK-TLR4

-MD2 were incubated with the MPLA (2 µg/ml), InAc-NPs

(1-100 µg/ml), or PLGA-NPs (1-100 µg/ml). 3D. The HEK cells were incubated with a TLR4 antagonist LPS-RS (0 to 120 ng/ml) 1 h prior to the treatment with InAc-NPs (100 µg/ml). After 48 h, the IL8 levels the supernatant were determined. InAc-NPs along with MPLA activated YFP

TLR4 signaling in HEK-TLR4

-MD2 cells, which was inhibited by pre-incubation of cells

with LPS-RS. The error bars indicate standard deviation (n=4-5). *** shows that results are statistically significant at p ≤ 0.001 in comparison to medium treated cells and InAc-NPs treated cells as determined by one-way ANOVA followed by Dunnett's multiple comparison tests (3A and 3C) or Bonferroni's multiple comparison tests for (3B and 3D) respectively. 3E-H. InAc-NPs activate swine and human peripheral blood mononuclear cells (PBMCs). Swine and human PBMCs were treated with PLGA-NPs or InAc-NPs (200 µg/ml). The activation of PBMCs was investigated after 24 h by determining the mRNA levels of IL-6 (3E), IL-12 (3F), and TNF-α (3G) in swine PBMCs and IL-6 (3H) in human PBMCs using real-time PCR. The mean fold change in mRNA levels was compared with non-stimulated cells. The standard deviation is represented as error bars. * (p ≤0.05), ** (p ≤0.01), and *** (p ≤0.001) indicates that the results are statistically significant compared to untreated cells as calculated using one-way ANOVA and Bonferroni’s post-hoc test. 20 ACS Paragon Plus Environment

Page 21 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


D. Groups

PBS FITC-Ova solution FITC-Ova-PLGA-NPs FITC-Ova-InAc-NPs

Mean fluorescence intensity (counts) ± Standard deviation

% Green cells

1h

12 h

1h

12 h

1570 ± 112.34 1581.29 ± 29.41 2581.25 ± 44.08 7854 ± 364.96 a, b

1482.67 ± 8.50 1578.33 ± 34.85 2288.5 ± 10.77 9130.56 ± 659.40 a, b

3.89 ± 2.94 11.47 ± 3.72 61.53 ± 1.28 98.33 ± 0.72 a, b

5.92 ± 0.49 18.60 ± 0.53 78.27 ± 036 98.35 ± 2.12 a, b



Page 22 of 44

E. FITC-Ova in Solution

FITC-Ova in PLGA-NPs

FITC-Ova in InAc-NPs

Figure 4. (A-C) InAc-NPs promote the maturation of APCs. Murine macrophage cell (NR9456) were stimulated with MPLA 2 µg/ml or InAc-NPs 250 µg/ml or left untreated for 48 h. Murine macrophage cells (NR-9456) were harvested and subsequently incubated with red fluorescent polystyrene beads (0.2 µm in size) at 1:10 cells to beads ratio for 1 h and the phagocytic activity was quantified using flow cytometry (A). DC2.4 cells were stained with fluorescently labelled antibodies against the marker proteins CD40, CD86 (B), MHC-I & MHCII (C) and analyzed via flow-cytometry for their surface expression. * (p ≤ 0.05), ** (p ≤ 0.01), and *** (p ≤ 0.001) indicates that the results are statistically significant compared to medium treated cells using two tailed unpaired t-test. D). Quantification of antigen delivery to DCs by InAc-NPs. FITC-ova was delivered either in PBS, PLGA-NPs, or InAc-NPs. The letters “a” and “b” represents that the values are significantly different at p ≤ 0.0001 as compared to FITC-ova and FITC-Ova-PLGA-NPs, respectively as calculated using one-way ANOVA and Bonferroni’s post-hoc test. E Intracellular localization of antigen. FITC-Ova was delivered to DC2.4 cells as a soluble antigen or in particulate form using PLGA-NPs or InAc-NPs. The cells were processed as mentioned in the methods section and imaged using confocal microscope. The


Page 23 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


image represents a single optical section (z-axis) image through the cell. The cyan color represents the nucleus stained with DAPI. 3.4 Safety of InAc-NPs The safety of InAc-NPs based vaccine delivery system was assessed using multiple approaches. In-vitro cytotoxicity studies indicate that InAc-NPs upto 500 µg/ml did not significantly alter the viability of DCs (Figure 5A). In mice studies, injecting 2 mg of InAc-NPs, injection site did not show any depot formation or damage of tissue as observed through histochemistry sections (H&E staining). However, CFA showed a depot formation with distinct tissue damage at the injection site (Figure 5B). Furthermore, in-vivo imaging of mice after injecting near-IR dyeloaded InAc-NPs showed that the InAc-NPs were cleared from the injection site within 36 h of injection (Figure 5C). The above data (Figure 5A-C) suggests that InAc-NPs are safe to administer as a vaccine delivery system37.



