In the Laboratory edited by
Concepts in Biochemistry
William M. Scovell
Detection of Non-B-DNA Secondary Structures by S1 Nuclease Digestion
Bowling Green State University Bowling Green, OH 43403
Marcel.lí del Olmo, Agustín Aranda, and José E. Pérez-Ortín Departament de Bioquímica i Biologia Molecular, Universitat de València, Av. Dr. Moliner 50, E-46100 Burjassot, Spain, and Instituto de Agroquímica y Tecnología de Alimentos, C. S. I. C., Apartado 73, E-46100 Burjassot, Spain Vicente Tordera Departament de Bioquímica i Biologia Molecular, Universitat de València, Av. Dr. Moliner 50, E-46100 Burjassot, Spain
In nature, almost all DNAs are supercoiled in both prokaryotic and eukaryotic cells (for a review of this concept, see refs 1 and 2). DNA supercoiling is closely associated, by cause or effect, with a defect in the linking number (the number of times the two strands are intertwined) with respect to the number of helical turns in the DNA. This topological state of DNA produces a torsional tension and therefore an excess of free energy that can be used to stabilize non-B-DNA secondary structures that would otherwise be unfavorable. The major types of these structures are denatured DNA, cruciforms, Z-DNA, and intramolecular triple helix (for a review, see 1). The important biological significance (3) of the supercoiling and related non-B-DNA secondary structures is widely discussed in biochemistry and molecular biology books, but experimental approaches for teaching purposes have not been developed so far. We believe it is necessary to include practical experiments covering this important area of research in biochemistry or molecular biology courses. Here we present two simple and inexpensive laboratory experiments to analyze the different topological states of DNA (described in 4 ) and, simultaneously, to detect denatured regions and cruciforms in vitro using the single-strand-specific S1 nuclease. Palindromic DNA sequences (inverted repeats) frequently occur in DNA at functionally interesting locations such as replication origins, operator sites, and transcription termination regions. A DNA fragment carrying palindromic or semipalindromic sequences can adopt two possible stable conformations: the regular DNA duplex with base pairing between strands, and a cruciform structure with intrastrand base pairing of the self-complementary sequence (5, 6 ). At least partial denaturation is needed to extrude the cruciform. Theoretical studies (7 ) and experimental data (8, 9) show that the cruciform structure occurs only in negatively supercoiled DNA over some critical value of superhelical density. We have demonstrated the presence of a cruciform in vitro in a natural (A+T)-rich region of the 3′ region of Saccharomyces cerevisiae gene FBP1 by digestion with S1 nuclease and endonuclease VII (10). The sequence of this region and its flanks is shown in Figure 1a and the most stable cruciform structure it can adopt is drawn in Figure 1b. S1 nuclease recognizes this structure in vitro in supercoiled DNA and is able to cut in the unpaired bases at the loop as described in other cases (11). A DNA (A+T)-rich region capable of undergoing supercoilingdependent denaturation and therefore sensitive to S1 nuclease has also been identified in plasmid pBR322 around the terminator of the ampicillin-resistance gene (12). This region is present also in pUC plasmids. We use these two sequences 762
to show by S1 nuclease digestion how they can adopt the non-B-DNA secondary structures described (cruciform for the FBP1 region and denaturation for the pUC region). In each case the S1 cutting sites are detected by the presence of two discrete fragments in agarose gel electrophoresis when plasmids having a unique site and carrying the sequence of interest are digested with an appropriate restriction enzyme. Materials Plasmid pFBP391(10) is a pUC18 derivative containing a 391-bp fragment of the 3′ region of the S. cerevisiae FBP1 gene. Figure 1a shows the sequence of the alternating TA-tract included in this plasmid and the modifications of this sequence in some derivatives obtained by in vitro mutagenesis. Escherichia coli strain DH5α was transformed with pUC18 and pFBP391 plasmids. The resulting bacterial strains were grown in LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl) supplemented with ampicillin (50 mg/mL) at 37 °C. DNA plasmids were resuspended in TE buffer (10 mM tris-HCl pH 8.0, 1 mM EDTA). S1 nuclease was purchased from Amersham. The incubation buffer used for this nuclease is 30 mM NaCl, 30 mM sodium acetate, 3 mM zinc sulfate A pFBP391WT
TGTCCTTATATATATATATATTTATATATATATATGTGTAT
pFBP391D10
TGTCCTTATATATATATATATATATGTGTAT
pFBP391D28
TGTCCTTGTGTAT
B A T T
T A:T
T: A A:T T: A A:T T: A A:T T: A A:T
Figure 1. (A) DNA sequence of the Saccharomyces cerevisiae FBP1 gene between positions +1118 and +1158 in the wild-type (WT) sequence and in sequences generated by in vitro mutagenesis (assuming +1 for the translation start). Successive D10 and D28 deletions are bracketed. (B) Structure of the most stable cruciform that forms from this sequence.
