Detection of Polybrominated Diphenyl Ethers in Herring Gull (Larus

Sep 12, 2008 - Herring gull (Larus argentatus) eggs from the Great Lakes contained 321−1191 ng/g wet weight (ww) ∑PBDEs (2) and eggs of marine and...
1 downloads 0 Views 202KB Size
Download PDF
Environ. Sci. Technol. 2008, 42, 7715–7721

Detection of Polybrominated Diphenyl Ethers in Herring Gull (Larus argentatus) brains: Effects on mRNA Expression in Cultured Neuronal Cells DOUG CRUMP,* MAGDALENA M. JAGLA, AMY KEHOE, AND SEAN W. KENNEDY Environment Canada, National Wildlife Research Centre, 1125 Colonel By Drive, Ottawa, Ontario, Canada, K1S 5B6

Received April 25, 2008. Revised manuscript received July 30, 2008. Accepted August 8, 2008.

In recent years, polybrominated diphenyl ethers (PBDEs) have been detected at increasing levels in the environment due to their widespread use as flame retardants. PBDEs can affect thyroid hormone homeostasis and the cholinergic neurotransmitter system. In this study, several PBDE congeners were detected in whole brain samples and neuronal cells of herring gulls (Larus argentatus). A herring gull neuronal cell culture method was used to determine the effects of PBDEs on cytotoxicity and mRNA expression. Real-time RT-PCR assays were developed for genes associated with the thyroid hormone pathway (thyroid hormone receptors [TR R and β], transthyretin [TTR]), and the cholinergic system (neuronal nicotinic acetylcholine receptor R-7 [nAChR R-7]). Administration of T3 resulted in a significant up-regulation of the two TRs and a significant down-regulation of TTR. TTR was also down-regulated by the commercial penta-BDE mixture, DE-71. In contrast, neither DE-71, nor BDE-47, -99, or -100 altered the mRNA levels of the TRs or nAChR R-7. The in vitro approach was a relevant model system for assessing the effects of PBDEs on cytotoxicity and mRNA expression. Herring gull neuronal cells were responsive to both T3 and PBDEs although, receptors associated with two predicted mechanisms of PBDE action were not effective molecular biomarkers of exposure.

Introduction Polybrominated diphenyl ethers (PBDEs) are flame retardants used in products such as electrical equipment, furniture, plastics, polyurethane foam, and building materials. In 2001, approximately 70 000 metric tonnes of PBDEs were produced (1), and several monitoring studies conducted worldwide suggest that avian species are subject to PBDE bioaccumulation. Herring gull (Larus argentatus) eggs from the Great Lakes contained 321-1191 ng/g wet weight (ww) ∑PBDEs (2) and eggs of marine and freshwater birds from British Columbia had 1-455 ng/g ww ∑PBDEs (3). PBDEs were detected in liver samples of common cormorants (Phalacrocorax carbo) and glaucous gulls (L. hyperboreus) at concentrations ranging from 2-6400 ng/g lipid weight (4, 5). Naert et al. (6) reported median PBDE concentrations of 14 ng/g ww in sparrow hawk (Accipiter nisus) brain samples. In * Corresponding author phone: 1-613-998-7383; fax: 1-613-9980458; e-mail: [email protected]. 10.1021/es801145j CCC: $40.75

Published on Web 09/12/2008

Published 2008 by the American Chemical Society

contrast to the abundance of PBDE monitoring data available for avian species, there are few studies which assess the toxic, biochemical, and molecular effects of these compounds in birds (7-10). The thyroid hormone (TH) pathway has been identified as one possible target of PBDEs. Disruption of this pathway could be critical because THs are involved in several aspects of avian biology including thermoregulation, growth, development, cell differentiation/maturation, and reproduction (11). Plasma thyroxine (T4) levels were reduced in American kestrels (Falco sparverius) exposed via diet to BDE-47, -99, and -100 (7). T4 depletions were also observed in rodents and ranch mink exposed to PBDEs (12-16). Hydroxylated metabolites of PBDEs bound with high affinity to transthyretin (TTR) in a competitive binding assay and 4-hydroxyBDEs had significant affinity for the thyroid hormone receptors (TRs) (17-19). Recently, a down-regulation of TTR mRNA was reported in chicken embryonic neuronal (CEN) cells exposed to the commercial penta-BDE mixture, DE-71 (10). To our knowledge, no avian studies exist assessing the effects of PBDEs on the cholinergic transmitter system. Many behavioural characteristics and cognitive functions (e.g., memory, learning) are closely linked to the cholinergic system. Nicotinic and muscarinic receptors were decreased in the hippocampus of mice and rats exposed to BDE-99 and BDE-153, and behavioural end points associated with memory and learning were negatively impacted (20, 21). Conversely, Bull et al. (22) did not observe changes in cholinergic parameters in the cerebral cortex of mink (Mustela vison) exposed to environmentally relevant levels of DE-71 via diet or in utero. In the present study, herring gull brain samples and neuronal cells, collected at various breeding colonies, were analyzed for PBDEs. Herring gull embryonic neuronal (HGEN) cells were treated with PBDEs to test the hypothesis that exposure would alter the expression of genes associated with the TH pathway and the cholinergic transmitter system. Three individual congeners (2,2′,4,4′-tetra-BDE (BDE-47)); 2,2’4,4′,5-penta-BDE (BDE-99)); 2,2′,4,4′,6-penta-BDE (BDE100)) and one penta-BDE mixture, DE-71, were assessed. Real-time reverse transcription polymerase chain reaction (real-time RT-PCR) assays were used to identify alterations in mRNA levels of TR R and β, TTR, and neuronal nicotinic acetylcholine receptor R-7 (nAChR R-7). The avian neuronal cell culture technique enhanced our ability to identify end points of PBDE exposure for a wild avian species in a controlled laboratory setting.

