Detection of Human Immunodeficiency Virus Type 1 Reverse

Detection of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Using ... Ariel H. Hecht , Greg J. Sommer , Ross H. Durland , Xianbin Yang , An...
0 downloads 0 Views 71KB Size
Download PDF
Anal. Chem. 2001, 73, 6070-6076

Detection of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Using Aptamers as Probes in Affinity Capillary Electrophoresis Victor Pavski and X. Chris Le*

Environmental Health Sciences Program, Department of Public Health Sciences, University of Alberta, Edmonton, Alberta, Canada T6G 2G3

An affinity capillary electrophoresis/laser-induced fluorescence (CE/LIF) assay was developed for direct and specific detection of reverse transcriptase (RT) of the type 1 human immunodeficiency virus (HIV-1) using fluorescently labeled single-stranded DNA aptamers as probes. The aptamer used (RT 26) is specific for HIV-1 RT, and it exhibited no cross-reactivity with RTs of the enhanced avian myeloblastosis virus (AMV), the Moloney murine leukemia virus (MMLV), or denatured HIV-1 RT. An affinity complex of RT 26-HIV-1 RT was readily formed, and calibration curves were linear up to 50 nM (6 µg/ mL) HIV-1 RT concentration, with both the free probe and complex peak usable for analytical quantitation. Cell culture media (RPMI with 10% fetal bovine serum) interfered with the assay and aptamer-HIV-1 RT binding. Nonspecific binding was observed in low or undiluted culture, necessitating at least 100-fold dilution for analysis of raw culture samples. Affinity probe capillary electrophoresis (APCE) coupled with laser-induced fluorescence (LIF) detection has emerged as an effective tool in the rapid, ultrasensitive detection of analytes in clinical chemistry1-3 and in the study of DNA-protein interactions.4,5 APCE typically exploits the high affinity binding between antigen and antibody in either a competitive2,6 or noncompetitive1,3 format. In both formats, a fluorescent probe is added to a solution containing the analyte (antigen). In noncompetitive APCE, a fluorescently labeled antibody probe binds to unlabeled antigen. A fluorescent antibody-antigen affinity complex then forms and is subsequently separated from the free labeled antibody by capillary electrophoresis (CE) and detected by LIF. Both free probe and bound complex peaks may be used for quantitation of the analyte; however, the use of antibodies as fluorescent probes in APCE can be problematic. Although it is theoretically possible * Corresponding author. Telephone: (780) 492-6416. Fax: (780) 492-0364. E-mail: [email protected]. (1) Hafner, F. T.; Kautz, R. A.; Iverson, B. L.; Tim, R. C.; Karger, B. L. Anal. Chem. 2000, 72, 5779-5786. (2) Wan, Q.-H.; Le, X. C. J. Chromatogr., B 1999, 734, 31-38. (3) German, I.; Buchanan, D. D.; Kennedy, R. T. Anal. Chem. 1998, 70, 45404545. (4) Wan, Q.-H.; Le, X. C. Anal. Chem. 1999, 1999, 4183-4189. (5) Wan, Q.-H.; Le, X. C. Anal. Chem. 2000, 72, 5583-5589. (6) Lam, M. T.; Wan, Q.-H.; Boulet, C. A.; Le, X. C. J. Chromatogr., A 1999, 853, 545-553.

6070 Analytical Chemistry, Vol. 73, No. 24, December 15, 2001

to generate antibodies for any desired target, in practice, native antibodies are electrophoretically heterogeneous and do not migrate as a single sharp peak, rendering them less useful for CE.1 In addition, the fluorescent label may interfere with binding if it is too close to the binding site. Other ligands that may avoid some of the problems inherent in antibody affinity assays are synthetic DNA and RNA oligonucleotides, known as aptamers. Aptamers are produced in vitro from a combinatorial chemistry process termed SELEX or systematic evolution of ligands by exponential enrichment.7-9 A large pool of oligonucleotides of the same length with randomized sequences is tested for binding, typically by filter assays, to a specific target ligand. The oligonucleotides that bind most tightly to the target ligand are then separated and amplified by the polymerase chain reaction (PCR), and the process is repeated until the pool evolves to a subset of sequences with the highest binding affinity to the target ligand. At the end of the process, the aptamers that are produced have binding constants typically many orders of magnitude greater than the original oligonucleotide mixture, making them highly selective for their target ligands. Aptamers have been used in numerous investigations, from the study of the evolution of oligonucleotides to the development of new drugs. Aptamers have, however, only recently been used in analytical chemistry applications, most commonly as immobilized ligands themselves. For example, DNA aptamers have been immobilized in chromatographic columns for purification of human L-selectinIg fusion protein,10 and DNA aptamers have been covalently bound to fused-silica capillaries and used as stationary phases for the separation of nontarget compounds, such as amino acids and polycyclic aromatic hydrocarbons in capillary electrochromatography.11 Aptamers were first applied in APCE when DNA aptamers were used to detect nanomolar levels of IgE in reconstituted human serum and thrombin in standard solution, yielding calibration curves having linearity of 5 orders of magnitude.3 Single-stranded DNA aptamers have been developed that bind to the reverse transcriptase of the type 1 human immunodeficiency virus (HIV-1).12 Two oligonucleotides, an 81-mer termed RT 26 and an 84-mer termed RT 12, have binding constants with HIV-1 (7) Turek, C.; Gold, L. Science 1990, 249, 505-510. (8) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818-822. (9) Joyce, G. F. Gene 1989, 82, 83-87. (10) Roming, T. S.; Bell, C.; Drolet, D. W. J. Chromatogr., B 1999, 731, 275284. (11) Kotia, R. B.; Li, L.; McGown, L. B. Anal. Chem. 2000, 72, 827-831. 10.1021/ac0107305 CCC: $20.00