T: A A:T T: A TGTCCT
TGTGTAT
Journal of Chemical Education • Vol. 75 No. 6 June 1998 • JChemEd.chem.wisc.edu
In the Laboratory
pH 4.8. The buffers for the restriction enzymes were used according to the instructions of the manufacturer (Boehringer Mannheim). The preparation of TBE buffer, electrophoresis sample buffer, and ethidium bromide are described elsewhere (13). Experimental Procedure
Experiment 1: Kinetic Analysis of pUC18 Digest with S1 Nuclease To carry out this experiment, pUC18 (or other pUCseries plasmid) is required. Students can prepare this plasmid following the protocol described in ref 13 or it can be provided ready prepared. Twenty microliters (5 µg) of plasmid DNA is mixed with 100 µL of S1 buffer, and 15-µL aliquots of the solution are introduced into seven 0.5-mL Eppendorf tubes. These tubes are then incubated for 5 min at 37 °C while dilutions of S1 nuclease to 0.25, 1, 50, 100, and 250 units/µL are prepared. To each of 5 tubes is immediately added 1 µL of one of the S1 dilutions. The first tube is a control to which no S1 nuclease (1 µL of 0 units/µL) is added. To two tubes (5 and 7) 1 µL of the 100 units/µL S1 nuclease is added. The mixture in the 7th tube will later be digested with EcoRI restriction enzyme. All tubes are incubated for 30 min at 37 °C. Then the S1 reaction is stopped by the addition of 3 µL of 6 X (six times concentrated) electrophoresis sample buffer. The DNA in tube number 7 is precipitated by adding 1.5 mL of sodium acetate 3 M and 2 volumes of ethanol. The tube is stored at {20 °C for 20 min. Then the DNA is collected by centrifugation at 8000 × g for 10 min, washed with 0.2 mL of 70% ethanol, air-dried, and resuspended in 8 µL of distilled water. One microliter of EcoRI 10X restriction buffer (usually supplied with the enzyme) and 1 µL of this enzyme (5 units/µL) are added and the mixture is incubated for 90 min at 37 °C. The reaction is stopped by adding 2 µL of 6X electrophoresis sample buffer. During the restriction time the students prepare a 0.8% agarose gel in electrophoresis buffer with 8 wells of 0.5-cm width according to Cunningham et al. (14 ) but including ethidium bromide (0.5 µg/mL). Alternatively, a gel can be prepared without ethidium bromide and stained with the same concentration of the dye in water after electrophoresis (4 ). CAUTION: Ethidium bromide is both an irritant and a potent mutagen. Protective gloves should always be worn while using solutions of the dye and handling gels that have been stained with it. A face mask should also be used when weighing out the pure compound. Methods for disposal of this mutagen are described elsewhere (15 ). All the samples previously prepared are applied to the gel together with a λ /HindIII marker (from Boehringer Mannheim). The marker contains fragments of 125, 564, 2027, 2322, 4361, 6557, 9416, and 23,130 bp and is used to estimate the sizes of fragments generated by the digestion. The electrophoresis is run at 80 V until the bromophenol front reaches 1 cm from the end of the gel. (Note that the voltage used for electrophoresis and the percentage of agarose in the gel affect the pattern of relative mobilities of the various forms of the plasmids described below.) The DNA is then visualized by a UV transilluminator. CAUTION: Safety glasses should be worn when observing gels illuminated with UV light. The distance from each band to the top of the lane is measured to determine the fragment size. For this purpose a
calibration curve should be constructed by plotting log10 of the standard sizes versus migration distance. An example of this experiment is shown in Figure 2A.