Materials and Methods Chemicals. The commercial penta-BDE mixture DE-71 (lot 901203; M.W. 564.69) was supplied by the Great Lakes Chemical Corporation (West Lafayette, IN). BDE-47, -99, and -100 were purchased from Wellington Laboratories (Guelph, ON) and 3,3′,5′-triiodo-L-thyronine (T3) was from SigmaAldrich (Oakville, ON). Stock solutions and serial dilutions of the above chemicals were prepared in dimethyl sulfoxide (DMSO) (Sigma-Aldrich). Analysis of PBDEs in Brain Tissue and Neuronal Cells of Herring Gulls. The five adult herring gull cortex samples analyzed were from historical collections at two Great Lakes sites: three individuals from a 1991 collection in Upper Green Bay, Lake Michigan (Big Sister Island; 45°13′29″N, 87°8′52″W) and two individuals from a 2003 collection in Hamilton Harbour, Lake Ontario (43°18′23″N, 79°48′16″W). Cortex samples (2 g ww) were homogenized and analyzed for PBDE VOL. 42, NO. 20, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY 9 7715

congeners following the method described by Gauthier et al. (2). In brief, accurately weighed aliquots were homogenized with anhydrous sodium sulfate followed by a neutral extraction with dichloromethane:hexane (1:1). Prior to the removal of lipids and biogenic materials by gel permeation chromatography and Florisil column chromatography, a portion of the extracts was used for lipid determination and a portion was used for spiking with labeled BDE internal standards. Purified sample extracts were analyzed for PBDEs using a capillary gas chromatograph, coupled with a mass selective detector (Agilent Technologies, Mississauga, ON) operated in selected ion monitoring mode. PBDE levels in embryonic cortex and neuronal cells were determined in embryos collected from Kent Island, New Brunswick (44°41′15″N, 66°41′40″W) as above, except that the sodium sulfate and internal standards were added directly to the sample vials because of the small sample size. Kent Island represents a non-Great Lakes reference site where legacy organochlorines have traditionally been much lower than sites in the Great Lakes (23). Fertilized, unincubated eggs were incubated at the National Wildlife Research Centre (NWRC) under the conditions described below. One day prior to hatch (day 26-27), cerebral cortices from four individuals were split into two pools; one pool for direct analysis in whole brain tissue (left hemisphere; 166 mg ww) and one pool for analysis in neuronal cells prepared as described below (right hemisphere; 71 mg ww). Residue levels of several individual BDE congeners were determined on a wet weight basis (ng/g). Sources of Eggs and Incubation Conditions. Fertilized, unincubated herring gull eggs were collected from one-egg nests at Chantry Island, Lake Huron (44°29′22″N, 81°24′7″W). Eggs were incubated at 37 °C and 60% relative humidity in Curfew model RX250 incubators (Althorne, Essex, UK) for 14 days (stage 37; ref 24). The incubation period for herring gulls is the same as turkeys; 28 days. Mun and Kosin (25) determined that a turkey embryo incubated for 14 days is equivalent to a stage 37 chicken embryo. All procedures were conducted according to protocols approved by the Canadian Council on Animal Care Committee at the NWRC. Preparation and Dosing of Avian Neuronal Cell Cultures. Primary cell cultures were prepared from the cerebral hemispheres of stage 37 herring gull embryos according to the method described by Crump et al. (10). Briefly, cerebral hemispheres were minced with a scalpel in neuronal isolation medium (25 mM HEPES, 128.5 mM NaCl, 5.4 mM KCl, 5.5 mM d (+) glucose, 51.8 mM d (+) saccharose, 0.1% BSA, at pH 7.4; Sigma-Aldrich) and vacuum-filtered through a series of nylon sieves with pore sizes of 200, 100, 50, and 25 µm. The filtrate was centrifuged for 13 min at 150g, and the resulting pellet was weighed and suspended in Neurobasal medium containing 2% B27 supplement, 0.5 mM glutamine, and 25 µM glutamate (Invitrogen, Burlington, Ontario). A 350 µL volume containing approximately 2.5 × 106 cells/mL was plated in 48-well plates and cultured at 37 °C in a humidified incubator with 5% CO2. After incubation for 24 h, solutions of DE-71, the three BDE congeners, and T3 in DMSO (2.5 µL/well; nominal concentration range 0.01-300 µM, 0.01-3 µM, or 0.03-30 nM for DE-71, BDE congeners, and T3, respectively) were added to the 48-well plates. Cells were incubated for another 24 h, the medium was removed, and plates were either immediately frozen and stored at -80 °C for RNA isolation or assessed for cell viability. Cell Viability Determination. Cell viability was determined for HGEN cells exposed to DE-71 (0.01-300 µM) and BDE congeners (0.01-3 µM) as described by Crump et al. (10). A one-way ANOVA followed by Bonferroni’s t test was performed to compare the relative fluorescence values of treatment groups to the untreated control using SigmaStat v2.03 (SPSS, Point Richmond, CA). 7716