© 2001 American Chemical Society Published on Web 11/16/2001

RT of 1 nM and 2 nM, respectively.12 These binding constants represent a 1000-fold increase over the binding of RT with native DNA. Both aptamers have structures analogous to the primer/ template junction. Binding with HIV-1 RT likely occurs as RT stalls along specific points of each DNA aptamer and cannot complete DNA synthesis.13 Although the original study most likely was an attempt to design drugs that inhibit HIV-1 RT activity in infected HIV-1 patients, the aptamers themselves may be used for the direct, selective determination of HIV-1 RT. HIV-1 RT is a key component in the life cycle of the HIV-1 virus, which itself is regarded as the etiological agent of the acquired immune deficiency syndrome (AIDS).12 HIV-1 RT is a marker for the HIV-1 virus, and RT activity is routinely used to titer (determine concentration) stocks of the HIV-1 virus. Correlating HIV-1 RT activity from virus stocks of known concentration with RT activity from viral cell lines of unknown concentration is routinely used to determine HIV viral loads in cell cultures for in vitro research into the HIV-1 virus and in cell cultures of infected individuals.14 The determination of viral load in HIV-positive individuals is becoming increasingly important in determining the course of therapy. Recently, a panel convened in part by the United States Department of Health and Human Services has issued guidelines15 increasing the viral load at which antiviral therapy should begin because the toxic side effects possessed by many antiviral drugs can negate the goal of AIDS treatment if used too aggressively. However, whole blood from individuals with even high viral loads contain corresponding HIV-1 RT activities that are typically many orders of magnitude below the working ranges of common analytical techniques. One study16 found that HIV-1 RT activities in the sera of infected individuals ranged broadly from about 9 × 10-4 pg/mL to 1 pg/mL (ppt). All existing assays for HIV-1 RT activity, therefore, rely on some form of amplification, typically using the enzymatic properties of RT itself, and none are capable of directly determining HIV-1 RT in whole blood or serum. The earliest assay for RT activity was a polymerization assay utilizing a radioactive tritiated triphosphate nucleotide precursor for incorporation into DNA by the action of viral polymerase.17,18 The reaction buffer for the assay was easy to make, and the template/primers were commercially available. The linear dynamic range of this assay was broad, quantifying viral loads over 4 orders of magnitude.19 However, the reaction took 24 h at 37 °C to perform. This assay was used throughout the early 1980s for determining RT activity and viral load in cell cultures, although some researchers20 continued its use in the 1990s. With the advent of PCR in 1985,21 it became possible to enhance the sensitivity of the RT assay 106-fold. Typically, this was accomplished by (12) Schneider, D. J.; Feignon, J.; Hostomsky, Z.; Gold, L. Biochemistry 1995, 34, 9599-9610. (13) Breaker, R. R. Curr. Opin. Chem. Biol. 1997, 1, 26-31. (14) Garcı´a-Lerma, G. J.; Yamamoto, S.; Cano-Go´mez, M.; Soriano, V.; Green, T. A.; Busch, M. P.; Folks, T. M.; Heneine, W. J. Infect. Dis. 1998, 177, 12211229. (15) The new guidelines are available on the Internet at the following URL: http://www.hivatis.org/guidelines/adult/Apr23_01/pdf/AAAPR23S.PDF. (16) Garcı´a-Lerma, J. G.; Schinazi, R. F.; Juodawlkis, A. S.; Soriano, V.; Lin, Y.; Tatti, K.; Rimland, D.; Folks, T. M.; Heneine, W. Antimicrob. Agents Chemother. 1999, 43, 264-270. (17) Baltimore, D. Nature 1970, 226, 1209-1211. (18) Temin, H. M.; Baltimore, D. Adv. Virus Res. 1972, 17, 129-186. (19) Lee, M. H.; Sano, K.; Morales, F. E.; Imagawa, D. T. J. Clin. Microbiol. 1998, 26, 371-374.