Page 24 of 44

Figure 5. 5A. In-vitro cellular viability of InAc-NPs. DC2.4 cells were treated with varying concentrations of InAc-NPs (0- 500 µg/ml) for 24 h. The relative cellular viability is determined using MTT assay. The non-treated cells were used a control. The experiments were performed in multiples of triplicates or more the data is represented as mean ± standard deviations. 5B. Skin toxicity of InAc-NPs. Histology images of mouse skin sections stained with H&E at the site of injection (2 mg of InAc-NPs) showed intact structures of the skin without major damage. 5C. Invivo clearance of InAc-NPs from the injection site. Mice were injected with 1 mg of InAc-NPs loaded with near-IR dye on the right foot pad. The clearance of vaccine from the injection site was studied by imaging the mice at different time points after injection till 30 h. 24 ACS Paragon Plus Environment

Page 25 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.5 InAc-NPs Generated Strong Serum Antibody Titers against an Encapsulated Antigen After establishing the in-vitro potential of InAc-NPs as a DC-targeting immune active vaccine delivery system, we tested the ability of InAc-NPs containing ova as the encapsulated antigen to stimulate immune responses (humoral and cellular). The dose sparing effect was studied by performing immunization at three different doses of the antigen as mentioned in the methods section (Figure 6A-I). The magnitude of antibody responses generated after 3 weeks of immunization by InAc-NPs was robust as compared to ova in solution without an adjuvant at all dose levels of ova (total IgG, 130 times; IgG1, 28 times; IgG2a, 125 times at 1 µg dose), (Total IgG, 20 times; IgG1, 10 times; IgG2a, 31 times at 10 µg dose) and (Total IgG, 7.5 times; IgG1, 217 times; IgG2a, 8 times at 100 µg dose). High IgG2a titers indicate an immune signaling for the cell-mediated immune response. Dose-sparring study indicates that even at lower doses of a weak antigen like ova (1 μg), InAc-NPs stimulated the high systemic antibody titers in the serum (Figure 6) compared to ova in saline at 100 µg dose (IgG1, 1.57 times; IgG-total, 1.66 times; and IgG2a, 29.8 times).



A.

1000000

Ova 1µg loaded InAc NPs ***

***

~28 times

10000

100000

Titer

100

10

10

1

1 a

~130 times ***

Ova 1µg loaded InAc NPs

***

100000

10 1

b

a

10000

*** ***

10

1000

a

10

1

G.

1

b

a

Ova 1µg

Ova 10µg

~28 times

10000



***

***

~2.2 times

10

100

***

10

1

1 b

***

100

10

1

~217 times

~5 times 1000

Titer

Titer

***

CFA 100µg

Ova 100µg loaded InAc NPs *** ***

***

100

a

100000

10000 1000

~1.5 times

Ova 100µg

~10 times

CFA 10µg

*** *** 1000

b

I.

H.

CFA 1µg

~7 times

1000

10

a

***

***

10000

100

b


100000

100

1

~7.5 times

CFA 100µg

1000000

***

Titer

Titer

100

Ova 100µg 10000000

***

10000

1000

b

F.

***

100000

1000 100

~10 times

1000000

~20 times

***

10000

Ova 10µg ~20 times CFA 10µg Ova 10µg loaded InAc NPs ***

10000000

~6 times

100000

E.

CFA 1µg


1000000

*

b

Ova 1µg

~8 times

CFA 100µg

10000000

***

a

D.

Titer

~15 times

Ova 100µg

1000

100

10000

***

10000

*** ***

1000

1000000

Ova 10µg ~31 times CFA 10µg Ova 10µg loaded InAc NPs ***

Titer

100000

Titer

~125 times

CFA 1µg

1000000

C.

