Anal. Chem. 2007, 79, 9484-9493
Detection of Six Single-Nucleotide Polymorphisms Associated with Rheumatoid Arthritis by a Loop-Mediated Isothermal Amplification Method and an Electrochemical DNA Chip Naoko Nakamura,*,† Keiko Ito,† Masayoshi Takahashi,† Koji Hashimoto,† Manabu Kawamoto,‡ Mariko Yamanaka,‡ Atsuo Taniguchi,‡ Naoyuki Kamatani,‡ and Nobuhiro Gemma†
Corporate Research and Development Center, Toshiba Corporation, 1, Komukai-Toshiba-cho, Saiwai-ku, Kawasaki, Kanagawa Prefecture 212-8582, Japan, and Institute of Rheumatology, Tokyo Women’s Medical University, 10-22 Kawada-cho, Shinjuku-ku, Tokyo 162-0054, Japan
An electrochemical DNA chip using an electrochemically active intercalator and DNA probe immobilized on a gold electrode has been developed for genetic analysis. In this study, the six polymorphisms associated with rheumatoid arthritis (RA), N-acetyltransferase2 (NAT2) gene polymorphisms T341C, G590A, and G857A, methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms C677T and A1298C, and serum amyloid A1 (SAA1) gene promoter polymorphism C-13T were simultaneously detected by the electrochemical DNA chip and the loopmediated isothermal amplification (LAMP) method, which is a novel technique for DNA amplification. Human genomic DNAs were extracted from blood, and the targets containing the six polymorphisms were amplified by the LAMP method. A sample containing the six LAMP products was reacted with the electrochemical DNA chip using a DNA detection system that controls hybridization reaction, washing, electrochemical detection, and data analysis automatically. A total of 31 samples were genotyped by this method, and the results were completely consistent with those determined by the polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP) analysis or the PCR direct sequence analysis. The time required for this method was only 2 h, and operations were very simple. Therefore, this method is expected to contribute to personalized medicine based on genotype. Among several types of genetic variation, single-nucleotide polymorphisms (SNPs) are the most important and basic form of variation in the genome. They are responsible for individual differences in disease susceptibility and drug response. If an individual’s genomic information is identified in advance of drug treatment, safe and effective treatment, known as “personalized medicine”, is achieved. Numerous approaches to SNP genotyping have been developed such as polymerase chain reaction-restriction fragment * Corresponding author. E-mail:
[email protected]. † Toshiba Corporation. ‡ Tokyo Women’s Medical University.
9484 Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
length polymorphism (PCR-RFLP) analysis, the TaqMan PCR method,1 the Invader method,2 single-strand conformational polymorphisms analysis,3 allele-specific primer PCR analysis,4 and allele-specific oligonucleotide hybridization analysis.5 Among them, DNA chip-based techniques are promising because they enable the simultaneous genotyping of many SNPs. A DNA chip is a device in which DNA probes are located with high density on glass or silicon. In regard to DNA chip-based techniques, fluorescence-based detection methods such as those applied by Affimetrix Inc. are the most widely used.6 However, these methods need complicated fluorochrome labeling and expensive fluorescence analysis equipment. Therefore, they are suitable for use in research. On the other hand, several electrochemical-based detection methods have been reported.7,8 Among these, we have developed a technique using an electrochemically active intercalator, Hoechst 33258, and DNA probe immobilized on a gold electrode.9-12 This method is very simple and inexpensive, because it requires no labeling step and large and expensive signal transduction equipment is unnecessary. Therefore, this method is suitable for genetic diagnostics. (1) Livak, K. J. Genet. Anal. 1999, 14, 143-149. (2) Lyamichev, V.; Mast, A. L.; Hall, J. G.; Prudent, J. R.; Kaiser, M. W.; Takova, T.; Kwiatkowski, R. W.; Sander, T. J.; de Arruda, M.; Arco, D. A.; Neri, B. P.; Brow, M. A. Nat. Biotechnol. 