performing a similar assay in which the RT is used, in conjunction with other primer/template oligonucleotides, to produce a target oligonucleotide later amplified by PCR.14,22 Although innovative PCR-based CE/LIF work has been reported for HIV-1 detection,23,24 the majority of laboratories specializing in HIV-1 research and testing typically use agarose gel electrophoresis to purify the PCR products, followed by detection and quantitation by Southern blot hybridized to a 32P end-labeled oligonucleotide probe, entailing much time and effort. A colorimetric RT assay has been developed using 96-well microtiter plates.25 This test also utilizes template/ primer oligonucleotides to polymerize new DNA with incorporated 5′-bromodeoxyuridine 5′-triphosphate(BrdUTP), usually requiring a polymerization period of 24 h. Quantification is obtained by adding alkaline phosphatase-conjugated anti-BrdUTP antibody, washing, and adding p-nitrophenyl phosphate to measure the bound antibody, with colorimetric determination taking place at specific times over an additional 24-hour period. Chemiluminescent26 and fluorescent27 versions of this assay have also been developed. Although the microtiter plate-based assays and PCRbased tests are laborious and time-consuming, they both boast impressive detection limits on the order of 4 pg/mL. None of these assays are specific for HIV-1 RT, however, detecting RTs from the human T-cell leukemia virus type 1 (HTLV-1), the avian myeloblastosis virus (AMV), and the Moloney murine leukemia virus (MMLV), among others. Determination of HIV-1 RT using a noncompetitive affinity CE/ LIF assay would have several advantages in terms of vastly decreasing analysis time and would involve much simpler chemical procedures. A fluorescently labeled aptamer probe, such as RT 12 or RT 26, would eliminate the need for the use of radiolabeled materials and would provide the first direct assay for HIV-1 RT. Because the aptamers are evolved to bind selectively to HIV-1 RT, interferences from RTs of other species should be eliminated or greatly attenuated. Although the assay would not be suitable for direct determination of HIV-1 RT activities in whole blood or serum (aptamer binding constants are 0.1-0.2 µg/mL of HIV-1 RT), it would readily determine RT activities in cell cultures of the HIV-1 virus. Used in conjunction with other laboratory procedures correlating HIV-1 RT activity to viral loads, it could prove useful in the determination of HIV-1 viral load. EXPERIMENTAL SECTION Apparatus. The CE/LIF instrument used in this work has been previously extensively described4,5,28 and will only be sum(20) Di Rienzo, A. M.; Petronini, P. G.; Guetard, D.; Favilla, R.; Borghetti, A. F.; Montagnier, L.; Piedmonte, G. J. Acquired Immune Defic. Syndr. 1992, 5, 921-929. (21) Sacki, R. K.; Scharf, S.; Faloona, F.; Mullis, K. B.; Horn, G. T.; Erlich, H. A.; Anahiem, N. Science 1985, 230, 1350-1354. (22) Pyra, H.; Bo ¨ni, J.; Schu ¨ pbach, J. Proc. Natl. Acad. Sci. U.S.A. 1994, 91, 1544-1548. (23) Gong, X.; Yeung, E. S. J. Chromatogr., B 2000, 741, 15-21. (24) Zhang, N.; Yeung, E. S. J. Chromatogr., B 1998, 714, 3-11. (25) Awad, R. J.-K.; Corrigan, G. E.; Ekstrand, D. H. L.; Thorstensson, R.; Ka¨llander, C. F. R.; Gronowitz, J. S. J. Clin. Microbiol. 1997, 35, 10801089. (26) Suzuki, K.; Craddock, B. P.; Kano, T.; Steigbigel, R. T. Anal. Biochem. 1993, 210, 277-281. (27) Zhang, J.-H.; Chen, T.; Nguyen, S. H.; Oldenburg, K. R. Anal. Biochem. 2000, 281, 182-186. (28) Ye, L.; Le, X. C.; Zing, J. Z.; Ma, M.; Yatscoff, R. J. Chromatogr., B 1998, 714, 59-67.