B. Ova 1µg

Titer

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 44

a

b

a

b

Figure 6. InAc-NPs stimulated robust antigen specific serum antibody titers (total IgG (AC), IgG1 (D-F), and IgG-2a (G-I)): A Dose-Sparing Effect. Mice (4-5 per group) were administered subcutaneously with ova (1, 10 and 100 µg) in saline, in CFA or inside InAc-NPs as primary and booster doses on day 1 and 21, respectively. Group ‘a’ and ‘b’ represents serum IgG titers determined 3 weeks after primary and booster immunizations, respectively. The titers are represented on Log10 scale. Results are statistically significant (*** p ≤ 0.001, one-way ANOVA along with Bonferroni’s post-hoc tests). 26 ACS Paragon Plus Environment

Page 27 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.6 InAc-NPs Induced Strong Memory Cell and Cytokine Response Stronger cytokine response is an indication of strong immune stimulation and the cytokine pattern informs about the polarization of immune stimulation towards humoral and/or cellmediated immunity. An ex-vivo culture of splenocytes isolated from the immunized mice was challenged with the antigen. The splenocytes isolated from the mice immunized with InAc-NPs as a delivery system secreted significantly higher levels of IFN-γ, IL-2 (Th1-type) (Figure 7A), IL-10 and IL-4 (Th2-type) (Figure 7B) cytokines into the supernatants. Although, IFN-γ response by memory cells in splenocytes from InAc-NPs immunized mice was not significantly higher than saline immunized mice splenocytes, the serum IgG2a titers were very high with InAc-NPs as a delivery system (Figure 6). These two observations are not co-related may be due to the fact that the cytokine response studied in this manuscript is an ex-vivo experiment and the antibody response is an in-vivo study and murine IgG2a could be generated independent of IFN-γ through CD40 ligation38. The response pattern is similar at various doses of the antigen tested during the vaccination. The cytokine data is consistent with the serum antibody response (Figure 6) that suggests a very strong humoral and cell-mediated immune response when the antigen is delivered through InAc-NPs based vaccine delivery system. The data here represents the global view on the memory response in mice. More detailed studies on the ability of InAc-NPs on generating the specific type of memory cells will be studied in future, which may include the



Page 28 of 44

percent of B220-/lowCD138+ plasma cells, GL7+CD95+ GC B cell as well as T memory cells.

Figure 7. Cytokine response from Ex-vivo culture of splenocyte. Splenocytes were isolated from mice immunized with 1-100 µg of antigen (Ova) using various delivery systems (Saline, CFA or InAc-NPs). The splenocytes were challenged with Ova (100 µg/ml) in the culture. After 72 h, the cytokines levels was evaluated in the cutlure medium using ELISA. The results are statistically significant at p ≤ 0.05 (*) and p ≤ 0.001 (***) compared to the saline group as calculated using student’s t-test. 28 ACS Paragon Plus Environment

Page 29 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.7 InAc-NPs Prevent the Metastasis of Melanoma Cells to Lungs in Mice The translational potential of InAc-NPs as dendritic cell targeted vaccine delivery system in preventing the metastasis of melanoma cells to lungs was evaluated. The mice received immunization twice on day 0 and 14 as primary and booster doses. The mice on day 21 were injected intravenously with 200,000 B16-F10-Ova tumor cells. B16-F10-Ova cells are murine melanoma cells that are modified genetically to express the antigen ovalbumin. After 28 days of injecting cells, the mice were euthanized and the tumor foci at the lungs were counted. As shown in Figure 8, metastatic lesions were completely absent in the lungs from the mice immunized with InAc-NPs based vaccine. In contrast, saline or peptide vaccine without the adjuvant could not prevent the metastasis of injected melanoma cells to the lungs (Figure 8). Quantifying the nodules showed that there was a complete absence of metastatic lesions in the mice immunized with InAc-NPs, which contrasts with mice immunized with ova (12.37 ± 3.92) or PBS (20.62 ± 4.62).



Page 30 of 44

Figure 8. Efficacy of InAc-NPs to induce an antitumor immune response to prevent tumor metastasis. Mice (n=8/group) were immunized subcutaneously with following formulations: (i) saline (ii) 50 µg of ova in saline and (iii) 50 µg ova encapsulated InAc-NPs on day 0 and day 14. Mice were injected intravenously with 2×105 B16-F10-Ova tumor cells (day 21). After 28 days of tumor cell injection, the mice were euthanized and the tumor foci on the lungs were pictured (8A) and counted (8B). *** indicates the values statistically significant at p ≤ 0.001 (compared to ova) calcuated by one-way ANOVA.


Page 31 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4. DISCUSSION The DCs represent professional APCs that are crucial in directing the adaptive immunity17. Therefore, DCs have become one of the sought after targets for vaccine development against cancer, malaria and HIV etc.