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 20, 2008

RNA Isolation and cDNA Synthesis. Total RNA was obtained from PBDE and T3-exposed HGEN cells using TRIzol (Invitrogen). 100 µL of TRIzol was added to all 48 wells and pooled based on treatment as follows; three replicate pools comprised of four wells/treatment. Total RNA was treated with DNA-free (Ambion, Austin, TX) and quantified by UV spectrophotometry. 200 ng of total RNA from each of the three replicate pools per treatment was annealed with 150 ng random primers (Invitrogen) and cDNA was generated using Superscript II RNase H-reverse transcriptase as described by the manufacturer (Invitrogen). An identical reaction without the reverse transcriptase was performed to verify the absence of genomic DNA (no-RT control). Real-Time RT-PCR. Primer pairs and Taqman fluorogenic probes for real-time RT-PCR assays were designed using partial herring gull mRNA sequences obtained by homology cloning for nAChR R-7, TR R, and TR β (accession numbers: AY914169, AY914170, AY914171, respectively). β-Actin primers and probe were graciously provided by J. Head, and TTR primers were designed for SYBR green analysis based on the chicken sequence. All primer and probe sequences are shown in Table 1. The Brilliant QPCR Core Reagent kit (Stratagene, La Jolla, CA) was used for the two multiplex assays; TR R and β in triplex with β-Actin and nAChR R-7 in duplex with β-Actin. Each 25 µL reaction contained 1 × Core PCR buffer, 5 mM MgCl2, 0.8 mM dNTP mix, 8% glycerol, 75 nM ROX reference, 900 nM forward primer (except β-Actin (300 nM forward primer)), 300 nM reverse primer (except β-Actin (60 nM reverse primer)), 200 nM fluorogenic probes, 5 µL diluted cDNA, and 1.25 U SureStart Taq Polymerase. The thermocycle program included an enzyme activation step at 95 °C (10 min) and 40 cycles of 95 °C (30 s) and 60 °C (1 min). For TTR, each 25 µL reaction contained 150 nM forward and reverse primers, SYBR Green Master Mix (Stratagene), ROX reference dye and 5 µL diluted cDNA. Reactions that amplified β-Actin contained an additional 3 mM MgCl2. Amplification conditions included a denaturation step at 94 °C (10 min) followed by 40 cycles of 95 °C (30 s), 60 °C (30 s), and 72 °C (1 min). Melting curves were obtained for each reaction to verify the amplification of a single product. Standard curves were generated for all genes from serial dilutions of cDNA and MxPro v3.00 software (Stratagene) was used to calculate the relative quantities of each gene. No-RT and no template controls were included to verify the absence of contamination. Each assay was run at least once in duplicate (SYBR) or triplicate (TaqMan) for the three replicate pools/treatment group. Data Analysis for Real-Time RT-PCR. Relative quantity values were normalized to the internal control gene, β-Actin, and fold changes were calculated relative to DMSO-treated cells. A one-way ANOVA followed by Bonferroni’s t test for multiple comparisons versus control was performed to determine statistically significant differences in mRNA abundance between DMSO-treated cells and those treated with PBDEs or T3 (SigmaStat v2.03; SPSS). Changes were considered statistically significant if p < 0.05.

Results PBDE Levels in Herring Gull Brain Tissue and Neuronal Cells. Thirteen tri- to hepta-BDE congeners were detected in adult herring gull cortex homogenates (Table 2; samples 1-5). The ∑BDE congeners associated with the commercial mixture DE-71 (i.e., BDE-47, -99, and -100) were detected at levels ranging from 10 to 96 ng/g ww. Of the 13 BDE congeners analyzed, BDE-47 was the most abundant in all adult cortex samples except for individual three, in which BDE-99 was the most abundant. PBDE levels were also determined in embryonic cortex samples because this was the developmental stage utilized

5′FAM/3′BHQ-1 5′FAM/3′BHQ-1 5′Quasar 670/3′BHQ-2 N/A 5′HEX/3′BHQ-1 SYBR green. b

TaqMan-multiplex.

