Detection of Almond Allergen Coding Sequences in Processed Foods

Article pubs.acs.org/JAFC

Detection of Almond Allergen Coding Sequences in Processed Foods by Real Time PCR Nuria Prieto,†,‡ Elisa Iniesto,†,‡ Carmen Burbano,§ Beatriz Cabanillas,∥ Mercedes M. Pedrosa,§ Mercè Rovira,⊥ Julia Rodríguez,∥ Mercedes Muzquiz,§ Jesus F. Crespo,∥ Carmen Cuadrado,*,§ and Rosario Linacero† †

Departamento de Genética, Facultad de Biología, Universidad Complutense de Madrid, 28040 Madrid, Spain Departamento de Tecnología de Alimentos, SGIT-INIA, Carretera La Coruña Km 7.5, 28040 Madrid, Spain ∥ Servicio de Alergia, Instituto de Investigación Hospital 12 de Octubre (i+12), Avenida de Córdoba s/n, 28041 Madrid, Spain ⊥ Institut de Recerca i Tecnologia Agroalimentàries IRTA-Mas de Bover, Carretera Reus-El Morell Km 3.8, 43120 Constantí, Spain §

S Supporting Information *

ABSTRACT: The aim of this work was to develop and analytically validate a quantitative RT-PCR method, using novel primer sets designed on Pru du 1, Pru du 3, Pru du 4, and Pru du 6 allergen-coding sequences, and contrast the sensitivity and specificity of these probes. The temperature and/or pressure processing influence on the ability to detect these almond allergen targets was also analyzed. All primers allowed a specific and accurate amplification of these sequences. The specificity was assessed by amplifying DNA from almond, different Prunus species and other common plant food ingredients. The detection limit was 1 ppm in unprocessed almond kernels. The method’s robustness and sensitivity were confirmed using spiked samples. Thermal treatment under pressure (autoclave) reduced yield and amplificability of almond DNA; however, high-hydrostatic pressure treatments did not produced such effects. Compared with ELISA assay outcomes, this RT-PCR showed higher sensitivity to detect almond traces in commercial foodstuffs. KEYWORDS: almond nut, allergen detection, real time-PCR, processed foods, thermal processing, pressure processing

■

INTRODUCTION In developed contries, food allergy is considered an important health problem. Its prevalence is about 3% in adults and 6 to 8% of the pediatric population.1 Its clinical manifestations can be gastrointestinal, cutaneous, systemic, or respiratory symptoms, and even life-threatening anaphylaxis can be induced with some foods.2,3 Tree nuts are one of the eight groups of potentially allergenic foods known to be responsible for almost 90% of human allergies caused by food ingestion. Almond (Prunus dulcis Miller) is currently the main tree nut crop in world production regarding plantings and value of its raw and processed kernels. Almond nut consumption could produce numerous immune reactions, including life-threatening anaphylaxis.4,5 So far, eight allergenic proteins have been described in almond: Pru du 1 (PR-10 protein), Pru du 2 (thaumatin-like protein), Pru du 2S albumin, Pru du 3 (lipid transfer protein), Pru du 4 (profilin), Pru du 5 (60S ribosomal protein), Pru du 6 (11S-legumin), and Pru du γ-conglutin (7S vicilin).6 Of these eight allergens, Pru du 3, Pru du 4, Pru du 5, and Pru du 6 are recognized as such and included in the WHO−IUIS allergen list. Foods are subjected to several processing methods in order to improve their quality and safety. Thermal processing can degrade food constituents, modify them, or facilitate interactions with other food matrix components; therefore, this processing can modify allergenic properties of food proteins.7 Thermal sterilization is still the most widely used method of food preservation.8 Its basic function is to inactivate food spoilage by microorganisms in sealed containers of food © 2014 American Chemical Society

using heat treatments at temperatures above the boiling point of water in pressurized steam retorts (autoclaves).9 However, emerging technologies, such as high hydrostatic pressure (HHP), act by inactivation of microorganisms without the need for substantial heating.10 HHP-treated foodstuffs are normally exposed for periods of a few seconds up to several minutes to hydrostatic pressures above 150 MPa.11 These treatments have the potential to modify food proteins, which could alter food allergenicity, i.e., increasing or decreasing IgE reactivity.12,13 From current information is not possible to identify which variables could be employed in the analysis of the effect of processing on protein allergenicity.1,14,15 To date, the effects of HHP on food allergenicity have been studied in beef,16,17 apple,14,18 celery,14 peanut,18 and nuts such as almond.19 HHP did not affect most food allergens, and even an increase of soybean antigenicity has been reported.20 However, there is scarce information on the effects of such food processing techniques on almond allergenicity. The European regulation (EU) 1169/2011/EC21 requires labeling of food products regarding the contents of almond and other allergenic components. Similar requirements are in use in the USA22 and in other countries. Several methodologies can be applied to detect potential allergens in foods.3 According to these authors the limit of detection (LOD) for food allergens Received: Revised: Accepted: Published: 5617

November 15, 2013 May 20, 2014 May 23, 2014 May 24, 2014 dx.doi.org/10.1021/jf405121f | J. Agric. Food Chem. 2014, 62, 5617−5624