1999, 17, 292-296. (3) Orita, M.; Iwahana, H.; Kanazawa, H.; Hayashi, K.; Sekiya, T. Proc. Natl. Acad. Sci. U.S.A. 1989, 86, 2766-2770. (4) Newton, C. R.; Heptinstall, L. E.; Summers, C.; Super, M.; Schwarz, M.; Anwar, R.; Graham, A.; Smith, J. C.; Markham, A. F. Lancet 1989, 2, 14811483. (5) Saiki, R. K.; Walsh, P. S.; Levenson, C. H.; Erlich, H. A. Proc. Natl. Acad. Sci. U.S.A. 1989, 86, 6230-6234. (6) Pease, A. C.; Solas, D.; Sullivan, E. J.; Cronin, M. T.; Holmes, C. P.; Fodor, S. P. Proc. Natl. Acad. Sci. U.S.A. 1994, 91, 5022-5026. (7) Drummond, T. G.; Hill, M. G.; Barton, J. K. Nat. Biotechnol. 2003, 21, 11921199. (8) Moeller, R.; Fritzsche, W. IEE Proc. Nanobiotechnol. 2005, 152, 47-51. (9) Hashimoto, K.; Ito, K.; Ishimori, Y. Anal. Chem. 1994, 66, 3830-3833. (10) Hashimoto, K.; Ishimori, Y. Lab Chip 2001, 1, 61-63. (11) Takahashi, M.; Okada, J.; Ito, K.; Hashimoto, M.; Hashimoto, K.; Yoshida, Y.; Furuichi, Y.; Ohta, Y.; Mishiro, S.; Gemma, N. Analyst 2005, 130, 687693. (12) Nakamura, T.; Sakaeda, T.; Takahashi, M.; Hashimoto, K.; Gemma, N.; Moriya, Y.; Komoto, C.; Nishiguchi, K.; Okamura, N.; Okumura, K. Drug Metab. Pharmacokinet. 2005, 20, 219-225. 10.1021/ac0715468 CCC: $37.00
© 2007 American Chemical Society Published on Web 11/07/2007
Table 1. PCR Primer for PCR-RFLP Analysis and PCR Direct Sequence Analysis 1. PCR-RFLP Analysis sequence (5′ to 3) gene NAT2 MTHFR SAA1
SNP
F
G590A G857A C677T C-13T
R
AGATGTGGCAGCCTCTAGAA
ATTAGTGAGTTGGGTGATAC
CTTGAAGGAGAAGGTGTCTGC AGCCACTGTGCTGGACCTAGTCTG
TCTGGGAAGAACTCAGCGAAC GTGCTGTAGCTGAGCTGCGG
2. PCR Direct Sequence Analysis sequence (5′ to 3) gene
SNP
F
R
NAT2 sequence primer MTHFR sequence primer
T341C
CTATTTTTGATCACATTGTAAGAAGAA CTATTTTTGATCACATTGTAAGAAGAA TGCTGAAGATGTGGGGGGAG ACAGGATGGGGAAGTCACAG
GCTCTCTCCTGATTTGGT
A1298C
Amplification of a specific DNA sequence is necessary for accurate SNP genotyping, because the DNA probe is too short to detect a specific DNA. For example, since NAT1 and NAT2, or SAA1 and SAA2 show high sequence homologies, it is essential to design the primers in the specific regions and to obtain the specific amplification product. Several nucleic acid amplification methods, including the PCR method, have been developed so far.13-15 Among them, the loop-mediated isothermal amplification (LAMP) method13 is very promising because the method can amplify DNA with high specificity and rapidity under isothermal conditions. Four specifically designed primers and a DNA polymerase with strand displacement activity are used for the amplification reaction. Recently, many reports that have detected bacteria or virus by the LAMP method have been published.16,17 It has become clear that there is an association between NAT2 variants, NAT2*4, NAT2*5, NAT2*6, and NAT2*7, and the adverse effects of sulfasalazine (SSZ).18 SSZ is widely used as a second-line drug for the treatment of rheumatoid arthritis (RA). In the case of the slow acetylators without NAT2*4 genotype, adverse effects occurred more frequently than in the case of the fast acetylators with at lease one NAT2*4 genotype. Similarly, several studies of the association between the MTHFR polymorphisms, C677T and A1298C, and the efficacy or adverse effect of methotrexate (MTX) have been reported. MTX is one of the most widely used drugs for the treatment of RA. Urano et al.19 showed that 677T allele was correlated with adverse effect of MTX; on the other hand, 1298C allele was correlated with efficacy of MTX.