Analytical Chemistry, Vol. 73, No. 24, December 15, 2001

6071

marized here. It is a laboratory-constructed system consisting of a CE power supply (model CZE 1000R, Spellman, Plainview, NY), and a fused-silica capillary (Polymicro Technologies, Phoenix, AZ), the detection end of which was inserted into a grounded sheathflow cuvette (NSG Precision Cells, Farmingdale, NY). Light from an argon ion laser with an excitation wavelength of 488 nm (model 2214-65, Uniphase, San Jose, CA) was focused using a 10× microscope objective to a detection window near the end of the tip of the capillary. Fluorescence was collected using a highnumerical aperture microscope objective (60×, 0.7 NA, Universe Kogaku, Oster Bay, NY), spectrally filtered through a 515-nm band-pass filter (515DF20) and restricted by a 2-mm pinhole. A polarizing beam splitter (Melles Griot, Nepean, Canada) was used to split the beam to two photomultiplier tubes (PMT, R1477, Hamamatsu Photonics, Japan) to measure horizontally and vertically polarized light. Initially, data was collected from both PMTs, which provided fluorescence polarization information.5 When early results indicated no substantial difference in the fluorescence polarization behavior for the molecules of interest, data from only one PMT was used for subsequent experiments. The output from the PMT and the CE high voltage was controlled using application software written in Labview (National Instruments, Austin, TX) and a PCI data acquisition board housed inside a Power Macintosh computer. Reagents. All solutions were prepared using 18.2 MΩ distilled, deionized water (DDW) from a Milli-Q Gradient 10 Water System (Millipore, Nepean, Canada). Tris-borate-EDTA (TBE) (0.089 M tris, 0.089 M boric acid, 0.0025M EDTA, pH 8.3), tris-glycine (0.025 M tris, 0.192 M glycine, pH 8.3), and disodium tertaborate buffers (0.1 M, pH 9.1) were prepared using reagent-grade materials and diluted to desired concentrations with DDW prior to being filtered through a 0.22-µm filter to remove particulate matter. The RT 12 aptamer (5′- ATCTACTGGATTAGCGATACTCGATTAGGTCCCCTGCCGCTAAACCATACCGCGGTAACTTGAGCAAAATCACCACTGCAGGGG-3′) and the RT 26 aptamer (5′-ATCCGCCTGATTAGCGATACTTACGTGAGCGTGCTGTCCCCTAAAGGTGATACGTCACTTGAGCAAAATCACCTGCAGGGG-3′) were labeled with 5′-FAM (5′-carboxyfluorescein) at the University Core DNA Services, University of Calgary, Canada. HIV-1 RT was obtained from Worthington Biochemicals (Lakewood, NJ). RTs from the enhanced avian myeloblastosis virus (AMV) and the Moloney murine leukemia virus (MMLV) were obtained from Sigma (St. Louis, MO). Cell culture media (RPMI with 10% fetal bovine serum (FBS)) was obtained from the Cross Cancer Institute at the University of Alberta. Capillary Electrophoresis/Laser-Induced Fluorescence. Uncoated fused-silica capillaries (20-µm i.d., 150-µm o.d.) were cut to a length of 40 cm and inserted into the sheath flow cuvette, where the laser beam was focused. Samples were injected for 5 s at a voltage of 15 kV (375 V/cm), and electrophoresis was carried out at a running voltage of 20 kV (500 V/cm). The running buffer utilized for all experiments was 1× tris-glycine. The laser power was set at 4 mW throughout. Periodically, the capillaries were treated by running 0.1 M NaOH through the system at an running voltage of about 100 V/cm for 30 min, followed by the running buffer (1× tris-glycine) at 500 V/cm, to remove protein material adsorbed on the capillary wall. 6072