Journal of Agricultural and Food Chemistry

Article

100,000; and 500,000 mg/kg (0.0001% to 50% w/w) of defatted raw almond flour “Marcona” in defatted peanut flour matrices were prepared to a final weight of 200 g. The analytical validation of the method was carried out with several commercial foods (biscuits, chocolates, etc.) obtained in local food markets. All samples were grounded and homogenized using a kitchen robot (Thermomix 31-1, Vorwerk Elektrowerke, GmbH & Co. KG, Wüppertal, Germany). Heat and High Hydrostatic Pressure (HHP) Treatments. Almond nuts were immersed in distilled water (1:5 w/v) and autoclaved using a Compact 40 Benchtop autoclave (Priorclave, London, U.K.) at 121 °C (120 kPa) and at 138 °C (260 kPa) for 15 and 30 min. Raw and autoclaved almond nuts were ground and defatted with n-hexane (34 mL/g of flour) for 4 h and air-dried after filtration of the n-hexane. High-pressure experiment conditions were carried out according to Omi et al.39 and Kato et al.40 Almond defatted flours were dissolved in distilled water (1:4 w/v) 20 h before HHP treatment, and the suspensions were subjected to HHP, using pressures of 300, 400, 500, and 600 MPa for 15 min in multivessel high-pressure equipment (HHP, ACB, France) at 15 °C. Genomic DNA Isolation. DNA was extracted using the CTAB/ phenol/chloroform-based method as previously described by Iniesto et al.33 DNA was cleaned using a silica membrane in a spin column from Power Plant DNA isolation kit (MoBio, CA USA) and finally eluted in 50 μL of H2O Milli-Q. The CTAB-based extraction was selected to obtain DNA from raw and processed almond (200 mg), as well as from spiked samples and complex food matrices (400 mg). DNA quantity and quality was determined with NanoDrop ND-1000 spectrophotometer (ThermoFisher, Waltham, MA, USA) by measuring the absorbance at 230, 260, and 280 nm. DNA quality was also evaluated on 0.8% agarose gels. Conventional PCR, Cloning, Sequencing, and RT-PCR Primer Design. Sets of primers were designed with Oligo Primer Analysis Software on the target coding sequences of the six Pru du genes (data not shown). The four most sensitive and specific to evaluate the almond content were used: Pru du 1 (GenBank accession no. EU424247.1, Pru du 1f AGTGTATTGTGATTGGCTCCC; Pru du 1r AGTCTTTGGCTTGCATTTGG), Pru du 3 (GenBank accession no. FJ652103, Pru du 3f GGCGGTGATGTGCTGC; Pru du 3r TGTAAGGGATGCCATTGACGG), Pru du 4 (GenBank accession no. AY081850.1 Pru du 4f AGTACGTCGATGACCACTTGA; Pru du 4r CTTAACAGTAATGCCACCAGA), and Pru du 6 (GenBank accession no. GU059261.1 Pru du 6 f GACAACCACATTCAGTCC; Pru du 6r CTTGTTGTTGCGGGTTA). These primers were used in conventional PCRs. The PCR reactions were carried out using DNA from the cultivars Marcona, Vairo, and Francoli ́ of almond, and the resulting amplicons were cloned in TOPO TA Cloning Kit (Invitrogen, Inc., U.K.), according to the manufacturer’s instructions. Plasmid DNA was extracted using High Pure Plasmid Isolation Kit (Roche, Germany) and sequenced in an ABI PRISM 3700 sequencer (Applied Biosystems, Foster City, CA, USA) from “Unidad de Genómica, ́ Parque Cientifico de Madrid”. DNA sequences were edited using Chromas Pro 1.22 software (Technelysium Pty, Ltd., Australia). These sequences were compared with those present in the GenBank (NCBI) nonredundant nucleotide (nr/nt) databases through BLAST. Alignments between sequences of the same amplicon obtained from the three cultivars were performed using the ClustalW algorithm.41 Specific almond primer for real-time PCR was designed from the conserved sequences of Pru du 1, 3, 4, and 6 by Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA) (data in Table 1 of Supporting Information). Primers met the following requirements: length between 20 and 24 bases and to produce an amplicon between 75 and 150 bp. A conventional PCR was performed using these pairs of primers in order to amplify the genomic DNA sequences of Pru du genes. The PCR products were electrophoresed on 2% agarose gels. The specificity of all primers was assessed by testing the amplification of non-almond DNA extracts from a wide variety of plant samples. The conventional PCR reactions were carried out in 20 μL, containing 10 ng of DNA, 0.25 μM of each primer and 1× Taq PCR Master Mix (Qiagen, Germany). SensoQuest LabCycler (Progen

should be less than 100 mg/kg. Data from a Spanish retrospective study indicated that 119 out of 530 food allergic reactions in adults were due to the exposure to “hidden” allergens which were not described in the label.23 Since food contamination with hidden allergens might happen at any processing stage, some analytical approaches are necessary in order to ensure food safety for allergic consumers. Enzyme-linked immunosorbent assay (ELISA) is the most common protein detection method used to detect the presence of food allergens in complex matrices. Currently, several almond specific ELISA assays are on the market.6 However, as the food proteins could be affected by high temperature or high pressure and, hence, the integrity of the allergenic proteins too, consequently, the reliability of techniques based on protein for processed foods could be disminished.7,18 A DNA-based method could be an advantegeous alternative for allergen detection, in which specific DNA sequences amplified by the polymerase chain reaction (PCR) are the target molecules. In spite of these techniques representing an indirect approach to detection of the allergenic components, DNA-based methods have higher stability vs seasonal and geographical variations than proteins and DNA is less affected and more efficiently extracted at severe conditions from food matrices.3 Quantitative real-time PCR using fluorescence probes has been the most widely applied PCR strategy to detect food allergens. The target sequences of DNA could be a species-specific region of the allergenic food genome or gene coding for an allergenic protein.24 Real-time PCR has been used to detect almond in food samples using different target sequences and dying methods.25−31 It is important to study the effects that food processing might exert on the detection of almond-allergen specific markers because consumers are commonly exposed to processed ingredients in complex food matrices.32 The effects of hightemperature and/or high-pressure processing on the detectability of DNA targets in complex food matrices have been analyzed in peanut24 and hazelnut.33,34 The aim of the present study was to set up and to analytically validate a quantitative SYBR Green real-time PCR method using specific primer sets designed de novo on Pru du 1, Pru du 3, Pru du 4 and Pru du 6 allergen-coding sequences in order to improve the sensitivity of RT-PCR techniques for detection of traces of almonds in commercial foods. In addition, how the detectability of almond DNA targets in complex food products is affected by high-temperature and/or high-pressure treatments was also analyzed.