(13) Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Nucleic Acids Res. 2000, 28, E63. (14) Compton, J. Nature 1991, 350, 91-92. (15) Walker, G. T.; Fraiser, M. S.; Schram, J. L.; Little, M. C.; Nadeau, J. G.; Malinowski, D. P. Nucleic Acids Res. 1992, 11, 1691-1696. (16) Iwamoto, T.; Sonobe, T.; Hayashi, K. J. Clin. Microbiol. 2003, 41, 26162622. (17) Ihira, M.; Yoshikawa, T.; Enomoto, Y.; Akimoto, S.; Ohashi, M.; Suga, S.; Nishimura, N.; Ozaki, T.; Nishiyama, Y.; Notomi, T.; Ohta, Y.; Asano, Y. J. Clin. Microbiol. 2004, 42, 140-145. (18) Tanaka, E.; Taniguchi, A.; Urano, W.; Nakajima, H.; Matsuda, Y.; Kitamura, Y.; Saito, M.; Yamanaka, H.; Saito, T.; Kamatani, N. J. Rheumatol. 2002, 29, 2492-2499. (19) Urano, W.; Taniguchi, A.; Yamanaka, H.; Tanaka, E.; Nakajima, H.; Matsuda, Y.; Akama, H.; Kitamura, Y.; Kamatani, N. Pharmacogenetics 2002, 12, 183190.
CACGATGGGGTCGGAGGA
Moreover, Moriguchi et al.20 showed that in the SAA1 promoter region polymorphism, C-13T was associated with susceptibility to amyloidosis. Amyloidosis is a fatal complication of common chronic inflammatory diseases such as RA. Since there is no established treatment method for amyloidosis, early detection and early medical treatment are important. If the susceptibility to amyloidosis can be predicted by genetic analysis in advance of medical treatment, a better clinical course can be selected. In this study, the six SNPs associated with RA, NAT2 T341C G590A G857A, MTHFR C677T A1298C, and SAA1 C-13T, were simultaneously detected by a novel combination technology of the LAMP method and the electrochemical-based DNA chip. EXPERIMENTAL SECTION Human Genomic DNA. Human genomic DNAs were purchased from Coriell Cell Repositories (Camden, NJ). The DNAs were genotyped by the PCR-RFLP or the PCR direct sequence analysis and were used for determination of genotyping condition by the DNA chip. Whole-blood samples were obtained from 31 RA patients with their informed consent, and genomic DNAs were purified using QIAamp DNA blood kit (Qiagen, Hilden, Germany). In order to confirm the accuracy of the DNA chip, 31 genomic DNAs were also genotyped by the PCR-RFLP or the PCR direct sequence analysis. PCR-RFLP Analysis. Genotypes of NAT2 G590A, G857A, MTHFR C677T, and SAA1 C-13T were determined by the PCRRFLP analysis. PCR primers are shown in Table 1, section 1. The NAT2 G590A and G857A were designed to be located on the same PCR fragment. The PCR for NAT2 G590A and G857A was conducted in a reaction mixture (50 µL) containing 1× Pyrobest buffer II, 0.4 mM dNTPs, 1.25 units of Pyrobest DNA polymerase (Takara Bio Inc., Shiga, Japan), 0.4 µM of each primer, and 30 ng of human genomic DNA. The amplification conditions were 95 °C for 5 min, followed by 40 cycles consisting of 98 °C for 10 s, 59 °C for 30 s, 72 °C for 30 s, then 72 °C for 1 min, followed by 4 °C. The reaction mixtures for MTHFR C677T and SAA1 C-13T were the same as for NAT2 G590A and G857A except for the use of 0.3 mM dNTPs and 0.6 µM of each primer for MTHFR C677T, (20) Moriguchi, M.; Terai, C.; Kaneko, H.; Koseki, Y.; Kajiyama, H.; Uesato, M.; Inada, S.; Kamatani, N. Arthritis Rheum. 2001, 44, 1266-1272.
Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
9485
Table 2. LAMP Primer and Amplification Condition for the Elemental Experimenta
primer
sequence (5′ to 3′)
primer concentration pmol
SNP position
F3 FIP B3 BIP
ACAGAAGAGAGAGGAATCTGGT TGTTTCTTCTTTGGCAGGAGATGAGAA-GGACCAAATCAGGAGAGAGCA GATGAAGCCCACCAAACAGTA ATGAATACATACAGACGTCTCC-CTGGGGTCTGCAAGGAAC
10 80 10 80
F1-B1c (F1c-B1)
F3 FIP B3 BIP
ACAAACAAAGAATTTCTTAA CGTCTGCAGGTATGTATTCATAGACTC-AAAAAATATACTTATTTACGCTTGAACC CGACCAGATCTGTATTGTCTT ATAACCACATCATTTTGTTCCTTGCA-TGAATTTTCTATAGGTGAGGATGA
5 40 5 40
F2-F1 (F2c-F1c)
F3 FIP B3 BIP
CTCAGGTGCCTTGCATTT GTTTGTAATATACTGCTCTCTCCTG-GCTTGACAGAAGAGAGAGGAATC AATGAAGATGTTGGAGACGT GAAACACCAAAAAATATACTTATTTACGC-CAGGTATGTATTCATAGACTCAAAATCT
10 80 80 10
B2c-B1c (B2-B1)
a Three types of LAMP primer sets were designed to detect the NAT2 G590A. For all reactions, 8 units of Bst DNA polymerase were added and amplification was carried out at 63 °C for 2 hr.
and 0.2 mM dNTPs for SAA1 C-13T. The amplification conditions for MTHFR C677T and SAA1 C-13T were the same: 95 °C for 5 min, followed by 40 cycles consisting of 98 °C for 10 s, 65 °C for 30 s, then 72 °C for 1 min, followed by 4 °C. The PCR reaction was carried out using GeneAmp PCR System model 9700 (Applied Biosystems, Foster City, CA). The restriction enzymes used for RFLP were TaqI (NAT2 G590A and MTHFR C677T), BamHI (NAT2 G857A), and BsrI (SAA1 C-13T). PCR Direct Sequence Analysis. Genotypes of NAT2 T341C and MTHFR A1298C were determined by the PCR direct sequence analysis because there is no restriction enzyme to perform the PCR-RFLP analysis. PCR primers are shown in Table 1, section 2. The reaction mixtures for NAT2 T341C and MTHFR A1298C were the same as for NAT2 G590A and G857A (see PCR-RFLP Analysis) except for the use of 0.35 mM dNTPs and 0.6 µM of each primer for NAT2 T341C and 0.2 mM dNTPs and 1.6 µM of each primer for MTHFR A1298C. The amplification conditions for NAT2 T341C were 95 °C for 5 min, followed by 40 cycles consisting of 98 °C for 10 s, 53 °C for 30 s, 72 °C for 30 s, then 72 °C for 1 min, followed by 4 °C. The amplification conditions for MTHFR A1298C were the same as for MTHFR C677T and SAA1 C-13T (see PCR-RFLP Analysis). The direct sequence analysis was consigned to Takara Bio Inc. Target Amplification by LAMP Method. LAMP primers used in this study are shown in Tables 2 and 3. To amplify one target, four or five primers (F3, B3, FIP, BIP, or loopF or loopB) were used. A 25 µL reaction mixture containing the primers, 1.4 mM each dNTP, 0.8 M betaine, 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 8 mM MgSO4, 0.1% Tween 20, 8 or 16 units of Bst DNA polymerase (New England Biolabs, Beverly, MA), and about 30 ng of template DNA was incubated at 63 °C for 15, 30, 45, 60, and 120 min and was heated at 80 °C for 2 min to terminate the reaction. The amplified products were analyzed by agarose electrophoresis, and the time required to reach saturation was estimated from the results. The same reaction mixture without a template DNA was used as negative control. The reaction was carried out using GeneAmp PCR System model 9700. Preparation of the DNA Chip. The DNA chip substrates used in this study were prepared as described previously.10 9486
Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
Oligonucleotide probes with a thiol group at the 3′ end were obtained as custom synthesis products from Greiner Japan (Tokyo, Japan) (Table 4). Each working electrode was spotted with 0.1 µL of the probe solution containing the 40 µg/mL oligonucleotide probe and 400 mmol/L sodium chloride by use of a spotter. The DNA chip was covered with a reaction chamber (50 µL, Grace Bio-Labs, Bend, OR) to prevent drying and kept for 1 h at room temperature. Then, the chip was washed with distilled water and stored at -20 °C. Hybridization, Washing, and Electrochemical Detection. A target sample containing the LAMP products and 2× SSC (300 mmol/L sodium chloride, 30 mmol/L sodium citrate) was reacted with the DNA probes on the electrodes. The hybridization reaction was carried out at 35-60 °C for 10 min to 12 h. After the reaction, the chip was washed with 0.2× SSC at 25-50 °C for 1-40 min to remove nonspecific hybridized DNA. Subsequently, the chip was reacted with phosphate buffer (20 mmol/L, pH 7.0) containing 50 µmol/L Hoechst 33258 (Wako Pure Chemicals, Osaka, Japan) and 100 mmol/L sodium chloride at 25 °C for 10 min. Then, the anodic peak current derived from Hoechst 33258 was measured by linear sweep voltammetry (model BAS-100B, Bioanalytical Systems Inc., West Lafayette, IN). The potential was scanned from -100 to 1000 mV at 300 mV/s. Anodic peak current (Ipa) values were measured from the voltammogram of Hoechst 33258. The electrochemical DNA detection method is advantageous for realizing an automated system, because the reaction part and the detection part are unified and simple. Moreover, large and expensive signal transduction equipment is unnecessary. Exploiting these advantages, we have developed a miniature DNA detection system that automatically performs the process after hybridization.21 The system consists of a temperature control part, a reagent sending part, and an electrochemical analyzing part. A target sample containing six LAMP products and 2× SSC was injected into a cassette (50 mm × 30 mm × 10 mm) including the DNA chip with immobilized probe. After setting the cassette in the system, hybridization reaction, washing, electrochemical detection, and data analysis are performed automatically. Specially (21) Nakamura, N.; Ito, K.; Hongo, S.; Hashimoto, K.; Furutsuka, M.; Kubota, R.; Fukuda, T.; Ohno, M.; Azuma, J.; Gemma, N. Rinsho Byori 2007, 55, 216-223.