Experiment 2: Dependence of S1 Nuclease Sensitivity on DNA Supercoiling and TA Sequence Length For this experiment, plasmids pFBP391, pFBP391D10, and pFBP391D28 are required. Again, students can prepare these plasmids following the protocol described in ref 13 or they can be provided ready prepared. Ten microliters (2.5 µg) of pFBP391, pFBP391D10, and pFBP391D28 are placed in 0.5-mL Eppendorf tubes. For pFBP391, two identical samples are prepared. Five microliters of 10X S1 incubation buffer, 1 unit of S1 nuclease, and up to 50 µL of double-distilled water are added to each tube. The samples are incubated at 37 °C for 30 min and the DNA is precipitated by adding 5 µL of 3 M sodium acetate and 2 volumes of cold ethanol. The tubes are stored at {20 °C for 20 min. The precipitated DNA is then collected, washed, airdried (as in Experiment 1), and dissolved in 5 µL of TE buffer. Two microliters of the DNA samples are transferred to 0.5-mL Eppendorf tubes containing 1 µL of sample buffer. To the remaining 3 µL, 1.5 µL of 10X restriction buffer for Asp700 and 5 enzyme units are added and the volume is adjusted to 15 µL with double-distilled water. The mixtures are incubated at 37 °C for 90 min and restriction is stopped with 3 µL of sample buffer.
Tube (lane) 1 2 3 4 5 6 7 8 Figure 2. Kinetics of pUC18 plasmid S1 digestion. (A) Plasmid DNA was digested with 0, 0.25, 1, 50, 100, and 250 units of S1 nuclease ( tubes / lanes 1– 6). A sample digested with 100 units of S1 nuclease and then with EcoRI is also included ( lane 7, S1+E). λ/Hin dIII molecuA lar weight marker is applied on the last B lane. Arrows on the left indicate the mobility of the supercoiled (ccc), circular relaxed (oc) and linear ( lin) forms of pUC18 plasmids. Arrows on the right indicate the migration of fragments resulting from digestion with S1 and EcoRI nucleases (numbers show the sizes of the fragments in bp). (B) Scheme of the plasmid indicating alternative positions of the S1-sensitive region (A, B) relative to the restriction enzyme recognition sequence. B
EcoR1
JChemEd.chem.wisc.edu • Vol. 75 No. 6 June 1998 • Journal of Chemical Education
763
In the Laboratory
The remaining samples (pFBP391, pFBP391D10, and pFBP391D28) are applied on another 6-well 0.8% gel together with controls of undigested plasmid pFBP391, S1digested plasmid pFBP391, and λ /HindIII marker. Figure 4A shows an example of this experiment. Results and Discussion These experiments provide a practical study of several important topics in molecular biology. Experiment 1 (Fig. 2A) shows the different tertiary structures of a plasmid DNA revealed by analysis of the kinetics of the digestion of pUC18 by S1 nuclease. As shown in the first lane, the plasmid preparation contains mostly supercoiled plasmid DNA (ccc form) and hence the sequence located around the terminator of the ampicillin resistance gene can adopt a denatured structure. Most plasmid preparations contain a variable proportion of open circular molecules (oc form) due to breakage during isolation (13, 15). The relative amounts of ccc and oc forms vary from one experiment to another. λ Hin dIII
To check that the secondary structure adopted by this sequence depends on the DNA supercoiling, a sample of pFBP391 is prepared by first digesting with the restriction enzyme (using 10 µL of the plasmid in a total volume of 50 µL). Then the DNA is precipitated with 5 µL of 3 M sodium acetate and 2 volumes of ethanol. After collection and washing, the sample is dissolved in 10 µL of TE. One half of the solution is transferred to another tube and 1 µL of 6X sample buffer is added. The other half is digested with S1 nuclease and the DNA is precipitated in the usual way. The final pellet is dissolved in 10 µL of TE and 2 µL of 6X electrophoresis sample buffer is added. To detect the non-B-DNA secondary structure and demonstrate that this structure depends on DNA supercoiling, a 0.8% agarose gel should be used. In this gel, one group of samples of pFBP391 is used together with the sample digested with restriction enzyme before S1 treatment. The following plasmid samples should be included: undigested, digested with restriction enzyme but not with S1 nuclease, and digested with S1 nuclease but not with restriction enzyme. One well is used for the molecular weight marker λ /HindIII. Conditions for running and visualizing the gel are the same as for Experiment 1. Figure 3A shows an example of this experiment.