■

MATERIALS AND METHODS

Samples. Almond cultivars (Prunus dulcis Miller) used in this work were provided by the almond collection of Institut de Recerca i Tecnologiá Agroalimentàries (IRTA-Mas de Bover, Tarragona, Spain). The four cultivars used were “Nonpareil”, “Marcona”, “Francoli”,́ and “Vairo”. “Nonpareil” and “Marcona” are both traditional cultivars of Californian and Spanish origins, respectively. “Nonpareil” is the main cultivar worldwide and used as reference. “Marcona” is a highly reputed cultivar used mainly in the Spanish almond industry.35 “Francoli”́ and “Vairo” are both new releases from the IRTA’s almond breeding program.36−38 DNA from other Prunus species (peach P. persica, cherry P. avium, sand-cherry P. besseyi, bird-cherry P. padus, flowering almond P. triloba), other Rosaceae species as Malus f loribunda and other common food plant species used as food ingredients (hazelnut, walnut, peanut, rice, wheat, barley, and rye) were employed in specificity analysis. To prepare the standards or spiked samples, binary mixtures containing 1; 10; 100; 1,000; 10,000; 5618

dx.doi.org/10.1021/jf405121f | J. Agric. Food Chem. 2014, 62, 5617−5624


Article

Scientific Ltd., Germany) was used and the following PCR program: an initial denaturation step at 95 °C, 4 min, followed by 35 cycles of denaturation at 94 °C for 45 s; annealing at 62−64 °C for 1 min; elongation at 72 °C for 1 min; last step at 72 °C for 6 min. Real-Time PCR Conditions. Real-time PCR reactions were carried out in a volume of 20 μL, using 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Each reaction consisted of 10 μL of SYBR Premix Ex Taq (Takara, Japan), 2 μmol of primer, and a variable amount of template DNA. All samples were analyzed in duplicate. On each plate, at least two non template controls (NTC) were used to check the PCR performance. The following PCR program was used: initial denaturation at 95 °C for 10 min followed by 40 cycles of denaturation at 95 °C for 15 s and primer annealing and elongation at 60−65 °C for 1 min. Dissociation studies were performed on PCR products at a constant temperature increase (60−95 °C), recording fluorescence each 10 s. Standard curves for real-time PCR were generated using the cycle threshold (Ct) value obtained from 10-fold serial dilutions of almond genomic DNA. The efficiency of each reaction was calculated from the slope of the standard curve (Ct vs log DNA concentration) as indicated in the Applied Biosystems manual. Standard curves for realtime PCR were generated using the cycle threshold (Ct) value obtained from 10-fold serial dilutions of almond genomic DNA. The efficiency of each reaction was calculated from the slope of the standard curve (Ct vs log DNA concentration) as indicated in the Applied Biosystems manual. ELISA Assay. Almond protein detection by imunochemistry was performed using a commercial almond ELISA kit (RidaScreen Fast, RBiopharm, Germany) according to the manufacturer’s instructions. The kit includes microtiter strips coated with specific policlonal antibody against water-soluble almond proteins.

To test DNA quality the 260/230 and 260/280 ratios were employed since these components absorb at 230 nm and the proteins at 280 nm. By combining the CTAB−phenol−chloroform extraction with sample cleaning employing a silica membrane from Power Plant DNA Isolation Kit, the yield, concentration and quality of the extracted DNA were notably improved.33 This procedure was employed for all the DNA extractions producing a high yield of good quality DNA from raw and processed almond foods and giving 260/280 = 2.11 ± 0.04 and 260/230 = 1.98 ± 0.06 ratios for raw samples. Instead of a multiplex strategy, single RT-PCR reactions for each sequence were performed.27 This procedure allows the analysis of the effect of each sequence on the most relevant parameters of RT-PCR (specificity, amplification efficiency, and sensitivity) and to compare them. The SYBR Green I methodology has been chosen because, giving equal sensitivity and performance as the TaqMan one, its cost is lower.44 Specificity. Through DNA amplification from almond by PCR, a 100−103 bp amplicon for each primer pair tested was obtained (Table 1 of the Supporting Information). To assess their specificity, DNA from different species of Prunus and other common food plant species used as food ingredients (hazelnut, walnut, peanut, rice, wheat, barley, and rye) were used as templates in conventional PCR, and the results of the amplification were electrophoresed on agarose. Primers for Pru du 1 and Pru du 4 genes were 100% specific for almond, while primers for Pru du 3 and Pru du 6 also amplify from peach DNA a product of the target size. As an example, Figure 1a shows the amplification of Pru du 6 and Figure 1b corresponds to Pru du 1.