Table 3. LAMP Primer and Amplification Condition for Genotyping of Six SNPsa detection sequence position
gene
SNP
primer
NAT2
T341C
F3 FIP B3 BIP loopF
GAGGCTATTTTTGATCACATTGTA GAAAACCGATTGTGGTCAGAG-GGTGTCTCCAGGTCAATCAA GGCTGCCACATCTGGGAG CATGGTTCACCTTCTCCTG-AGCTTCCAGACCCAGCAT CCCAGTACAGAAGTTG
10 80 10 80 20
BP
G590A
F3 FIP B3 BIP loopF
CTGGGAAGGATCAGCCTC GTTTGTAATATACTGCTCTCTCCTG-CCTTGCATTTTCTGCTTGAC AAATGAAGATGTTGGAGACG CACCAAAAAATATACTTATTTACGC-CTGCAGGTATGTATTCATAGACTC GTACCAGATTCCTCTCTCTTCT
5 40 5 40 10
BP
G857A
F3 FIP B3 BIP loopF
GTGGGCTTCATCCTCAC AGCACTTCTTCAACCTCTTCCTC-TAAAGACAATACAGATCTGGTCG TGATAATTAGTGAGTTGGGTGAT GGGGAGAAATCTCGTGCCCA-AGGGTTTATTTTGTTCCTTATTC AGTGAGAGTTTTAAACTCGACC
5 40 5 40 10
BP
C677T
F3 FIP B3 BIP loopB
GTTACCCCAAAGGCCACC TCAGCCTCAAAGAAAAGCTG-AGGCTGACCTGAAGCACT TCTGGGAAGAACTCAGCGAA CAGGAGAGCCCATAAGCTCCCT-TCAGCACTCCACCCAGAG CCGCACCGTCCTCGCACAGGC
10 80 10 80 20
FP
A1298C
F3 FIP B3 BIP loopB
GCTGAAGGACTACTACCTCTTCTACC CGGTTTGGTTCTCCCGAGAGG-GCTGAAGATGTGGGGGGA CTTTGCCATGTCCACAGC AGCTGCAGGCCAGGCTG-ATGGAGGGGAGGGCAC CGGGGCTGTGACTTCC
10 80 10 80 20
FP
C-13T
F3 FIP B3 BIP loopF
GTCTCCTGCCCTGACAGC CAGTGGTTTCTTCATCCCG-CAGGCACATCTTGTTCCCTC ACTCCTTGGTGTGCTCCTC GGAAGGCTCAGTATAAATAGCA-GTGCTGTAGCTGAGCTGCGG GTCATTTATCCCAGTTGTGCAACC
10 80 10 80 20
BP
MTHFR
SAA1
sequence (5′ to 3′)
primer concentration pmol
a For MTHFR A1298C, 16 units of Bst DNA polymerase were added, and for the other five SNPs, 8 units of Bst DNA polymerase were added. Amplification was carried out at 63 °C for 1 hr.
designed software for SNP analysis is installed on a computer connected to the system, and SNPs are automatically genotyped using voltammetric results. RESULTS AND DISCUSSION Difference of Hybridization Efficiency by the Position of the Detection Sequence in the LAMP Products. The final LAMP products are mixtures of stem-loop DNAs with various stem lengths. Each molecule has a single-stranded loop at its end. The portions between F2 and F1 (F2-F1), between F2c and F1c (F2c-F1c), between B2c and B1c (B2c-B1c), and between B2 and B1 (B2-B1) will become the single-stranded loops partially. On the other hand, the portions between F1 and B1c (F1-B1c) and between F1c and B1 (F1c-B1) will become entirely the double-stranded stem and not become the single-stranded loops (Figure 1). In this study, the sequence in the LAMP product hybridized with the probe was termed a detection sequence. We examined the difference of the hybridization efficiency between the probe and the detection sequence when the detection sequence was located between F1-B1c (F1c-B1), F2-F1 (F2c-F1c), or B2cB1c (B2-B1). The detection sequence was designed to contain the SNP site. Amplification reaction was performed using each of the LAMP primer sets (Table 2). The hybridization reaction was carried out at 35 °C for 12 h, and the washing was carried out at