nAChR R-7 TR Ra TR βa TTRb β-Actina,b

Discussion

a

GCCACTGTGCAGCAGGTTT GAATGTTGTGTTTGCGGTAGTTG AGGAACAATGGAGGGAAGAGTTCT GCAGTGAACACCACATCAGC CGGATATCCACATCGCACTT GCTGGAAGGGGTTCACTGC ATCTGCGTGGAGAAGATCGAG TGAAAGTGACAGACCTGCGAATG AAGCTGGCAGGACTTTGCTA TGGGTATGGAGTCCTGTGGTA

TGTTGGCGAGCAGGTCATCCTCCC TCGAAGGCCAGCAGGTACGTCTCC CTGCCATGCCAGCCGCTTCCTGC N/A CCATGAAACCACCTTCAACTCCATCA

fluorophor probe (5′-3′) reverse primer (5′-3′) forward primer (5′-3′)

a

gene

TABLE 1. Primer Pairs, Probe Sequences, And Fluorophor Used in the Real-Time RT-PCR Assays for Herring Gulls

for cell culture. Several congeners were detected and BDE99 was the most abundant followed by BDE-47, -100, and -153 (Table 2; sample 6). In addition, PBDEs were detected in neuronal cells (Table 2; sample 7) indicating that levels in whole brain were not solely a result of extra-cerebral fluid or blood vessels. Approximately 10 ng/g ww ∑BDE47,99,100 and 14 ng/g ww total ∑PBDEs were detected in isolated neuronal cells compared to 38.2 and 44.3 ng/g ww in whole cortex samples (Table 2; compare samples 6 and 7). These analytical data and residue data from herring gull egg homogenates (2) formed the basis for selecting environmentally relevant concentrations for the in vitro exposure study. We assumed that 100% of the PBDEs would be associated with the neuronal cells, and calculations were based on the weight of the cells to facilitate comparison to levels reported in herring gulls (i.e., on a µg/g basis; Table 3). Cell Viability. HGEN cells treated with DE-71 showed a significant concentration-dependent decrease in viability from 10 to 300 µM, with fluorescence values approaching the ethanol-killed cells (Figure 1). Viability for all other treatments, including the DMSO vehicle, was not significantly different than the untreated control. Exposure to 0.01-3 µM of the three individual congeners (BDE-47, -99, and -100) did not alter cell viability (data not shown). In all cases, cells selected for RNA isolation were from treatment groups that were deemed viable (0.01, 0.1, and 3 µM). mRNA Expression. The Ct values for the internal control gene, β-Actin, were stable across all treatments and no-RT and no-template negative controls did not amplify. T3 treatment, the positive control for TH-dependent gene expression, significantly increased TR R and β mRNA levels at 0.3 nM (4-fold) and 0.03 and 0.3 nM (5-fold), respectively (Figure 2A and B). mRNA levels of both receptors returned to basal (i.e., DMSO) levels at 3 and 30 nM suggesting a desensitization mechanism to protect cells from excess agonist (26). Exposure to T3 also resulted in a significant 2 to 4-fold down-regulation of TTR at all the concentrations tested (Figure 3). Alternatively, neither DE-71 (Figure 4) nor the three BDE congeners (data not shown) significantly affected the expression levels of TR R or β. At 0.01 and 3 µM DE-71, TTR was down-regulated by 2- to 3-fold whereas, the 0.1 µM group had a diminished (∼1.5-fold) effect on expression (Figure 3). Treatment with the three BDE congeners alone had no effect on TTR expression. Finally, we observed no significant alterations in nAChR R-7 mRNA levels following DE-71 (Figure 5), BDE-47,-99, or -100 administration.

This is the first study to explore the effects of PBDEs on toxicity and mRNA expression in the developing herring gull brain. PBDEs were detected in herring gull cerebral cortices and neuronal cells and the in vitro screening technique elucidated important information regarding potential molecular modes of action of environmentally relevant concentrations of PBDEs in a wild avian species. Exposure to DE-71 decreased HGEN cell viability at concentrations g10 µM. A similar decrease in viability was observed in CEN cells treated with DE-71 (10). This sensitivity must be interpreted based on the ability of PBDEs to accumulate in brain tissue. ∑BDE47,99,100 was detected in adult and embryonic herring gull cerebral cortices at levels comparable to those found in sparrow hawk brain samples (i.e., 10-96 ng/g ww) (6). In addition, this was the first study to measure PBDEs in isolated avian neuronal cells and approximately 30% of the PBDEs measured in whole cortex were detectable in neuronal cells. The detection of BDE congeners in neuronal cells suggests that they can cross the blood-brain barrier and are not solely associated with blood VOL. 42, NO. 20, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

7717

TABLE 2. Concentrations (ng/g, Wet Weight) of 13 Major BDE Congeners in Herring Gull Cerebral Cortex Samples and Neuronal Cells