■

RESULTS AND DISCUSSION Gene Target Selection, Primer Design, and Sequence Analyses. To specifically detect genes coding for different almond allergens (Pru du 1, Pru du 3, Pru du 4, and Pru du 6), sequences from these genes deposited in the GenBank database of NCBI were chosen to design the primers. These primers were checked for their specificity utilizing BLAST and employed for the amplifications of partial allergen-coding sequences of three almond cultivars. This procedure makes it possible to assess the intraspecific polymorphism which could produce false negatives.42 All the amplicons showed the expected size, and their sequences were homologous to those employed for designing the specific primers (data in Table 1 of the Supporting Information). The sequences obtained for each primer pair from three cultivars (Marcona, Vairo, and Francoli)́ were aligned, showing a high similarity degree among them (Pru du 1 = 99.95%; Pru du 3 = 100%; Pru du 4 = 99.98%; Pru du 6 = 99%). The aligments were used to design the specific real-time PCR primers from each one of the target sequences. The coding sequences of Pru du 1 (PR-10 protein), Pru du 3 (LTP), and Pru du 4 (profilin) proteins were chosen as target sequences since, until now, there has not been a specific RTPCR method to detect them. So far, different RT-PCR protocols to detect almond have been developed by other authors,6,28 and Pru du 6 (11S) and a nsLTP related to Pru du 3 genes have been previously used as targets.27,28 Optimization of Real-Time PCR Assays with SYBR Green. The first step to develop a reliable real-time PCR protocol is to optimize the DNA extraction regarding yield and quality values. Such parameters are important for the optimal detection of the target sequences besides other real-time PCR requirements such as efficiency, Ct, and R2 values. As some nut components could inhibit polymerase reaction (polyphenols and fat),43 they have to be eliminated from the DNA sample.

Figure 1. Real-time PCR primers specificity. Amplicons obtained with Pru du 6 (a) and Pru du 1 (b) primer pairs in different Prunus-related species. Lanes 1−4: Prunus dulcis cv Marcona, Vairo, Francoli, and Nonpareil. Lane 5: P. persica. Lane 6: P. avium. Lane 7: P. besseyi. Lane 8: P. padus. Lane 9: P. triloba. Lane 10: Malus f loribunda. Electrophoresis in 2% (w/v) agarose gel. M: 100 pb ladder (Fermentas).

By the evaluation of the dissociation curves the primer specificity was confirmed (Figure 2). When DNA from almond cultivars was used as template, a single amplicon was observed and no amplification was detected from other plant samples. Similar results have been previously reported.25,27,45 Amplification Efficiency and R2 Coefficient. To estimate the reaction amplification efficiency in a RT-PCR procedure, the slope of the standard curve is used. According to the supplier’s instructions, a 100% efficient PCR reaction corresponds to a standard curve slope of −3.32. The R2 describes the correlation between the Ct value and the logarithm of the amount of DNA in the standard curve. In order to produce the standard curves, three different DNA extractions of raw almond were carried out, the DNA was 10 times serially diluted, and 5 μL of each dilution was used in the reaction tube. The values obtained for all standard curves were optimal in agreement to ENGL 5619



Article

Figure 2. Melting curve obtained by real time-PCR. Amplification with SYBR Green dye target Pru du 6 gene of almond and applied to other food samples. 1, 2 and 3: almond cultivars. 4−12: other plants.

acceptance criteria (slope between −3.1 and −3.6 and correlation coefficient higher than 0.98).46 The efficiency values were 102% for Pru du 1, 99.75% for Pru du 3, 99.75% for Pru du 4, and 97.5% for Pru du 6 (Figure 1 of the Supporting Information). By overlapping the 3 standard curves obtained from separate samples in independent assays, the interassay reproducibility was studied. The Ct values were similar for all the varieties used, and the mean slope varied between −3.22 for Pru du 1 and −3.49 for Pru du 6; therefore, according to these results it can be concluded that this RT-PCR method is highly reproducible. Sensitivity. At least three independent DNA extractions of almond have been used to assess the sensitivity of this RT-PCR protocol. Similarly to the efficiency experiments, the DNA was 10 times serially diluted, and 5 μL of each dilution was used in the reaction tube. The limit of detection (LOD) was 2.5 pg for Pru du 3 and 25 pg for Pru du 1, Pru du 4, and Pru du 6. This method allowed detection of a 1:10,000 dilution with the Pru du 3 primer pair. So far, the most sensitive RT-PCR method to detect almond had been described with the Pru du 5 probe, detecting up to 10 pg of almond DNA.6,25 In order to check the sensitivity of this procedure with food products, we carried out PCRs using defatted peanut flour mixed with known amounts of defatted almond flour (from 0.0001% to 1% w/w). The DNA of all spiking levels was extracted and analyzed by RT-PCR in duplicate. The LOD determined was 0.0001% w/w (1 mg/kg) of almond in peanut, that correspond to 1 ppm for the four allergen sequences. The literature on the specific detection of almond using real-time PCR reported a relative LOD of 50 mg/kg of almond in walnut,25 10 mg/kg of almond spiked in cookies,26 and 5 mg/ kg of almond in food products.28 Taking this into account, the present procedure showed a higher sensitivity than those

previously reported, this fact being its main advantage in comparison with others. The sensitivity of this method could be related to the use of SYBR Green methodology for detection. Although SYBR Green is a non sequence-specific binding system, it showed a sensitivity and efficiency as high as other systems used to trace almond allergens, such as TaqMan probes28 or high-resolution melting analysis.25 The SYBR Green I methodology has been chosen because, according to other authors, it gives equal sensitivity and performance as the TaqMan one, but with lower cost.44 Effect of High-Pressure and Autoclave Treatments. To investigate the action of high-pressure and thermal treatments on the detection ability of this RT-PCR procedure, a calibration curve for each primer pair (Pru du 1, Pru du 3, Pru du 4, and Pru du 6) was performed using DNA extracted from the spiked samples made by mixing defatted peanut and known amounts of defatted almond flour (from 1% to 50% w/w). A linear regression was obtained in all cases, by plotting the Ct values against the logarithm of the almond quantity (Figure 2 of the Supporting Information). To quantify the amount of almond DNA in unprocessed and processed samples, these curves were used. From each treatment three DNA extracts were obtained and analyzed in duplicate. The mean values were normalized to the almond content measured in the unprocessed samples. Data are shown in Figure 3. The autoclave treatment applied reduced significantly the ability to detect almond DNA. Similar results have been reported for hazelnut33 and peanut,24 all of which showed that thermal processing causes an important decrease in the DNA detectability when PCR methods are used. The samples treated only with high pressure did not show this reduction; on the contrary, the amount of almond detected in these samples was higher than in those untreated. These results could be related 5620