Analytical Chemistry, Vol. 73, No. 24, December 15, 2001

Information on electroosmotic flow (EOF) was acquired by injecting 10-10 M BODIPY FL dye in methanol as a neutral marker under normal sample injection and running conditions. It migrated at ∼2.4 min under the given EOF conditions. Affinity Complex Formation. The RT 12 aptamer and RT 26 aptamer were received in 0.020-µg and 0.040-µg quantities, respectively. These were diluted to 100 µL in 1× TBE in 600-µL microcentrifuge tubes and stored in a freezer at -20 °C when not in use, as were the RTs of HIV-1, AMV, and MMLV. Stock solutions of 80 nM for the RT 12 aptamer and 170 nM for the RT 26 aptamer were prepared in 1× TBE in 600-µL microcentrifuge tubes. A 1000 nM stock solution of HIV-1 RT was similarly prepared in DDW. Complex formation was carried out in an incubation buffer of 1× TBE. The desired concentration of aptamer and protein was obtained by pipeting the appropriate volumes of aptamer and protein stock solutions into a 60 µL volume in 600-µL microcentrifuge tubes. The tubes were then vortexed for 30 s and put on ice for about 5 min prior to sample injection into the capillary. All stock solutions were stored at -20 °C when not in use, and all samples were kept on ice during the course of experimentation. Interference Studies. To determine the degree to which the aptamers would bind with RTs from AMV and MMLV, experiments were conducted in which complex formation experiments, as described above, were undertaken with AMV and MMLV RTs substituted for HIV-1 RT. Furthermore, complex formation experiments were conducted with RTs of HIV-1, AMV, and MMLV mixed together, with the AMV and MMLV RTs at a concentration the same as or higher than HIV-1 RT. Additionally, to determine whether binding would take place between the aptamer and denatured HIV-1 RT, 20 µL of 7.7 × 10-6 M HIV-1 RT was heatdenatured at 95 °C for 10 min and then immediately placed on ice prior to incubation with the aptamer, as described previously. To determine the degree to which matrix effects from cell culture media would interfere with complex formation, aliquots of RPMI containing 10% FBS were added to samples containing both HIV-1 RT and aptamer, as well as aptamer alone. RESULTS AND DISCUSSION Affinity Complex Formation and CE Separation. The affinity complex was formed by adding increasing concentrations of aptamer to a fixed concentration of HIV-1 RT (50 nM). These data are shown in Figure 1. In the absence of HIV-1 RT, the aptamer peak is sharp with a migration time of ∼4.2 min. Tailing is a characteristic of the aptamer peak, and it was observed even at the lowest aptamer concentrations used (1.7 nM). This most likely results from impurities in the DNA, with the tailing consisting of unresolved impurities, as has also been observed in another DNA aptamer APCE study.3 Closer examination of the aptamer peak reveals it to be a triplet, with two minor peaks on the shoulders of the main peak, and this structure becomes more pronounced as binding increases, particularly at 50 nM of aptamer. This also suggests the presence of impurities in the aptamer, with DNA impurities containing multiple DNA structures, some of which cannot be recognized by the HIV-1 RT protein.4,29,30 The (29) Stebbins, M. A.; Hoyt, A. M.; Speniak, M. J.; Hurlburt, B. K. J. Chromatogr., B 1996, 683, 3053-3058. (30) Hamdan, I. I.; Skellern, G. G.; Waigh, R. D. Nucleic Acids Res. 1998, 26, 3053-3058.

Figure 1. Effect of increasing concentration of RT 26 aptamer probe on the formation of RT 26-HIV-1 RT affinity complex at a fixed HIV-1 concentration of 50 nM. The bottom electropherogram contains data representing 17 nM of RT 26 probe only. Peak 1 corresponds to the unbound aptamer; peak 2 corresponds to the complex of the aptamer and HIV-1 RT.

RT 26-HIV-1 RT affinity complex is clearly formed, having a migration time of ∼3.3 min, and is well-resolved and Gaussian in appearance. The lack of features, such as bumps or shoulders, suggests that the affinity complex is primarily of single stoichiometry. For the most part, this was observed for the RT 26-HIV-1 RT system. In some instances, particularly at concentrations of 50 nM HIV-1 RT and 17 nM RT 26, the complex peak migrated as a doublet or with a shoulder, likely indicating that RT 26 and HIV-1 RT formed a complex of two stoichiometries. As expected, the peak area of the HIV-1 RT-aptamer affinity complex continued to increase with increasing aptamer concentration. As can be observed from Figure 1, the migration time of the aptamer increases slightly with increasing aptamer and HIV-1 RT concentration. This has been observed previously5 and is the result of binding between the low-mobility protein and the higher-mobility DNA. Mobility shifts of both affinity complex and probe peaks to longer migration times become particularly pronounced at high protein and DNA concentrations, because protein may be adsorbed onto the capillary walls.2 Experiments were also undertaken using RT 12 at 8, 15, and 20 nM concentrations added to a solution containing a fixed concentration of 50 nM of HIV-1 RT. Initial results (data not shown) parallel those described above in that the peak area of the affinity complex increased with increasing aptamer concentration. However, the RT 12-HIV-1 RT affinity complex exhibited two distinct peaks, one forming at the same migration time as the RT 26-HIV-1 RT complex, and an additional early peak formed at about 2.9 min. HIV-1 RT is a heterodimer of total molecular weight 120 kDa, with two subunits of molecular weight 51 kDa and 66 kDa. Although it is possible that the dimeric forms of HIV-1 RT may be binding to different sites on the differently structured RT 12 aptamer, a more plausible explanation is that the RT 12 is being incorporated into the affinity complex in such a way as to produce a complex of two different stoichiometries.4 Because of the stronger binding of the RT 26 aptamer (1 nM) compared to the RT 12 (2 nM), RT 26 was chosen for all further work.