1

3

0.12 0.19 5.63 0.10 0.03 0.01 2.58 1.72 0.01 3.61 1.18 0.21 0.05

0.23 0.43 18.89 0.30 0.05 0.02 8.66 5.54 0.02 5.88 2.17 0.30 0.03

0.26 0.46 26.05 0.14 0.10 0.53 27.12 9.32 0.15 9.12 2.80 0.21 0.02

0.14 0.31 18.89 0.23 0.03 0.02 8.44 6.00 0.04 5.63 2.49 0.20 0.08

0.49 1.41 49.33 0.61 0.09 0.03 21.81 24.46 0.05 37.53 5.89 0.90 0.05

nd nd 15.42 nd nd 1.60 17.80 4.97 nd 2.85 1.67 nd nd

nd nd 4.77 nd nd 1.04 3.94 1.79 nd 0.87 1.40 nd nd

9.93 15.44

33.09 42.52

62.49 76.28

33.33 42.5

95.6 142.65

38.19 44.31

10.5 13.81

compound BDE-17 BDE-28 BDE-47 BDE-66 BDE-71 BDE-85 BDE-99 BDE-100 BDE-138 BDE-153 BDE-154 BDE-183 BDE-190 ΣBDE47,99,100 total ΣPBDE

concentration (ng/g, ww) Hamilton Harbourb 4 5

Big Sister Islanda 2

Kent Islandc 6 (cort.) 7 (cells)

a Nos. 1-3 are adult cortex samples from Big Sister Island, Lake Michigan in 1991. b Nos. 4-5 are adult cortex samples from Hamilton Harbour, Lake Ontario in 2003. c No. 6 is a pool of four embryonic cortices (cort.) and 7 is neuronal cells (cells) prepared from a pool of four embryonic cortices. Embryos were collected from Kent Island, New Brunswick in 2006.

TABLE 3. Comparison of Nominal Medium Concentrations (µM) of DE-71 and the Equivalent Concentrations Based on Weight (µg/g) Utilized in the Herring Gull Neuronal Cell Culture Exposure Studies under the Assumption of 100 and 15% Uptake into the Cells 100% uptake nominal (µM) 0.01 0.1 3

15% uptake µg/g

µg/g a

1.1 11 330

0.165b 1.65 49.5

a Concentration similar to levels detected in herring gull egg homogenates from the Great Lakes. b Concentration similar to levels detected in adult herring gull brain homogenates from the Great Lakes.

vessels and extra-cerebral fluid when whole brain homogenates are analyzed. Given the availability of PBDE residue data for herring gull egg homogenates (2) and brain samples (this study), environmentally relevant concentrations were selected for the exposure experiments based on the assumption that 100% of the PBDEs would be associated with the neuronal cells. However, an accumulation study using rat neocortical cells revealed that only 15% of applied BDE-47 was associated with the cells, whereas 55% remained in the medium and 30% was associated with the plastic culture dish (27). Assuming a 15% uptake rate by HGEN cells, concentrations of 0.01 and 0.1 µM were similar to levels reported in herring gull brain samples and egg homogenates from the Great Lakes, respectively (Table 3). There are few studies which incorporate alterations in mRNA levels as an end point to assess the effects of environmental chemicals in the avian central nervous system (CNS). We demonstrated that both T3 and PBDEs altered the steady-state mRNA levels of key gene targets of the thyroid hormone pathway in HGEN cells. Exposure of stage 37 HGEN cells to T3 significantly increased TR R and β mRNA providing empirical evidence that the receptors were detectable at the developmental stage examined. This finding corroborated results by Haidar et al. (28) who reported a high abundance of TRs in neuronal nuclei of stage 37 chickens. Despite the 7718

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 20, 2008

detection of TRs in HGEN cells, neither DE-71 nor the three BDE congeners altered their expression. Similarly, DE-71 had no effect on the mRNA levels of either TR isoform in CEN cells (10). Only a limited number of hydroxylated BDEs have been shown to bind TRs (19) and stimulate cell proliferation in the T-screen assay (29) and the present molecular data refute any direct binding or activation of TRs by the PBDEs assessed. In fact, very few chemicals bind to avian TRs leading some to conclude that this end point has little relevance as a screening tool to identify thyroid disruption (30). Unlike the lack of response observed for the TRs, DE-71 down-regulated TTR mRNA in HGEN cells. The 0.1 µM group had a slightly diminished effect, but the overall downregulation was consistent with T3-treated HGEN cells and CEN cells exposed to DE-71 in which a down-regulation of 2-fold was observed at 0.1, 1, and 3 µM (10). The inclusion of additional DE-71 treatments for future herring gull studies (e.g., 0.03, 0.3, 1 µM) is warranted to further characterize the nature of the response profile. None of the individual congeners altered TTR expression levels suggesting that the down-regulation was not the result of a single component of DE-71. One of the key roles of TTR in birds is the transport of T4 to the CNS during embryonic development (31). T4 is critical for the establishment of brain architecture and altered thyroid states during CNS development could result in serious, permanent effects (29). In a TTR-null mutant mouse line, Palha et al. (32) observed a significant reduction of brain T4 content in null mutants but T3 levels remained unchanged. The null mutants appeared euthyroid and thyroid-stimulating hormone (TSH) production was not stimulated despite a significant reduction in total serum T4 levels (33). The total T4 reductions combined with a lack of effect on T3 levels and TSH production is strikingly consistent with findings from avian and mammalian studies assessing the effects of PBDEs on TH homeostasis (7, 12-16). Thus, altered TTR levels should be considered as a contributing factor to the observed TH disruption and assessments at the protein level are warranted for future studies. The cholinergic transmitter system is a potential target of PBDEs however, we did not observe alterations in nAChR R-7 mRNA following PBDE exposure in HGEN cells. nAChR R-7 is expressed in the cortex, hippocampus, amygdala,