Article

smear at low molecular weight is observed when HHP treated samples are electrophoresed. HHP treatment of foods can be used to create new products (new texture or taste) or to obtain analogue products with minimal effect on flavor, color, and nutritional value and without any thermal degradation. The effect of HHP on allergenicity is being currently investigated mainly through changes in protein structure.48 Higher pressures can unfold the protein, and the usual pressure needed for the unfolding is about 500 MPa, but it can vary from protein to protein, ranging from 100 MPa to 1 GPa, or reaching even higher pressures in some cases.48 The effects of HHP on food allergenicity have been studied in beef,14,16−18 apple,14,18 celery,14 and nuts such as peanut.18 The DNA quality or integrity was also analyzed through amplificability studies in unprocessed and processed samples. For this objective the amount of DNA was standardized to 25 ng and the analysis was in duplicate. Unprocessed and highpressure-treated almonds presented similar low Ct values, 24.96 ± 0.01 and 24.54 ± 0.03, respectively, but thermally treated almond (autoclaved) had higher Ct values, 33.74 ± 0.5 at 121 °C 30 min and 30.31 ± 0.08 at 138 °C 30 min. These data confirmed that degradation of DNA produced in the heat processed samples reduced the ability to amplify and detect almond by qRT-PCR. Although the high-pressure treatments at low temperature can break the DNA, they have no effect on their amplificability, because the expected size of the fragments is probably over the amplicon size (around 100 bp). Scaravelli et al.24 report a considerable peanut DNA extraction decrease as thermal treatment increases while DNA quality or integrity is not reduced. Our present data corroborated that the thermal treatment here applied decreased the DNA yield, aside from the almond DNA integrity or quality, is also affected, as previously described in hazelnut by Iniesto et al.33 Such decrease was not detected in the almond samples treated only with high pressure at low temperature; on the contrary, the amount of almond detected in HHP treated samples was higher than in those untreated. This fact could be due to the smaller size of fragments, which makes their amplification easier. The effect of high-pressure treatments on the detection of allergenic tree nuts has been studied in hazelnut, where it did not affect the extraction yield, DNA quality, integrity, and amplicability.33 A similar conclusion has also been reported by other authors.34 They concluded that food processing affects hazelnut detection using real-time PCR as well as ELISA. Moreover, they suggested that both methods lacked robustness in relation to food processing, without drawing any firm conclusion about the technique. This study hence illustrates that both food matrix and processing can lead to an erroneous quantification of the almond (DNA) content in food samples. This fact might pose a risk for the allergic consumer in cases where quantitative results are applied in risk assessment procedures. Applicability on Commercial Foods. The applicability of this RT-PCR procedure for detecting almond allergens in food samples was evaluated by analyzing 10 commercial foodstuffs (chocolates, cookies, snacks, nougat, etc.). Two of these foods declared in the label the percentage of almond, six of them adverted that the product could have traces of tree nuts, and the other two did not declare any almond content. These commercial foodstuffs were also subjected to ELISA analysis, and the results are summarized in Table 2, in order to compare the outcomes of both techniques.

Figure 3. Estimation of almond content in different raw and treated samples. Raw; autoclaved 120 kPa, 15 min; autoclaved 120 kPa, 30 min; autoclaved 260 kPa, 15 min; autoclaved 260 kPa, 30 min; highpressure 300 MPa; high-pressure 400 MPa; high-pressure 500 MPa; high-pressure 600 MPa.

to higher DNA extractability of HHP treated almond compared to the untreated samples. These findings are quite similar to the results obtained with protein in rice.47 Therefore, while the autoclaving process strongly decreased the capability to detect almond DNA, high pressure at low temperature increased it. The effect of treatments on the detection of almond DNA may take place at two different levels: on the quality or on the amplificability of DNA. In order to evaluate how processing can affect the amount and/or integrity of almond DNA, both were analyzed in the present work. DNA quantification of unprocessed and processed almond samples showed a progressive reduction in the extraction yield parallel to heat and time treatment increases (Table 1). The yield of DNA was disminished from Table 1. DNA Extraction Yields Obtained from Raw and Processed Almond Samplesa almond samples raw autoclaved 120 120 260 260 HHP 300 400 500 600

Yields (nm·mg−1) 37.76 ± 6.64 a

kPa, kPa, kPa, kPa, MPa MPa MPa MPa

15 30 15 30

min min min min

23.66 ± 1.92 3.23 ± 0.65 1.53 ± 0.36 0.56 ± 0.08 52.19 71.43 59.53 46.73

± ± ± ±

20.94 14.53 19.02 15.81

a,b b a,b a,b

a The mean values with the same letter are not significantly different when compared by Student’s t test (P < 0.05).