Figure 2. Effect of increasing HIV-1 RT concentration at a fixed concentration of fluorescently labeled RT 26 aptamer probe of 17 nM. The bottom electropherogram contains data representing 17 nM of RT 26 probe only. Peak 1 corresponds to the unbound aptamer; peak 2 corresponds to the complex of the aptamer and HIV-1 RT.

Calibration Curve. Calibration curves for HIV-1 RT were constructed using aptamer concentrations of 17 nM and 60 nM. Initially, the higher aptamer concentration was selected because it may afford greater sensitivity to the assay, incorporating more fluorescent probe into the affinity complex and increasing its peak area. In practice, however, it afforded neither greater sensitivity nor linear dynamic range to the assay (data not shown), and 17 nM of the RT 26 aptamer was subsequently used in all experiments. The electropherograms from which the calibration curve was constructed appear in Figure 2. The RT 26 probe peak area decreases with increasing HIV-1 RT concentration (20-100 nM) and disappears completely at 800 nM of HIV-1 RT. That the aptamer is completely incorporated into the affinity complex indicates the aptamer is at its preferred orientation in the TBE incubation buffer without the need for heat denaturing and the presence of Mg2+ salts, as was found in another assay in which DNA aptamers were used to bind IgE and thrombin.3 In that study, both the incubation and running buffers were composed of trisglycine, whereas in this instance, the incubation buffer is TBE. An early experiment using tris-glycine as the incubation buffer, without heat denaturing or addition of MgCl2, yielded on electrophoresis a weak and broad aptamer peak for the RT 12, in contrast to the sharp peak obtained with TBE incubation buffer. EDTA is routinely added to solutions used in DNA sequencing applications to ensure denaturization of DNA fragments by chelating zinc ions that catalyze duplex formation. It is possible it performs a similar function here. Although HIV-1 RT and aptamer working stock solutions (diluted 10 and 100-fold, respectively) were stable for several months, sample solutions, particularly those of low aptamer and protein concentration, were stable for about two to three weeks. This may be a consequence of the HIV-1 RT’s losing activity and the DNA aptamer’s losing its preferred orientation when exposed to room temperature for long periods of time. At very low HIV-1 RT concentrations (below 7 nM), it is necessary to perform experiments within 30-40 min, because the complex peak area Analytical Chemistry, Vol. 73, No. 24, December 15, 2001

6073

Figure 3. Calibration curves constructed from samples containing 17 nM RT 26 aptamer. The line is a cubic spline fit to the data. The insert is a linear regression best fit of the linear regions of both the unbound RT 26 probe and the bound RT 26-HIV-1 RT affinity complex. All error bars represent 1 standard deviation from the mean; the peak areas represent data obtained from 3 to 5 runs.

Figure 4. Degree of binding between the RT 26 aptamer and the RTs of AMV, MMLV, and HIV-1 added together in the same sample. The aptamer concentration was fixed at 17 nM. (A) The sample contains 0.135 units/µL of HIV-1 RT, 0.200 units/µL of AMV RT, and 20 units/µL of MMLV RT. (B) The sample contains 0.135 units/µL of HIV-1 RT, 0.200 units/µL of AMV RT, and 2 units/µL of MMLV RT. (C) The sample contains 0.135 units/µL of HIV-1 RT.

decreased and the aptamer peak increased. This is likely an added consequence of work at concentrations tending toward the binding constant of the aptamer and HIV-1 RT. Because of practical considerations such as these, calibration curve samples were prepared sequentially, and samples were prepared fresh daily. The calibration curve obtained appears in Figure 3. For the bound complex (filled circles), there is an initial steep increase in fluorescence intensity with HIV-1 RT concentration, followed by leveling off, indicative of binding saturation, beginning at about 100 nM of HIV-1 RT. For the unbound aptamer probe peak (open circles), this is mirrored by a similar steep loss in fluorescence intensity, followed by a leveling off at about 100 nM as it is incorporated into the affinity complex, ultimately completely, at 800 nM of HIV-1 RT. The steeply rising sections of the curves were then investigated to determine analytical utility. The insert to Figure 3 shows that the linear dynamic range for both probe and complex peaks extends to 50 nM of HIV-1 RT. In the case of the aptamer probe, least-squares linear regression provides a bestfit line having a correlation coefficient (r2) of 0.985 and a slope of 0.612, whereas the same fit to the bound complex provided an r2 value of 0.986 and a slope of -0.938. Relative standard deviations (RSDs) range from a high of 7.1% to a majority of 1.9-2.5% for both probe and complex peaks. The calibration curve does not have the linear dynamic range of other noncompetitive assays,1,3 and correction for injection volume variations by using an external standard3 could only extend linearity to 2 orders of magnitude, at which point binding is saturated. It is possible that the high binding constant or binding kinetics of this assay is favorable for early binding saturation. The steep slope of the early part of the curve would indicate good sensitivity for the linear parts of the calibration curves. Effect of Other Reverse Transcriptases. To examine whether other reverse transcriptases affect the assay for HIV-1 reverse transcriptase, two commercially available RTs, AMV and MMLV, were tested. Experiments were performed in which all or some of the RTs were added together with HIV-1 RT and 17 nM of RT 26 aptamer. These results are contained in Figure 4, and the areas