14, 17, 20-21, 39

. Despite being the prime target, there exist numerous

challenges in creating successful DC based vaccines. One of these challenges is the availability of a safe drug delivery technology that efficiently delivers sufficient antigen to DCs, and simultaneously, activates and initiates the immune-signaling for the desired response. In this direction, the current work focuses on the design of an effective nano-vaccine delivery system that mimics pathogens to be efficiently recognized by DCs and activates DCs to produce a robust immune response without the risk of developing an infection. Despite tremendous progress in our understanding of the immune regulation over the past half-century, our ability to rationally design vaccine platforms largely remains an effort of trialand-error. Currently, alum has been a part of most of the marketed vaccines as an adjuvant. However, alum has the limitation that it cannot induce a cellular immune response. Besides alum, there is a serious paucity in the availability of safe adjuvants in the vaccine market31. The direction of current research for the development of vaccine adjuvants mainly targets PRRs such as TLRs esp. TLR4 for stimulating cell-mediated immunity30-32. Previously, our laboratory has discovered a plant-based polymer InAc as a novel TLR4 agonist for a vaccine design28-29. InAc is the first plant polysaccharide, polymer-based TLR4 agonist. It is not as potent as MPLA. Such milder activity makes it suitable as a biologically biomaterial for particulate vaccines. In this manuscript, utilizing InAc (a novel immune-active polymeric material), a nano-vaccine delivery system was designed to mimic pathogens on multiple aspects; being water insoluble, foreign, with the ability to contain multiple antigens, recognition by DCs to activate them to initiate



Page 32 of 44

inflammatory signaling cascade. InAc-NPs are unique and distinct compared to other discovered vaccine adjuvants; as they function both as a deliver system like PLGA particles and as an adjuvant like MPLA29. InAc-NPs as a unique delivery system, carry well-established advantages of NPs such as; a) potential to encapsulate target antigen, thereby protecting it from degradation, b) controlled the release of antigens that promotes stronger immune stimulation, and c) better recognition by APCs, which leads to improved antigen delivery28. Being prepared with a TLR4 ligand and of the size of pathogens, InAc-NPs are better recognized and phagocytosed by DCs (Figure 4D). This leads to significantly higher efficiency of InAc-NPs in delivering antigen compared to PLGA-NPs prepared with an inert polymer. In addition, the antigens from InAc-NPs released slowly and steadily over a period after the initial burst release. Such dual-release pattern is a common feature of hydrophobic polymeric particles encapsulated with soluble antigen, which is beneficial during vaccine delivery. The sustained release could have implications depending on the site of drug release; sustained release from a depot at injection site vs persistent release inside APCs after the uptake of the particles. Importantly, in case of InAc-NPs there is no depot formation the injection site unlike microparticles (~ 1.5 µm in diameter) prepared with InAc (data not shown). They are cleared from the site of injection within 36 h of injection similar to other NPs37. Depot formation, which contributes to the persistence of antigen, is assumed to be one of the mechanisms of various vaccine adjuvants40. The effect of such antigen persistence at the injection site on immune stimulation is complex and yet to be clearly understood40. Formation of a sustained depot with persistent antigen without co-stimulatory molecules could lead to T-cell sequestration and deletion, which could be detrimental to the vaccine efficiency41. As a vaccine adjuvant, InAc-NPs activated and promoted the maturation of DCs (Figure 3 and


Page 33 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4). Upon vaccination, dendritic cell activation is crucial in directing the strength and nature of immune response

17, 20

. Being prepared with a material that simulates PAMPs (a TLR4 ligand),

InAc-NPs are better recognized by naïve DCs as pathogens28, and importantly, promoted their activation and maturation as shown by an enhanced expression of maturation markers (CD40, CD86, MHCI and MHCII) (Figure 3E-H). These markers facilitate efficient antigen presentation and communication with the adaptive immune system to direct robust cellular immunity mediated by T-cells. The interaction of CD80/86 on APCs with CD28 that is present on T-cell plays a crucial role in T-cell survival and activation. Similarly, the interaction of CD40 on APCs and CD40L, expressed during the inflammation on T-cells for transient period, controls the strength and nature of the immune response42-43. The observations that the activation of DCs and HEK cells that exclusively express TLR4 could be inhibited by pre-incubation with a TLR4 antagonist clearly suggests that InAc-NPs stimulate immune cells through the activation of TLR4. This observation doesn’t exclude the contribution of other mechanisms for the immunestimulatory properties of InAc-NPs. Indeed, certain isoforms of inulin are shown to activate immune system through the alternate complement pathway (ACP)44. However, previous studies from our laboratory have shown that InAc doesn’t activate ACP28. InAc activates TLR4 as shown by results from this and previous studies28. The two main signaling pathways that mediate TLR4 activation involve MyD88 or TRIF

45

. InAc activated TLR4 on mouse APCs

through MyD88-dependent pathway28. As expected, InAc-NPs also activated primary immune cells (PBMC) from two other higher order species (swine and humans) and increased the gene expression of important cytokines that play essential role for strong immune response to vaccines (Figure 3E-H).