37.76 ± 6.64 ng/mg in raw almond to 0.56 ± 0.08 ng/mg in autoclaved samples at 138 °C during 30 min. When DNA integrity was determined by agarose gel electrophoresis, the results were compatible with the DNA degradation in the heat processed samples (Figure 3 of the Supporting Information). High pressure (HHP) seems to increase the DNA extraction yield, but this treatment apparently breaks the DNA, since a 5621



Article

Table 2. Almond Detection in Commercial Food Products Analyzed through Real-Time PCR (Ct Value Average) and ELISA (+ = Detected; − = Nondetected) commercial foods

almond declaration

cereal snack chocolate with hazelnut cereal snack I chocolate chocolate with cereal cookies with cereal and chocolate cookies with fiber nougat chocolate snack with cookie Russian cake

contain contain hazelnut might contain nuts might contain nuts might contain nuts might contain nuts not declared might contain nuts not declared contain

Pru du 1 28.46 − − 29.05 25.62 28.94 − 25.29 29.02 21.25

± 0.33 ± 0.99 ± 0.62 ± 0.19 ± 0.79 ± 0.21

Pru du 3 26.69 − − − 29.44 − − 26.72 − 22.36

± 2.01

± 2.12

± 0.47 ± 0.34

Pru du 4 28.34 − − − 28.08 − − 26.12 − 22.34

± 0.20

± 2.53

± 0.12 ± 0.48

ELISA + − − − + + − + − +

This material is available free of charge via the Internet at http://pubs.acs.org.

The study was performed with the three primer pairs Pru du 1, Pru du 3, and Pru du 4, which were more sensitive to detect almond in the processed samples. The three primers detected the almond declared in the label, even at trace levels. This realtime PCR method based on three target sequences reduced the probability of false negatives or positives ensuring more reliable results. The probe Pru du 1 was the most sensitive to detect almond traces in commercial food samples. There is correspondence between RT-PCR results and those obtained by ELISA for 8 of the 10 foods studied with Pru du 1, confirming the reliability of this method. In two samples (chocolate and chocolate snack with cookies), the signal obtained with the RidaScreen Fast ELISA assay was under its limit of detection (1.7 ppm), however, trace amounts of almond DNA were detected in these samples by the Pru du 1 primer. Röder et al.28 described a similar relationship between the detectable signal and the amount of almond for both RT-PCR and ELISA. According to Stephan and Vieths,32 the detection of almond DNA by RT-PCR in a nondeclared sample whose results in the ELISA analysis were negative, such as chocolate snack with cookies, corroborates the higher sensitivity of such RT-PCR procedure. The method developed in this study seems to be more reliable than the ELISA assay tested. In conclusion, a highly specific and sensitive RT-PCR procedure to detect almond DNA is described in this work. The primers designed de novo allow the amplification of DNA of the coding region of several almond allergens (Pru du 1, Pru du 3, Pru du 4, and Pru du 6). The present RT-PCR method seems to be the most sensitive of those previously reported for the detection of almond because of its very low LOD (1 ppm). In addition, when the outcome is compared with an ELISA assay, it offers a higher sensitivity to detect almond traces or even hidden almond allergens in food products where ELISA yields negative results. When processed samples or complex food products are analyzed, the effect of heat processing should be taken into account. In spite of the decrease in DNA quantitiy and quality elicited by the thermal treatment applied, the almond DNA detection has always been possible and accurate in the present study.

■

± 0.33

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected] Departamento de Tecnologiá de Alimentos, SGIT-INIA, Ctra. Coruña Km 7.5, 28040 Madrid, Spain. Tel:+34913476925. Fax:+34913572293. Author Contributions ‡

Both first authors have collaborated on the work and the writing of the manuscript equally.

Funding

The AGL 2008-03453 and AGL 2012-39863 research projects supported this work. Notes

The authors declare no competing financial interest.

■

ABREVIATIONS USED Ct, cycle threshold; CTAB, hexadecyltrimethylammonium bromide; HHP, high hydrostatic pressure; NTC, nontemplate control; RT, real time

■

REFERENCES

(1) Sampson, H. A. Update on food allergy. J. Allergy Clin. Immunol. 2004, 114, 127−30. (2) Ballmer-Weber, B. K. Allergic reactions to food proteins. Int. J. Vitam. Nutr. Res. 2011, 81 (2−3), 173−80. (3) Poms, R. E.; Klein, C. L.; Anklam, E. Methods for allergen analysis in food: a review. Food Addit. Contam. 2004, 21 (1), 1−31. (4) Chen, L.; Zhang, S. M.; Illa, E.; Song, L. J.; Wu, S. D.; Howad, W.; Arus, P.; van de Weg, E.; Chen, K. S.; Gao, Z. S. Genomic characterization of putative allergen genes in peach/almond and their synteny with apple. BMC Genomics 2008, 9, 15. (5) Tawde, P.; Venkatesh, Y. P.; Wang, F.; Teuber, S. S.; Sathe, S. K.; Roux, K. H. Cloning and characterization of profilin (Pru du 4), a cross-reactive almond (Prunus dulcis) allergen. J. Allergy Clin. Immunol. 2006, 118 (4), 915−22. (6) Costa, J.; Mafra, I.; Carrapatoso, I.; Oliveira, M. B. Almond allergens: molecular characterization, detection, and clinical relevance. J. Agric. Food Chem. 2012, 60 (6), 1337−49. (7) Sathe, S. K.; Sharma, G. M. Effects of food processing on food allergens. Mol. Nutr. Food Res. 2009, 53 (8), 970−8. (8) Farid, M.; Ghani, A. G. A. A new computational technique for the estimation of sterilization time in canned food. Chem. Eng. Process. 2004, 43 (4), 523−531. (9) Simpson, R.; Almonacid, S.; Teixeira, A. Optimization criteria for batch retort battery design and operation in food canning-plants. J. Food Process Eng. 2003, 25 (6), 515−38. (10) Gould, G. W. Preservation: past, present and future. Br. Med. Bull. 2000, 56 (1), 84−96.