25 °C for 1 min. Probes are used in both forward and reverse sequences (Table 4; 590-15G-F, 590-15G-R) that hybridized with reverse and forward strands of the detection sequence, respectively. A negative control probe whose sequence is irrelevant to NAT2 sequence was also prepared. The three types of probes were immobilized by separate electrodes. For each probe, two electrodes were assigned. Figure 2 shows voltammograms of Hoechst 33258 for the three LAMP products. In the case of the LAMP product whose detection sequence was located between F1-B1c (F1c-B1), the Ipa values on the forward probe (590-15G-F) and on the reverse probe (59015G-R) were the same level as those on the control probe (Figure 2A-I). This result indicated that the LAMP product was scarcely hybridized to the probe. On the other hand, as for the LAMP product whose detection sequence was located between F2-F1 (F2c-F1c), the Ipa values on the reverse probe were about 4 times higher than those on the control probe, whereas the Ipa values on the forward probe were almost the same as those on the control probe (Figure 2A-II). Moreover, as for the LAMP product whose detection sequence was designed between B2c-B1c (and B2B1), the Ipa values on the forward probe were about 3.5-4 times higher than those on the control probe, whereas the Ipa values on the reverse probe were almost the same as those on the control probe (Figure 2A-III), clarifying that the LAMP product whose Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
9487
Table 4. Sequences of Probe DNAa gene
SNP
F/R
length (bp)
probeb
sequence (5′ to 3′)c
NAT2
G590A
F R F F F F F F F F F F F R R R R F F
14 15 15 17 21 26 19 21 23 27 23 26 18 17 18 20 27 25 16 17
Control 590-15G-F 590-15G-R 590-17G 590-21G 590-26G* 590-19A 590-21A 590-23A 590-27A* 857-23G* 857-26A* 341-18T* 341-17C* 677-18C* 677-20T* 1298-27A* 1298-25C* -13-16C* -13-17T*
GTGCTGCAGGTGCG AACCTCGAACAATTG CAATTGTTCGAGGTT GAACCTCGAACAATTGA TTGAACCTCGAACAATTGAAG TTGAACCTCGAACAATTGAAGATTTT GAACCTCAAACAATTGAAG GAACCTCAAACAATTGAAGAT TTGAACCTCAAAACAATTGAAGAT TTGAACCTCAAACAATTGAAGATTTTG CCTGGTGATGGATCCCTTACTAT ACCTGGTGATGAATCCCTTACTATTT AGGTGACCATTGACGGCA AGGTGACCACTGACGGC GATGAAATCGGCTCCCGC TGATGAAATCGACTCCCGCA CTTCAAAGACACTTTCTTCACTGGTCA TTCAAAGACACTTGCTTCACTGGTC CCACCGCTCCCTGGCA CCACCGTTCCCTGGCAG
G857A T341C MTHFR
C677T A1298C
SAA1
C-13T
a Oligonucleotide probes were modified with a thiol group at their 3′ ends. b The asterisk indicates the probe finally selected. c The bold, underlined bases indicate the SNP sites.
Figure 1. LAMP primer design, and single-stranded or double-stranded portions in LAMP products. In the LAMP method, six primer regions are set and four primers are used for amplification. F3, F2, and F1 regions are placed in this order from the 5′ terminal side of a forward strand of a target nucleic acid, and the B3c, B2c, and B1c regions are placed in this order from the 3′ terminal side of the forward strand of a target nucleic acid. The complimentary regions of F3, F2, F1 B3c, B2c, and B1c in the reverse strand are called the F3c, F2c, F1c B3, B2, and B1 regions, respectively. Primers constituting the four basic primers are FIP inner primer, BIP inner primer, F3 outer primer, and B3 outer primer. In addition, the amplification period can be shortened by optionally using a primer called a loop primer (ref 29). In such a case, loop primer F (loopF) anneals the portion between F2 and F1 and loop primer B (loopB) anneals the portion between B2 and B1. These loopF and loopB can be used alone or in combination.