Page 34 of 44

The success of vaccine technology is judged on the strength and nature of the immune response generated. Vaccination in mice showed that InAc-NPs could generate a robust antibody immune response, similarly to the vaccine that contained CFA as an adjuvant. CFA is one of the most potent immune stimulators; however, it produces granuloma and tissue damage at the injection site. However, unlike CFA, InAc-NPs are cleared from the injection site and did not produce any local toxicity or phlebitis. They are safe to administer and produce a strong immune response without depot formation. The antibody response by InAc-NPs as a delivery system was so strong that even at 100 times less antigen dose (1 μg), InAc-NPs produced higher antibody titers compared to unadjuvanted antigen at 100 μg dose (IgG1, 1.57 times; IgG-total, 1.66 times; and IgG2a, 29.8 times). This strong dose-sparing effect by InAc-NPs not only reduces the cost of a vaccine but also eases the anticipated shortage of antigen during mass vaccination against pandemic infections. One of the areas of emphasis by the World Health Organization has been to develop vaccine-adjuvant pairs that could improve immunogenicity while sparing the antigen and inducing protective immunity, especially for influenza46-47. Stimulating innate immune signaling by a TLR4 agonist, including InAc-microparticles,

provides robust

humoral and cell-mediated immunity48. The efficiency of InAc-NPs–based vaccine delivery system was tested in preventing the metastasis of mouse melanoma cells (B16F10-Ova). As shown in Figure 8, InAc-NPs completely prevented the metastasis of melanoma cells in 100 % of vaccinated mice. Immunetherapies including vaccinations are gaining more attention as adjuvant therapies after surgical resection for stage III melanoma or as primary therapy for stage IV disease49. InAc-NPs will not only provide a great platform for the delivery of melanoma antigens, but also function as a vehicle for a multimodal cancer vaccine that could include an antigen, a CTLA-4 and PD-1 (T-


Page 35 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cell check-point) inhibitors, other TLR agonists, and CD40 inhibitors, etc. Numerous studies are underway on the identification of novel cancer-specific antigens. The antigens could be either a well-established peptide from melanocytes (gp100 or TRP2) or a patient-specific tumor antigen identified due to the recent advancement of next generation sequencing. The overall goal is to drive enough activated antigen-specific T-cells at the tumor site. The duration of the antigen persistence and its location control the antigen-specific T-cells number and their phenotype. Overly persistent antigen as a depot at the injection site could potentially misdirect the T-cells away from the tumor site, leading T-cell sequestration and deletion41. As InAc-NPs are cleared within hours from the injection site, without forming a depot precludes the abovementioned undesired effects of antigen persistence. In contrast, particles prepared with hydrophobic InAc polymer deliver high amounts of antigen to APCs as they mimic pathogens and interestingly, the delivered antigen persists inside APCs for more than ~24 h28. Such longer antigen presentation and stimulation (~20 hours) of APCs is critical for overall adaptive T-cells function 49-50. Previously, particles prepared with InAc as polymer are shown to stimulate strong memory response in mice29. However, in this manuscript, the memory cell response was measured through the function of memory cells (splenocytes) in response to ex-vivo challenge with the antigen as determined by an enhanced release of IFNγ, IL-2, IL-10 and IL-4 (Figure 7). In this study, for the first time it has been shown that multifunctional InAc-NPs prepared with a polymer-based TLR4 agonist provide an efficient multi-functional platform technology for the delivery of cancer vaccine. The delivery system it-self activates the dendritic cells. Further studies are underway to investigate the application of InAc-NPs with tumor-specific antigens, in combination with other TLR-agonists and various routes of administration.



Page 36 of 44

5. CONCLUSIONS In summary, using a multidisciplinary designing approach, an immune-active nanovaccine delivery system was designed (InAc-NPs) that targeted the TLR4 signaling on dendritic cells for their activation and maturation. Safety of InAc-NPs was demonstrated by their quick clearance from the injection site and the absence of skin toxicity. In-vivo InAc-NPs generated very strong humoral responses. Using melanoma mouse model as a proof-of-concept, InAc-NPs based vaccine delivery system showed a great potential in preventing the metastasis of melanoma cells to lungs in 100 % of vaccinated mice. InAc-NPs demonstrate strong anti-tumor effect due to its multifunctional nature; an efficient delivery system and an immune adjuvant. InAc-based vaccine delivery system has a great potential in cancer immunotherapy and against various infectious diseases, (e.g., HIV, Hepatitis B, Influenza etc.), where both humoral and cellular immunity is required.

ACKNOWLEDGEMENTS The work is supported by the Animal Health and Production and Animal Products: Animal Health and Disease [SD00G647-17] from the USDA National Institute of Food and Agriculture and the college of pharmacy, SDSU.