ASSOCIATED CONTENT

S Supporting Information *

Table 1 suppl (sequences, melting temperature, accession number for each locus, and amplicon size of specific primers used in real-time PCR studies), Figure 1 suppl (standard curve of DNA serial dilutions), Figure 2 suppl (calibration curve of Pru du primer pairs), and Figure 3 suppl (DNA degradation). 5622



Article

(11) Guillard, V.; Mauricio-Iglesias, M.; Gontard, N. Effect of novel food processing methods on packaging: structure, composition, and migration properties. Crit. Rev. Food Sci. Nutr. 2010, 50 (10), 969−88. (12) Cabanillas, B.; Maleki, S. J.; Rodriguez, J.; Cheng, H.; Teuber, S. S.; Wallowitz, M. L.; Muzquiz, M.; Pedrosa, M. M.; Linacero, R.; Burbano, C.; Novak, N.; Cuadrado, C.; Crespo, J. F. Allergenic properties and differential response of walnut subjected to processing treatments. Food Chem. 2014, 157, 141−7. (13) Cuadrado, C.; Cabanillas, B.; Pedrosa, M. M.; Varela, A.; Guillamon, E.; Muzquiz, M.; Crespo, J. F.; Rodriguez, J.; Burbano, C. Influence of thermal processing on IgE reactivity to lentil and chickpea proteins. Mol. Nutr. Food Res. 2009, 53 (11), 1462−8. (14) Husband, F. A.; Aldick, T.; Van der Plancken, I.; Grauwet, T.; Hendrickx, M.; Skypala, I.; Mackie, A. R. High-pressure treatment reduces the immunoreactivity of the major allergens in apple and celeriac. Mol. Nutr. Food Res. 2011, 55 (7), 1087−95. (15) van Boekel, M.; Fogliano, V.; Pellegrini, N.; Stanton, C.; Scholz, G.; Lalljie, S.; Somoza, V.; Knorr, D.; Jasti, P. R.; Eisenbrand, G. A review on the beneficial aspects of food processing. Mol. Nutr. Food Res. 2010, 54 (9), 1215−47. (16) Han, G. D.; Matsuno, M.; Ikeuchi, Y.; Suzuki, A. Effects of heat and high-pressure treatments on antigenicity of beef extract. Biosci., Biotechnol., Biochem. 2002, 66 (1), 202−5. (17) Yamamoto, S.; Mikami, N.; Matsuno, M.; Hara, T.; Odani, S.; Suzuki, A.; Nishiumi, T. Effects of a high-pressure treatment on bovine gamma globulin and its reduction in allergenicity. Biosci., Biotechnol., Biochem. 2010, 74 (3), 525−30. (18) Johnson, P. E.; Van der Plancken, I.; Balasa, A.; Husband, F. A.; Grauwet, T.; Hendrickx, M.; Knorr, D.; Mills, E. N.; Mackie, A. R. High pressure, thermal and pulsed electric-field-induced structural changes in selected food allergens. Mol. Nutr. Food Res. 2010, 54 (12), 1701−10. (19) Li, Y.; Yang, W.; Chung, S.-Y.; Chen, H.; Ye, M.; Teixeira, A.; Gregory, J.; Welt, B.; Shriver, S. Effect of Pulsed Ultraviolet Light and High Hydrostatic Pressure on the Antigenicity of Almond Protein Extracts. Food Bioprocess Technol. 2011, 6 (2), 431−40. (20) Peñas, E.; Gomez, R.; Frias, J.; Baeza, M. L.; Vidal-Valverde, C. High hydrostatic pressure effects on immunoreactivity and nutritional quality of soybean products. Food Chem. 2011, 125 (2), 423−9. (21) Official Journal of the European Union. (2011). Regulation (EU) 1169/2011EC of the European Parliament and of the Council of 25 October 2011on the provision of food information to consumers, amending Regulations (EC) No 1924/2006 and (EC) No 1925/2006 of the European Parliament and of the Council, and repealing Commission Directive 87/250/EEC, Council Directive 90/496/EEC, Commision Directive 1999/10/EC, Directive 2000/13/EC of the European Parliament and of the Council, Commision Directives 2002/ 67/EC and 2008/5/EC and Commission Regulation (EC) No 608/ 2004, L 304, pp 18−43. (22) Food Allergen Labeling and Consumer Protection Act of 2004. (Aug 2, 2004). Public law 108−282 (pp 905−11), 118 STAT. (23) Añibarro, B.; Seoane, F. J.; Mugica, M. V. Involvement of hidden allergens in food allergic reactions. J. Invest. Allergol. Clin. Immunol. 2007, 17 (3), 168−72. (24) Scaravelli, E.; Brohee, M.; Marchelli, R.; van Hengel, A. J. The effect of heat treatment on the detection of peanut allergens as determined by ELISA and real-time PCR. Anal. Bioanal. Chem. 2009, 395 (1), 127−37. (25) Costa, J.; Mafra, I.; Oliveira, M. High resolution melting analysis as a new approach to detect almond DNA encoding for Pru du 5 allergen in foods. Food Chem. 2012, 133 (3), 1062−9. (26) Koppel, R.; van Velsen-Zimmerli, F.; Bucher, T. Two quantitative hexaplex real-time PCR systems for the detection and quantification of DNA from twelve allergens in food. Eur. Food Res. Technol. 2012, 235 (5), 843−52. (27) Pafundo, S.; Gulli, M.; Marmiroli, N. Multiplex real-time PCR using SYBR(R) GreenER for the detection of DNA allergens in food. Anal. Bioanal. Chem. 2010, 396 (5), 1831−9.