FIGURE 1. Calcein-Am cell viability results for HGEN cells exposed to DE-71. Viability is reported as a percentage of the fluorescence signal obtained from the untreated control and standard error bars were calculated based on three replicates per treatment (Significant differences are indicated by letters; p < 0.05).

FIGURE 3. The relative expression of TTR mRNA in HGEN cells following treatment with T3 (0.03, 0.3, 3, and 30 nM) and DE-71 (0.01, 0.1, and 3 µM). mRNA fold changes were calculated based on the DMSO control and data were corrected by the control gene, β-Actin. Error bars reperesent SEM and a one-way ANOVA was used to determine significant differences (n ) 3; * p < 0.05, ** p < 0.01).

FIGURE 2. The effect of T3 exposure (0.03, 0.3, 3, and 30 nM) on TR r (A) and β (B) mRNA expression in HGEN cells. Results were normalized to the internal β-Actin control gene and presented as mRNA fold change compared to the DMSO control. Standard error bars were calculated based on the mean of three replicate pools/treatment. Statistically significant differences compared to the DMSO control were determined by a one-way ANOVA followed by Bonferroni’s t test and are indicated by * (p < 0.05). olfactory areas, and hypothalamus and increases between stages 34 and 44 in chick neurons to become the second most abundant nicotinic receptor transcript per neuron (34). In this study, HGEN cells were exposed to PBDEs at stage 37 and thus, we hypothesized that nAChR R-7 would be a suitable gene target especially given the body of work that suggests

hippocampal cholinergic receptors are vulnerable to PBDE exposure (20, 21, 35). Recently, Bull et al. (22) found no significant effects of environmentally relevant concentrations of DE-71 on key cholinergic parameters in the cerebral cortex of ranch mink. These results are consistent with those observed for HGEN cells but do not corroborate those of the available mammalian studies (20, 21). The single oral doses of 16 mg BDE-99/kg and 9 mg BDE-153/kg body weight that caused effects in the rodent studies were much higher than those used in the mink study (0.1-2.5 mg DE-71/kg feed). In addition, both our study and that by Bull et al. (22) assessed cholinergic end points in the cerebral cortex, not the hippocampus, and thus, tissue-specific differences in responsiveness must be taken into account. In summary, down-regulation of TTR mRNA in HGEN cells following treatment with both T3 and DE-71 implies a shared mechanism of action and warrants further investigation. The receptors (TRs and nAChR R-7) were not effective molecular biomarkers of PBDE exposure in the avian in vitro system. This may be a result of stringent regulatory control (positive/negative feedback mechanisms) or lack of direct VOL. 42, NO. 20, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

7719

(3)

(4)

(5)

(6)

FIGURE 4. The effect of DE-71 exposure (0.01, 0.1, and 3 µM) on TR r (solid) and β (hatched) mRNA as detected by real-time RT-PCR. Data were normalized to the internal control gene, β-Actin, and fold changes were calculated based on the DMSO control. Bars represent mean ( SEM and changes were considered statistically significant if p < 0.05.

(7)

(8)

(9)

(10)

(11) (12)

FIGURE 5. The relative expression of nAChR r-7 mRNA in HGEN cells exposed to DE-71 (0.01, 0.1, and 3 µM). Data were normalized to the internal control gene, β-Actin, and fold changes were calculated based on the DMSO control. Bars represent mean ( SEM calculated based on three replicate pools/treatment group and data were considered significant if p < 0.05. binding to the receptors by parent PBDE compounds. The in vitro neuronal cell culture technique was effective for assessing mechanisms of action of PBDEs and was a relevant model system as PBDEs were detected in whole brain samples and neuronal cells of herring gulls.

(13)

(14)

(15) (16)

(17)

Acknowledgments We thank J. Head for her kind contribution of the herring gull β-Actin probe and primer set and S. Jones for technical assistance. Adult herring gull brain samples were collected and kindly provided by G. Fox and PBDE residue analysis of these samples was performed by J. Moisey. We thank M. Mulvihill for the preparation and analysis of PBDEs in embryonic cortex samples and neuronal cells. This work was supported by funding from Environment Canada’s Strategic Technology Applications of Genomics for the Environment (STAGE) and Wildlife Toxicology and Disease Program.