Table 1. Peak Areas of Free Aptamer and Bound Affinity Complexa

6074 Analytical Chemistry, Vol. 73, No. 24, December 15, 2001

peak area system

aptamer

affinity complex

RT 26 and HIV-1 RT RT 26, HIV-1 RT, AMV RT and MMLV RT(2 units/µL) RT 26, HIV-1 RT, AMV RT and MMLV RT (20 units/µL)

0.67 ( 0.06 0.71 ( 0.04

28 ( 1 30 ( 2

0.77 ( 0.04

29 ( 2

a The separation conditions and analyte concentrations are the same as in Figure 4. Uncertainties represent 1 SD from 3 to 5 replicate runs.

of the bound complex and the unbound probe peaks are provided in Table 1. RSDs in Table 1 range from a high of 8.6% to a majority of 5-6%, indicating reasonably good reproducibility with both aptamer and complex peak areas. Concentrations of RTs are expressed in units of activity per microliter in order to provide consistency. Figure 4B contains the results for the aptamer, AMV RT, and MMLV RT. AMV RT is present at a concentration comparable to that of HIV-1 RT, whereas MMLV RT is an order of magnitude more concentrated. Compared to Figure 4C, in which only HIV-1 RT and aptamer are present, there is no significant difference in the peak area of the affinity complex. The peak area of the unbound aptamer probe has not decreased and is similar in Figure 4C and B, indicating that it is not being incorporated into an affinity complex with RTs of AMV or MMLV. In Figure 4A, the concentration of MMLV RT was increased to over 2 orders of magnitude above that of HIV-1 RT, and the peak area of the unbound aptamer had still not decreased, remaining essentially identical to that in the presence of HIV-1 RT alone. These results indicate that the presence of other RT proteins, such as AMV RT and MMLV RT, does not affect the determination of HIV-1 RT. Table 2 contains the results of experiments to determine if the RTs of AMV, MMLV, and heat-denatured HIV-1 cross-react with the aptamer. RSDs in Table 2 range from 1.6 to 3.3%, again

Table 2. Peak Areas of Free Aptamer for Aptamer Binding with Different Species of RTa component RT 26 aptamer (no RT present) AMV RT MMLV RT denatured HIV-1 RT

concn

peak area, unbound aptamer

140 nM

417 ( 7

4 units/µL 4000 units/µL 1 unit/µL

426 ( 7 420 ( 10 421 ( 7

a The separation conditions are the same as in Figure 4. Uncertainties represent 1 SD from 3 to 5 replicate runs. No affinity complex was observed to form.

indicative of good reproducibility of the assay. Very high concentrations of RT (1-4000 units/µL) and aptamer probe (140 nM) were used, which should favor complex formation; however, no complex formation is evident, even at a denatured HIV-1 RT concentration of 1 unit/µL, AMV RT concentration of 4 units/µL, and MMLV RT concentration of 4000 units/µL (initial experiments were run using longer analysis times in case the RT-aptamer complex would form at longer migration times). Table 2 clearly shows that the peak area of the unbound aptamer is essentially the same in the absence and the presence of denatured HIV-1 RT, AMV RT, and MMLV RT. The results show that the aptamer probe is specific for HIV-1 RT and does not cross-react with other RTs. Effect of Sample Matrix. Although virological methods exist to reduce matrix effects (such as ultracentrifugation and pelleting), samples of raw cell culture were chosen to represent the most complex sample matrix. It has been reported that fetal bovine serum (FBS) concentrations of over 2.5% inhibit HIV-1 RT activity.31 Thus, we examined any potential matrix effects from samples containing FBS. Cell culture medium (RPMI) containing 10% FBS was used as a sample matrix for this investigation. Figure 5 shows electropherograms from the analysis of mixtures containing 20 nM HIV-1 RT and 17 nM RT 26 aptamer in TBE buffer (Figure 5A), in RPMI cell culture medium (Figure 5B), and in 100-fold dilute culture medium (Figure 5C). Undiluted culture medium clearly affected the formation and CE/LIF analysis of the complex. This is not surprising, because the RPMI culture medium was supplemented with 10% FBS. This protein-containing medium is known to affect HIV-1 RT.31 When the cell culture medium was diluted 100-fold, the matrix interference on the complex formation and CE/LIF analysis was minimal. The analyses of mixtures of the RT 26 aptamer and HIV-1 RT in TBE buffer (Figure 5A) and in 100-fold dilute culture media (Figure 5C) show similar electropherograms.