(28) Röder, M.; Vieths, S.; Holzhauser, T. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman® real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay. Anal. Chim. Acta 2011, 685 (1), 74−83. (29) Pafundo, S.; Gulli, M.; Marmiroli, N. SYBR GreenER Real-Time PCR to detect almond in traces in processed food. Food Chem. 2009, 116 (3), 811−5. (30) Costa, J.; Oliveira, M. B. P. P.; Mafra, I. Novel approach based on single-tube nested real-time PCR to detect almond allergens in foods. Food Res. Int. 2013, 51 (1), 228−35. (31) López-Calleja, I. M.; de la Cruz, S.; Pegels, N.; González, I.; Martín, R.; García, T. Sensitive and specific detection of almond (Prunus dulcis) in commercial food products by real-time PCR. LWTFood Sci. Technol. 2014, 56, 31−9. (32) Stephan, O.; Vieths, S. Development of a real-time PCR and a sandwich ELISA for detection of potentially allergenic trace amounts of peanut (Arachis hypogaea) in processed foods. J. Agric. Food Chem. 2004, 52 (12), 3754−60. (33) Iniesto, E.; Jiménez, A.; Prieto, N.; Cabanillas, B.; Burbano, C.; Pedrosa, M. M.; Rodríguez, J.; Muzquiz, M.; Crespo, J. F.; Cuadrado, C.; Linacero, R. Real Time PCR to detect hazelnut allergen coding sequences in processed foods. Food Chem. 2013, 138, 1976−81. (34) Platteau, C.; De Loose, M.; De Meulenaer, B.; Taverniers, I. Quantitative detection of hazelnut (Corylus avellana) in cookies: ELISA versus real-time PCR. J. Agric. Food Chem. 2011, 59 (21), 11395−402. (35) Romero, A.; Vargas, F. J.; Tous Martí, J.; Ninot i Cort, A.; Miarnau, X. Parámetros de calidad del fruto interesantes en la mejora genética del almendro. Rev. Frutic. 2010, 10, 70−9. (36) López, M.; Romero, M. A.; Vargas, F. J.; Batlle, I. ‘Francoli’,́ a late flowering almond cultivar re-classified as self-compatible. Plant Breed. 2005, 124 (5), 502−6. (37) Socias i Company, R.; Alonso, J. M.; Kodad, O.; Gradziel, T. M. Almond. In Fruit Breeding, Handbook of Plant Breeding; Badenes, M. L., Byrne, D. H., Eds.; Springer Science + Business Media: 2012; Vol. 8, pp 697−728. (38) Vargas, F. J.; Romero, M. A.; Clavé, J.; Vergés, J.; Santos, J.; Batlle, I. ‘Vayro’, ‘Marinada’, ‘Constanti’́ and ‘Tarraco’ almonds. HortScience 2008, 43 (2), 535−7. (39) Omi, Y.; Kato, T.; Ishida, K.-I.; Kato, H.; Matsuda, T. PressureInduced Release of Basic 7S Globulin from Cotyledon Dermal Tissue of Soybean Seeds. J. Agric. Food Chem. 1996, 44 (12), 3763−7. (40) Kato, T.; Katayama, E.; Matsubara, S.; Omi, Y.; Matsuda, T. Release of allergenic proteins from rice grains induced by high hydrostatic pressure. J. Agric. Food Chem. 2000, 48 (8), 3124−9. (41) Thompson, J. D.; Higgins, D. G.; Gibson, T. J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22 (22), 4673−80. (42) D’Andrea, M.; Coisson, J. D.; Locatelli, M.; Garino, C.; Cereti, E.; Arlorio, M. Validating allergen coding genes (Cor a 1, Cor a 8, Cor a 14) as target sequences for hazelnut detection via Real-Time PCR. Food Chem. 2011, 124 (3), 1164−71. (43) Venkatachalam, M.; Sathe, S. K. Chemical composition of selected edible nut seeds. J. Agric. Food Chem. 2006, 54 (13), 4705−14. (44) Andersen, C.; Holst-Jensen, A.; Berdal, K.; Thorstensen, T.; Tengs, T. Equal performance of TaqMan, MGB, molecular beacon, and SYBR green-based detection assays in detection and quantification of roundup ready soybean. J. Agric. Food Chem. 2006, 54 (26), 9658− 63. (45) Watanabe, S.; Taguchi, H.; Temmei, Y.; Hirao, T.; Akiyama, H.; Sakai, S.; Adachi, R.; Urisu, A.; Teshima, R. Specific detection of potentially allergenic peach and apple in foods using polymerase chain reaction. J. Agric. Food Chem. 2012, 60 (9), 2108−15. (46) European Network of GMO Laboratories (2005). Definition of minimum performance requirements for analytical of GMO testing. http://gmocrl.jrc.it/guidancedocs.htm. Accessed 25.11.07. 5623



Article

(47) Estrada-Giron, Y.; Swanson, B. G.; Barbosa-Canovas, G. V. Advances in the use of high hydrostatic pressure for processing cereal grains and legumes. Trends Food Sci. Technol. 2005, 16 (5), 194−203. (48) Somkuti, J.; Smeller, L. High pressure effects on allergen food proteins. Biophys. Chem. 2013, 4622 (13), 98−7.

5624


Detection of Almond Allergen Coding Sequences in Processed Foods

Recommend Documents