(18)

(19)

(20)

Literature Cited (1) Major Brominated Flame Retardants Volume Estimates; Bromine Science and Environmental Forum: Brussels, 2003; available at www.bsef.com. (2) Gauthier, L. T.; Hebert, C. E.; Weseloh, D. V.; Letcher, R. J. Current-use flame retardants in the eggs of herring gulls (Larus 7720

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 20, 2008

(21)

argentatus) from the Laurentian Great Lakes. Environ. Sci. Technol. 2007, 41, 4561–4567. Elliott, J. E.; Wilson, L. K.; Wakeford, B. Polybrominated diphenyl ether trends in eggs of marine and freshwater birds from British Columbia, Canada, 1979-2002. Environ. Sci. Technol. 2005, 39, 5584–5591. Herzke, D.; Gabrielsen, G. W.; Evenset, A.; Burkow, I. C. Polychlorinated camphenes (toxaphenes), polybrominated diphenylethers and other halogenated organic pollutants in glaucous gull (Larus hyperboreus) from Svalbard and Bjornoya (Bear Island). Environ. Pollut. 2003, 121, 293–300. Watanabe, K.; Senthilkumar, K.; Masunaga, S.; Takasuga, T.; Iseki, N.; Morita, M. Brominated organic contaminants in the liver and egg of the common cormorants (Phalacrocorax carbo) from Japan. Environ. Sci. Technol. 2004, 38, 4071–4077. Naert, C.; Van Peteghem, C.; Kupper, J.; Jenni, L.; Naegeli, H. Distribution of polychlorinated biphenyls and polybrominated diphenyl ethers in birds of prey from Switzerland. Chemosphere 2007, 68, 977–987. Fernie, K. J.; Shutt, J. L.; Mayne, G.; Hoffman, D.; Letcher, R. J.; Drouillard, K. G.; Ritchie, I. J. Exposure to polybrominated diphenyl ethers (PBDEs): changes in thyroid, vitamin A, glutathione homeostasis, and oxidative stress in American kestrels (Falco sparverius). Toxicol. Sci. 2005, 88, 375–383. Fernie, K. J.; Mayne, G.; Shutt, J. L.; Pekarik, C.; Grasman, K. A.; Letcher, R. J.; Drouillard, K. Evidence of immunomodulation in nestling American kestrels (Falco sparverius) exposed to environmentally relevant PBDEs. Environ. Pollut. 2005, 138, 485– 493. Murvoll, K. M.; Jenssen, B. M.; Skaare, J. U. Effects of pentabrominated diphenyl ether (PBDE-99) on vitamin status in domestic duck (Anas platyrhynchos) hatchlings. J. Toxicol. Environ. Health, Part A 2005, 68, 515–533. Crump, D.; Jagla, M. M.; Chiu, S.; Kennedy, S. W. Detection of PBDE effects on mRNA expression in chicken (Gallus domesticus) neuronal cells using real-time RT-PCR and a new differential display method. Toxicol. in Vitro 2008, 22, 1337– 1343. McNabb, A. Thyroids. In Sturkie’s Avian Physiology; Whittow, G. C., Ed.; Academic Press: Honolulu, 2000. Fowles, J. R.; Fairbrother, A.; Baecher-Steppan, L.; Kerkvliet, N. I. Immunologic and endocrine effects of the flame-retardant pentabromodiphenyl ether (DE-71) in C57BL/6J mice. Toxicology 1994, 86, 49–61. Hallgren, S.; Sinjari, T.; Hakansson, H.; Darnerud, P. O. Effects of polybrominated diphenyl ethers (PBDEs) and polychlorinated biphenyls (PCBs) on thyroid hormone and vitamin A levels in rats and mice. Arch. Toxicol. 2001, 75, 200–208. Zhou, T.; Ross, D. G.; DeVito, M. J.; Crofton, K. M. Effects of short-term in vivo exposure to polybrominated diphenyl ethers on thyroid hormones and hepatic enzyme activities in weanling rats. Toxicol. Sci. 2001, 61, 76–82. Zhou, T.; Taylor, M. M.; DeVito, M. J.; Crofton, K. M. Developmental exposure to brominated diphenyl ethers results in thyroid hormone disruption. Toxicol. Sci. 2002, 66, 105–116. Martin, P.; Mayne, G.; Bursian, S.; Palace, V.; Tomy, G. Altered Thyroid Status and Vitamin A Levels in Mink (Mustela Vison) Exposed to a Commercial PBDE Mixture. North American SETAC Proceedings: Pensacola, FL, 2004. Meerts, I. A.; van Zanden, J. J.; Luijks, E. A.; Leeuwen-Bol, I.; Marsh, G.; Jakobsson, E.; Bergman, A.; Brouwer, A. Potent competitive interactions of some brominated flame retardants and related compounds with human transthyretin in vitro. Toxicol. Sci. 2000, 56, 95–104. Hamers, T.; Kamstra, J. H.; Sonneveld, E.; Murk, A. J.; Kester, M. H.; Andersson, P. L.; Legler, J.; Brouwer, A. In vitro profiling of the endocrine-disrupting potency of brominated flame retardants. Toxicol. Sci. 2006, 92, 157–173. Marsh, G.; Bergman, A.; Bladh, L.-G.; Gillner, M.; Jakobsson, E. Synthesis of p-Hydroxybromodiphenyl Ethers and binding to the thyroid receptor. Organohalogen Compd. 1998, 37, 305– 308. Viberg, H.; Fredriksson, A.; Eriksson, P. Neonatal exposure to polybrominated diphenyl ether (PBDE 153) disrupts spontaneous behaviour, impairs learning and memory, and decreases hippocampal cholinergic receptors in adult mice. Toxicol. Appl. Pharmacol. 2003, 192, 95–106. Viberg, H.; Fredriksson, A.; Eriksson, P. Deranged spontaneous behaviour and decrease in cholinergic muscarinic receptors in hippocampus in the adult rat, after neonatal exposure to the brominated flame-retardant, 2,2′,4,4′,5-pentabromodiphenyl