Lane B
Lane
1
2
3
4
5
1
2
3
4
6
Asp 700
Asp 700
6 800
1230
Figure 3. Sensitivity of the FBP1 gene TAAsp 700 tract to S1 and dependence on DNA supercoiling. (A) pFBP391 plasmid was undigested (ND, lane 1) or digested with S1 (lane 2) or the Asp700 restriction enzyme (lane 4). In lane 3 (S1+A) the sample was digested with the restriction enzyme after A S1 treatment. In lane 5 (A+S1) a sample B prepared by first digesting with the restriction enzyme and then treating with S1 nuclease is shown. The last lane contains the λ/HindIII marker. Arrows on the left indicate the mobility of the different topological forms of the plasmid as in Fig. 2A; arrows on the right mark the bands resulting from digestion in the sequence capable of cruciform formation. Sizes of these bands in bp are also indicated. * indicates chromosomal DNA contained in this plasmid preparation. (B) Scheme of the plasmid indicating alternative positions of the S1-sensitive region ( A, B) relative to the restriction enzyme recognition sequence.
S1 sensitive secondary site
B
764
5
1850
2280
S1 sensitive site in FBP1
Figure 4. Analysis of effect of TA content of sequence capable of cruciform formation on the S1 sensitivity. ( A ) pFBP391 was digested with S1 nuclease and applied on the gel ( lane 3) together with a sample of the plasmid untreated with the enzyme ( lane 2). Lanes 4, 5, and 6, respectively, show samples of pFBP391 (wild type), pFBP391D10, and pFBP391D28 digested with the restriction endonuclease Asp700 after S1 digestion. The first lane shows DNA marker. Arrows on the left mark bands resulting from digestion in the sequence capable of cruciform formation. Arrows on the right indicate secondary region of sensitivity to the nuclease ( located in the terminator of the ampicillin gene). (B) Schematic representations of the pFBP391 plasmid indicating positions of the cutting sites for the restriction enzyme and the S1 nuclease (in both regions). Sizes of fragments (in bp) that can be generated are indicated.
Journal of Chemical Education • Vol. 75 No. 6 June 1998 • JChemEd.chem.wisc.edu
In the Laboratory
The extent of supercoiling of the ccc form depends on the physiological state of the cells. Stressed cells (e.g., grown to stationary phase or in the presence of chloramphenicol) have higher levels of supercoiling (17 ). Nevertheless, the supercoiling levels observed in the culture conditions described here are high enough for the appearance of S1 sensitivity. At low S1 concentrations the enzyme recognizes the denatured region and introduces a nick on one of the strands. This results in a relaxation of the plasmid and the appearance of oc molecules, as seen in lanes 2 and 3. The nick introduced in one of the strands provokes a single-stranded region that is recognized by the nuclease on the opposite strand, giving rise to linear molecules (lin) that begin to appear even at these low enzyme concentrations. The percentage of linear molecules relative to open circular ones increases with the concentration of S1 nuclease (compare lanes 2–4). Finally, at higher S1 concentrations the linear fragment can be further degraded by the enzyme (lanes 4–6). Restriction of the S1-linearized plasmid with the EcoRI restriction enzyme (lane 7) allows determination of the approximate location of the denatured region in the plasmid. As shown in the scheme in Figure 2B, two alternative sites (A and B), located at 900 bp from the EcoRI site, are possible, one of which (A) coincides with the data in the literature (12). Experiment 2 is important for introducing students to analysis of the determinants of S1 sensitivity. A plasmid carrying a sequence capable of cruciform formation is used. As in Experiment 1, first we show that this sequence is S1-sensitive. In Figure 3A, lane 1 shows that the supercoiled plasmid is predominant in the DNA preparation used. When this plasmid is digested with S1 and the restriction enzyme (S1+A) we detect two bands (together with remaining linear plasmid) whose sizes are compatible with two positions (A and B in the scheme of Fig. 3B) for the S1-sensitive site. Position A corresponds to the region previously described (10). We also show that when a plasmid loses its supercoiled state by digestion with the restriction enzyme, the S1 nuclease cannot recognize any sensitive region and no additional bands appear (lane 5). This part of the experiment could be done using pUC18 plasmid. In this case it is only necessary to add one sample to Experiment 1—one in which