Page 37 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1) Azzawi, M.; Seifalian, A.; Ahmed, W., Nanotechnology for the Diagnosis and Treatment of Diseases. Future Medicine. 2016, 11, 2025-2027. (2) Irvine, D. J.; Swartz, M. A.; Szeto, G. L. Engineering Synthetic Vaccines using Cues from Natural Immunity. Nat Mater. 2013, 12, 978-990. (3) Zupancic, E.; Curato, C.; Paisana, M.; Rodrigues, C.; Porat, Z.; Viana, A. S.; Afonso, C. A.; Pinto, J.; Gaspar, R.; Moreira, J. N. Rational Design of Nanoparticles towards Targeting Antigen-presenting Cells and Improved T cell Priming. J. Control. Release. 2017, 258, 182195. (4) Zhang, C.; Shi, G.; Zhang, J.; Song, H.; Niu, J.; Shi, S.; Huang, P.; Wang, Y.; Wang, W.; Li, C. Targeted Antigen Delivery to Dendritic Cell via Functionalized Alginate Nanoparticles for Cancer Immunotherapy. J. Control. Release. 2017, 256, 170-181. (5) Sahdev, P.; Ochyl, L. J.; Moon, J. J. Biomaterials for Nanoparticle Vaccine Delivery Systems. Pharm. Res. 2014, 31, 2563-2582. (6) Gregory, A. E.; Williamson, D.; Titball, R. Vaccine Delivery using Nanoparticles. Front. Cell. Infect. Microbiol. 2013, 3, 13. (7) Narasimhan, B.; Goodman, J. T.; Vela Ramirez, J. E. Rational Design of Targeted Nextgeneration Carriers for Drug and Vaccine Delivery. Annu. Rev. Biomed. Eng.. 2016, 18, 2549. (8) Ulery, B. D.; Petersen, L. K.; Phanse, Y.; Kong, C. S.; Broderick, S. R.; Kumar, D.; RamerTait, A. E.; Carrillo-Conde, B.; Rajan, K.; Wannemuehler, M. J. Rational Design of Pathogen-mimicking Amphiphilic Materials as Nanoadjuvants. Sci. Rep.. 2011, 1, 198.



Page 38 of 44

(9) Zhao, L.; Seth, A.; Wibowo, N.; Zhao, C.-X.; Mitter, N.; Yu, C.; Middelberg, A. P. Nanoparticle Vaccines. Vaccine. 2014, 32, 327-337. (10) Klinman, D. M.; Sato, T.; Shimosato, T. Use of Nanoparticles to Deliver Immunomodulatory Oligonucleotides. Wiley. Interdiscip. Rev. Nanomed. Nanobiotechnol. 2016, 8, 631-637. (11) Nakamura, T.; Moriguchi, R.; Kogure, K.; Harashima, H. Incorporation of Polyinosine– Polycytidylic acid Enhances Cytotoxic T cell Activity and Antitumor Effects by Octaarginine-modified Liposomes Encapsulating Antigen, but not by Octaarginine-modified Antigen Complex. Int. J. Pharm. 2013, 441, 476-481. (12) Wang, C.; Zhuang, Y.; Zhang, Y.; Luo, Z.; Gao, N.; Li, P.; Pan, H.; Cai, L.; Ma, Y. Tolllike Receptor 3 Agonist Complexed with Cationic Liposome Augments Vaccine-elicited Antitumor Immunity by Enhancing TLR3–IRF3 Signaling and Type I Interferons in Dendritic Cells. Vaccine. 2012, 30, 4790-4799. (13) Rizwan, S.; McBurney, W.; Young, K.; Hanley, T.; Boyd, B.; Rades, T.; Hook, S. Cubosomes containing the Adjuvants Imiquimod and Monophosphoryl lipid A Stimulate Robust Cellular and Humoral Immune Responses. J. Control. Release. 2013, 165, 16-21. (14) Shi, G.-N.; Zhang, C.-N.; Xu, R.; Niu, J.-F.; Song, H.-J.; Zhang, X.-Y.; Wang, W.-W.; Wang, Y.-M.; Li, C.; Wei, X.-Q. Enhanced Antitumor Immunity by Targeting Dendritic Cells with Tumor Cell Lysate-loaded Chitosan Nanoparticles Vaccine. Biomaterials. 2017, 113, 191-202. (15) Iwasaki, A.; Medzhitov, R. Toll-like Receptor Control of the Adaptive Immune Responses. Nat. Immunol. 2004, 5, 987-995.