(22)

(23)

(24) (25) (26)

(27)

(28)

ether (PBDE 99). Environ. Toxicol. Pharmacol. 2005, 20, 283– 288. Bull, K.; Basu, N.; Zhang, S.; Martin, J. W.; Bursian, S.; Martin, P.; Chan, H. M. Dietary and in utero exposure to a pentabrominated diphenyl ether mixture (DE-71) did not affect cholinergic parameters in the cerebral cortex of ranch mink (Mustela vison). Toxicol. Sci. 2007, 96, 115–122. Fox, G. A.; Trudeau, S. F.; Won, H.; Grasman, K. A. Monitoring the elimination of persistent toxic substances from the Great Lakes; Chemical and physiological evidence from adult herring gulls. Environ. Monit. Assess. 1998, 53, 147–168. Hamilton, V.; Hamburger, H. L. A series of normal stages in the development of the chick embryo. J. Morphol. 1951, 88, 49–92. Mun, A. M.; Kosin, I. L. Developmental stages of the broad breasted bronze turkey embryo. Biol. Bull. 1960, 119, 90–97. Ortiz-Caro, J.; Montiel, F.; Yusta, B.; Pascual, A.; Aranda, A. Downregulation of thyroid hormone nuclear receptor levels by L-triiodothyronine in cultured glial C6 cells. Mol. Cell. Endocrinol. 1987, 49, 255–263. Mundy, W. R.; Freudenrich, T. M.; Crofton, K. M.; DeVito, M. J. Accumulation of PBDE-47 in primary cultures of rat neocortical cells. Toxicol. Sci. 2004, 82, 164–169. Haidar, M. A.; Dube, S.; Sarkar, P. K. Thyroid hormone receptors of developing chick brain are predominantly in the neurons. Biochem. Biophys. Res. Commun. 1983, 112, 221–227.

(29) Schriks, M.; Vrabie, C. M.; Gutleb, A. C.; Faassen, E. J.; Rietjens, I. M.; Murk, A. J. T-screen to quantify functional potentiating, antagonistic and thyroid hormone-like activities of poly halogenated aromatic hydrocarbons (PHAHs). Toxicol. in Vitro 2006, 20, 490–498. (30) McNabb, F. M. The hypothalamic-pituitary-thyroid (HPT) axis in birds and its role in bird development and reproduction. Crit. Rev. Toxicol. 2007, 37, 163–193. (31) Southwell, B. R.; Duan, W.; Tu, G. F.; Schreiber, G. Ontogenesis of transthyretin gene expression in chicken choroid plexus and liver. Comp. Biochem. Physiol. B 1991, 100, 329–338. (32) Palha, J. A.; Hays, M. T.; Morreale, d. E.; Episkopou, V.; Gottesman, M. E.; Saraiva, M. J. Transthyretin is not essential for thyroxine to reach the brain and other tissues in transthyretin-null mice. Am. J. Physiol. 1997, 272, E485–E493. (33) Palha, J. A.; Episkopou, V.; Maeda, S.; Shimada, K.; Gottesman, M. E.; Saraiva, M. J. Thyroid hormone metabolism in a transthyretin-null mouse strain. J. Biol. Chem. 1994, 269, 33135–33139. (34) Boyd, R. T. The molecular biology of neuronal nicotinic acetylcholine receptors. Crit. Rev. Toxicol. 1997, 27, 299–318. (35) Viberg, H.; Fredriksson, A.; Eriksson, P. Neonatal exposure to the brominated flame retardant 2,2′,4,4′,5-Pentabromodiphenyl ether causes altered susceptibility in the cholinergic transmitter system in the adult mouse. Toxicol. Sci. 2002, 67, 104–107.

ES801145J

VOL. 42, NO. 20, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

7721