EcoRI is used first and S1 is used later (E+S1 sample). The result should be similar to the one obtained with the A+S1 sample: the 1786- and 900-bp bands do not appear. Finally, we show (Fig. 4) that the TA content of the cruciform-forming sequence in pFBP391 is responsible for the S1 sensitivity. Progressive deletions of the TA region (Fig. 1A) from 13 pairs (WT, lane 4) to 9 (D10, lane 5), and 0 (D28, lane 6) are associated with progressive decrease in sensitivity to S1 nuclease. Simultaneously, an increase of the sensitivity to this nuclease is detectable in a secondary site, located around the terminator of the ampicillin-resistance gene and coincident with the S1-sensitive site analyzed in Experiment 1. This indicates that other destabilized sites in the plasmid acquire non-B-DNA secondary structure when the inability to extrude the cruciform is not relaxing the torsional stress. This experiment may be performed according to different schedules. If plasmid isolations are not carried out by the students, the first session can be limited to Experiment 1. The electrophoresis corresponding to this experiment may be carried out during the second session together with the preparation of samples for Experiment 2. In a third session the
electrophoreses can be performed. It is also possible in this session to introduce students to computer programs related to this field. Programs that predict cruciform formation, such as the CRUCIFORM program of the PCGENE package (IntelliGenetics Inc., University of Geneva), are available. It would be possible to have students use this kind of program to design these and other sequences capable of adopting alternative secondary structures. Another possibility is to link this experiment with additional experiments (e.g., plasmid isolation [13], restriction maps [13], and PCR [16 ]) that can easily be adapted to the experiment. The complete set of experiments requires the pFBP391 series of plasmids, which can be obtained from the authors. The experiment can also be limited to the pUC18 part, given that this plasmid is commercially available and widely distributed (other pUC-series plasmids may be used as well). In this case the main topics of the practical experiment are still covered: the S1 sensitivity of alternative secondary structures, the supercoiling dependence of those structures, and the different electrophoretic mobilities of topological isoforms of the plasmids. Experimental costs are low, and the small amounts of chemicals used are available in every laboratory. The laboratory equipment (microfuge, electrophoresis cuvettes, UVtransilluminator, automatic pipets) is generally available in biochemistry and molecular biology laboratories. The experiment is suitable for a general program of biochemistry experiments and for courses with large numbers of students. It is also possible to include it in a specific program of recombinant DNA experiments for small groups of students. Acknowledgments This work has been supported by grant PB91-0329 from D.G.I.C.Y.T. (Spanish Ministry for Education and Science) to J. E. P. O. and grant 1160 from the Universitat de València to M. del O. Literature Cited 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.
16. 17.
Scovell, W. M. J. Chem. Educ. 1986, 63, 562–565. Palecek, E. Crit. Rev. Biochem. Mol. Biol. 1991, 26, 151–226. Sinden, R. R. J. Chem. Educ. 1987, 64, 294–301. Russo, R. N.; Russo, J. E. J. Chem. Educ. 1993, 70, 330–332. Platt, J. R. Proc. Natl. Acad. Sci. U. S. A. 1955, 41, 181–183. Gierer, A. Nature 1966, 212, 1480–1481. Vologodskii, A. V.; Frank-Kamenetskii, M. D. FEBS Lett. 1982, 143, 257–260. Mizuuchi, K.; Mizuuchi, M.; Gellert, M. J. Mol. Biol. 1982, 156, 229–243. Lilley, D. M. J.; Markham, A. F. EMBO J. 1983, 2, 527–533. del Olmo, M.; Pérez-Ortín, J. E. Plasmid 1993, 29, 222–232. Lilley, D. M. J. Proc. Natl. Acad. Sci. U. S. A. 1980, 77, 6468– 6472. Kowalski, D.; Eddy, M. J. EMBO J. 1988, 8, 4335–4344. Pérez-Ortín, J. E.; Ramón, D.; Ferrer, S.; Tordera, V. Biochem. Educ. 1986, 14, 142–144. Cunningham, N.; Tomlinson, J.; Jurnak, F. Biochem. Educ. 1983, 11, 130–134. Sambrook, J.; Fritsch, E. F.; Maniatis, T. Eds.; Molecular Cloning, 2nd ed.; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, 1989. Weller, D. L. J. Chem. Educ. 1994, 71, 340–342. Dayn, A.; Malkhosyan, S.; Duzhy, D.; Lyamichev, V.; Panchenko, Y.; Mirkin, S. M. J. Bacteriology 1991, 173, 2658–2664.
JChemEd.chem.wisc.edu • Vol. 75 No. 6 June 1998 • Journal of Chemical Education
765