Figure 5. Effect of the sample matrix (RPMI with 10% FBS) on the binding between the RT 26 aptamer and HIV-1 RT. The RT 26 aptamer concentration was fixed at 17 nM, and the HIV-1 RT concentration was fixed at 20 nM. (A) HIV-1 RT and RT 26 aptamer in TBE buffer. (B) HIV-1 RT and RT 26 aptamer in RPMI cell culture medium supplemented by 10% FBS. (C) HIV-1 RT and RT 26 aptamer in the cell culture medium diluted 100-fold with TBE buffer.

CONCLUSIONS A noncompetitive affinity assay has been developed for the direct and selective determination of HIV-1 RT in under 5 min using fluorescently labeled single-stranded DNA aptamers as probes. The assay is capable of quantifying up to 50 nM (6 µg/ mL) HIV-1 RT and is not interfered with by the presence of RTs from AMV, MMLV, or denatured HIV-1. This assay has potential

utility in determining HIV-1 virus titers, or when used in conjunction with laboratory techniques designed to quantify HIV-1 virus lines of unknown titers, in determining HIV-1 viral loads. The HIV-1 RT concentrations in the sera of HIV infected individuals appear to be approximately in the range 9 × 10-4 pg/ mL to 1 pg/mL.16 This is many orders of magnitude below the analytical working range of most current techniques, including the affinity CE assay described in this paper. All existing HIV-1 RT assays are carried out indirectly, utilizing the RT to propagate fluorescent or radiolabeled oligonucleuotide fragments, which are later quantified (typically by slab gel electrophoresis). In the 1980s, HIV-1 RT assays typically involved co-culturing the HIV-1 virus with cell lines of infected individuals, pretreatment to isolate the virus (eg., ultracentrifugation and pelleting of the virus), followed by HIV-1 RT determination. Currently, the most common assay for HIV-1 RT employs the polymerase chain reaction (PCR) to improve detection limits (of the order of 4 pg/mL). No HIV-1 RT assay, including the one we described, is capable of directly determining RT activity in whole blood or serum. Although the assay would not be suitable for direct determination of HIV-1 RT activities in whole blood or serum (aptamer binding constants are 0.1-0.2 µg/mL of HIV-1 RT), it would readily determine RT activities in cell cultures of the HIV-1 virus. Because it is not possible to amplify proteins, the assay we described could be used only in situations in which the virus was cultured to sufficient titer to produce µg/mL levels of HIV-1 RT protein. Hoffman et al.33 cultured viral stocks sufficient to produce 1000 µg/mL levels of total protein. The CE/LIF system described here is amenable to rapid highthroughput HIV-1 RT determination through the use of capillary arrays and solid-state detectors.23,32 Aptamers may be developed for numerous ligands of biological, environmental, and clinical interest, and when applied with the CE/LIF system described

(31) Lee, M. H.; Sano, K.; Morales, F. E.; Imagawa, D. T. J. Clin. Microbiol. 1987, 25, 1717-1721.

(32) Gao, Q.; Pang, H.-M.; Yeung, E. S. Electrophoresis 1999, 20, 1518-1526. (33) Hoffman, A. D.; Banapour, B.; Levy, J. L. Virology 1985, 147, 326-335.

Analytical Chemistry, Vol. 73, No. 24, December 15, 2001

6075

here, they may complement or improve antibody-based methods of affinity electrophoresis.

RPMI, 10% FBS culture media. This work was supported by the Natural Sciences and Engineering Research Council of Canada.

ACKNOWLEDGMENT

Received for review July 2, 2001. Accepted October 7, 2001.

The authors thank Priscilla Gao and Jane Lee of the Cross Cancer Institute at the University of Alberta for donation of the

6076

Analytical Chemistry, Vol. 73, No. 24, December 15, 2001

AC0107305