Page 39 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(16) Iwasaki, A.; Medzhitov, R. Control of Adaptive Immunity by the Innate Immune System. Nat. Immunol.. 2015, 16, 343-353. (17) Lewis, K. L.; Reizis, B. Dendritic Cells: Arbiters of Immunity and Immunological Tolerance. Cold. Spring. Harb. Perspect. Biol. 2012, 4, a007401. (18) Thompson, A. G.; Thomas, R. Induction of Immune Tolerance by Dendritic Cells: Implications for Preventative and Therapeutic Immunotherapy of Autoimmune Disease. Immunol. Cell Biol.. 2002, 80, 509-519. (19) Steinman, R. M.; Hemmi, H. Dendritic Cells: Translating Innate to Adaptive Immunity. In From Innate Immunity to Immunological Memory; Springer: 2006; pp 17-58. (20) Steinman, R. M. Dendritic Cells in vivo: A Key Target for a New Vaccine Science. Immunity. 2008, 29, 319-324. (21) Klippstein, R.; Pozo, D. Nanotechnology-based Manipulation of Dendritic Cells for Enhanced Immunotherapy Strategies. Nanomedicine. 2010, 6, 523-529. (22) Leleux, J.; Roy, K. Micro and Nanoparticle-‐‑based Delivery Systems for Vaccine Immunotherapy: An Immunological and Materials Perspective. Adv. Healthc. Mater. 2013, 2, 72-94. (23) Mallapragada, S. K.; Narasimhan, B. Immunomodulatory Biomaterials. Int. J. Pharm. 2008, 364, 265-271. (24) Li, P. L.; Wang, F. S. Polysaccharides: Candidates of Promising Vaccine Adjuvants. Drug Discov Ther. 2015, 9, 88-93. (25) Cordeiro, A. S.; Alonso, M. J.; de la Fuente, M. Nanoengineering of Vaccines using Natural Polysaccharides. Biotechnol. Adv.. 2015, 33, 1279-1293.



Page 40 of 44

(26) Moreno-Mendieta, S.; Guillén, D.; Hernandez-Pando, R.; Sanchez, S.; Rodriguez-Sanoja, R. Potential of Glucans as Vaccine Adjuvants: A Review of the α-glucans Case. Carbohydr. Polym. 2017, 165, 103-114. (27) Villiers, C.; Chevallet, M.; Diemer, H.; Couderc, R.; Freitas, H.; Van Dorsselaer, A.; Marche, P. N.; Rabilloud, T. From Secretome Analysis to Immunology Chitosan Induces Major Alterations in the Activation of Dendritic cells via a TLR4-dependent Mechanism. Mol. Cell Proteomics. 2009, 8, 1252-1264. (28) Kumar, S.; Kesharwani, S. S.; Kuppast, B.; Rajput, M.; Bakkari, M. A.; Tummala, H. Discovery of Inulin Acetate as a Novel Immune-active Polymer and Vaccine Adjuvant: Synthesis, Material Characterization, and Biological Evaluation as a Toll-like Receptor-4 Agonist. J. Mater. Chem. B. 2016, 4, 7950-7960. (29) Kumar, S.; Kesharwani, S. S.; Kuppast, B.; Bakkari, M. A.; Tummala, H. PathogenMimicking Vaccine Delivery System Designed with a Bioactive Polymer (Inulin Acetate) for Robust Humoral and Cellular Immune Responses. J. Control. Release. 2017, 261, 263274. (30) Dowling, J. K.; Mansell, A. Toll-like Receptors: The Swiss Army Knife of Immunity and Vaccine Development. Clin. Transl. Immunol. 2016, 5, 1-10. (31) O'Hagan, D. T.; Fox, C. B. New Generation Adjuvants - From Empiricism to Rational Design. Vaccine. 2015, 33, B14-B20. (32) Reed, S. G.; Hsu, F.-C.; Carter, D.; Orr, M. T. The Science of Vaccine Adjuvants: Advances in TLR4 Ligand Adjuvants. Curr. Opin. Immunol.. 2016, 41, 85-90. (33) Kumar, S.; Tummala, H. Development of Soluble Inulin Microparticles as a Potent and Safe Vaccine Adjuvant and Delivery System. Mol. Pharm.. 2013, 10, 1845-1853.


Page 41 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(34) Muley, P.; Kumar, S.; El Kourati, F.; Kesharwani, S. S.; Tummala, H. Hydrophobically Modified Inulin as an Amphiphilic Carbohydrate Polymer for Micellar Delivery of Paclitaxel for Intravenous Route. Int. J. Pharm. 2016, 500, 32-41. (35) Shen, Z. H.; Reznikoff, G.; Dranoff, G.; Rock, K. L. Cloned Dendritic Cells can present Exogenous Antigens on both MHC class I and class II Molecules. J Immunol. 1997, 158, 2723-2730. (36) Park, B. S.; Song, D. H.; Kim, H. M.; Choi, B.-S.; Lee, H.; Lee, J.-O. The Structural Basis of Lipopolysaccharide Recognition by the TLR4–MD-2 Complex. Nature. 2009, 458, 1191-1195. (37) Jiang, H.; Wang, Q.; Sun, X. Lymph Node Targeting Strategies to Improve Vaccination Efficacy. J. Control. Release. 2017, 267, 47-56. (38) Griffiths, K. L.; Ahmed, M.; Das, S.; Gopal, R.; Horne, W.; Connell, T. D.; Moynihan, K. D.; Kolls, J. K.; Irvine, D. J.; Artyomov, M. N. Targeting Dendritic Cells to Accelerate Tcell Activation Overcomes a Bottleneck in Tuberculosis Vaccine Efficacy. Nat. Commun. 2016, 7, 1-13. (39) Awate, S.; Babiuk, L. A.; Mutwiri, G. Mechanisms of Action of Adjuvants. Front. Immunol. 2013, 4, 1-10. (40) Hailemichael, Y.; Dai, Z.; Jaffarzad, N.; Ye, Y.; Medina, M. A.; Huang, X.-F.; DortaEstremera, S. M.; Greeley, N. R.; Nitti, G.; Peng, W. Persistent Antigen at Vaccination Sites induces Tumor-specific CD8+ T cell Sequestration, Dysfunction and Deletion. Nat. Med.. 2013, 19, 465-472.



Page 42 of 44

(41) Fujii, S.-i.; Liu, K.; Smith, C.; Bonito, A. J.; Steinman, R. M. The Linkage of Innate to Adaptive Immunity via Maturing Dendritic Cells in vivo requires CD40 Ligation in Addition to Antigen Presentation and CD80/86 Costimulation. J. Exp. Med. 2004, 199, 1607-1618. (42) Schoenberger, S. P.; Toes, R. E.; van der Voort, E. I.; Offringa, R.; Melief, C. J. T-cell help for Cytotoxic T Lymphocytes is Mediated by CD40–CD40L Interactions. Nature. 1998, 393, 480-483. (43) Cooper, P. D. Vaccine Adjuvants Based on Gamma Inulin. Pharm Biotechnol. 1995, 6, 55980. (44) Lu, Y.-C.; Yeh, W.-C.; Ohashi, P. S. LPS/TLR4 Signal Transduction Pathway. Cytokine. 2008, 42, 145-151. (45) Palese, P. Making better Influenza Virus Vaccines? Emerg Infect Dis. 2006, 12, 61-65. (46) Baras, B.; Bouveret, N.; Devaster, J. M.; Fries, L.; Gillard, P.; Sanger, R.; Hanon, E. A Vaccine Manufacturer's Approach to Address Medical Needs Related to Seasonal and Pandemic Influenza Viruses. Influenza. Other. Respir. Viruses. 2008, 2, 251-260. (47) Morefield, G. L.; Hawkins, L. D.; Ishizaka, S. T.; Kissner, T. L.; Ulrich, R. G. Synthetic Toll-like Receptor 4 Agonist enhances Vaccine Efficacy in an Experimental Model of Toxic Shock Syndrome. Clin Vaccine Immunol. 2007, 14, 1499-1504. (48) Rodriguez-Cerdeira, C.; Gregorio, M. C.; Lopez-Barcenas, A.; Sanchez-Blanco, E.; Sanchez-Blanco, B.; Fabbrocini, G.; Bardhi, B.; Sinani, A.; Guzman, R. A. Advances in Immunotherapy for Melanoma: A Comprehensive Review. Mediators. Inflamm. 2017, 2017,1-14.


Page 43 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(49) van Stipdonk, M. J.; Hardenberg, G.; Bijker, M. S.; Lemmens, E. E.; Droin, N. M.; Green, D. R.; Schoenberger, S. P. Dynamic Programming of CD8+ T Lymphocyte Responses. Nat. Immunol. 2003, 4, 361-365. (50) Blair, D. A.; Turner, D. L.; Bose, T. O.; Pham, Q.-M.; Bouchard, K. R.; Williams, K. J.; McAleer, J. P.; Cauley, L. S.; Vella, A. T.; Lefrançois, L. Duration of Antigen Availability Influences the Expansion and Memory Differentiation of T cells. J. Immunol. 2011, 18, 2310-2321.



Page 44 of 44

Graphical Abstract


Dendritic Cell Targeted Nanovaccine Delivery System Prepared with

Recommend Documents