detection sequence was designed between F2-F1 (and F2c-F1c) and the LAMP product whose detection sequence was designed between B2c-B1c (and B2-B1) show opposite detection patterns. Figure 2B shows the increased current (∆I) values in the case that the Ipa values on the forward or reverse probe were subtracted from those on the control probe. The ∆I values exactly indicate the signals corresponding to the hybridization. Difference of Hybridization Efficiency by a Direction of the DNA Probe. As shown in Figure 3I, four detection sequences between F2-F1, F2c-F1c, B2-B1c, and B2-B1 are defined as FP, FPc, BPc, and BP, respectively. Then, four types of stemloops shown in Figure 3II will exist in LAMP products. As for the length of the loop, 40-60 bp is the best from the viewpoint of amplification efficiency. The Tm values of F2 and B2 sequences were set between 60 and 65 °C, that is, they become about 1530 bp in length. When the four types of stem-loops are hybridized to probes whose 3′ ends are fixed to the DNA chip substrate, in the cases of type a and type d, the double-stranded portion in the 9488
Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
stem-loop turns to the substrate and a steric hindrance between LAMP product and the substrate is caused. On the other hand, for type b and type c, the double-stranded portion in the stemloop turns contrary to the substrate, and so the steric hindrance is not caused. Therefore, it is suggested that, in order to detect the LAMP product efficiently by using the probe whose 3′ end is fixed to the DNA chip substrate, the FPc or BPc should be employed as the probe sequences and the FP or BP should be employed as the detection sequences. The theory mentioned above and the experimental results match exactly. Moreover, for another LAMP product, it was confirmed that detection patterns are opposite in the case that probes with fixed 5′ ends were used (data not shown). For the other five SNPs, the probe sequences and the detection sequences were designed to be type b or type c. Among the nucleic acid amplification methods, the PCR method is most generally used. However, since the PCR products are double-stranded, the complementary strand works as a
Figure 2. Voltammograms of Hoechst 33258 (A) and ∆I values (B) for the three types of LAMP products. (A) Voltammograms of Hoechst 33258 for the LAMP products whose detection sequence is located between F1-B1c (I), F2-F1 (II), and B2c-B1c (III). Voltammetry was carried out by linear sweep voltammetry from -100 to 1000 mV at 300 mV/s. (a), (d), and (g) are voltammograms on the control probe. (b), (e), and (h) are voltammograms on the 590-15G-F probe. (c), (f), and (i) are voltammograms on the 590-15G-R probe. (B) ∆I values for LAMP products whose detection sequence is located between F1-B1c (I), F2-F1 (II), and B2c-B1c (III). Electrode nos. 1 and 2: ∆I values on the control probe. Electrode nos. 3 and 4: ∆I values on the 590-15G- F probe. Electrode nos. 5 and 6: ∆I values on the 590-15G-R probe.
competitor of the probe, reducing the hybridization efficiency. To solve this problem, digesting or separating complementary strands or fragmenting the PCR products has been employed.11,12,22-24 However, these methods are complex, costly, and time-consuming. On the other hand, in LAMP products, the single-stranded DNAs were contained and can be fully utilized for detection. Because the amplified LAMP products can be hybridized to probes directly, this method is very simple, cost efficient, and fast. Moreover, the LAMP method is excellent in that a large amount of amplification product is obtained in only 15-60 min. Optimization of Hybridization and Washing Conditions for the DNA Chip. LAMP primer sequences and amplification conditions for the genotyping of the six SNPs are shown in Table 3. The LAMP primers for the G590A genotyping were improved to efficiently amplify in a short period. To avoid the overlapping of the loop primer region and the detection sequence region, the loop primer was designed in a loop different from the loop (22) Chizhikov, V.; Wagner, M.; Ivshina, A.; Hoshino, Y.; Kapikian, A. Z.; Chumakov, K. J. Clin. Microbiol. 2002, 55, 2398-2407. (23) Cronin, M. T.; Fucini, R. V.; Kim, S. M.; Masino, R. S.; Wespi, R. M.; Miyada, C. G. Hum. Mutat. 1996, 7, 244-255. (24) Anderson, R. C.; Su, X.; Bogdan, G. J.; Fenton, J. Nucleic Acids Res. 2000, 15, E60.
containing the target sequence region. That is, when the detection sequence was FP, the loop primer was used in loopB, and when the detection sequence was BP, the loop primer was used in loopF. Saturation times of six amplification products were between 15 and 45 min, and so the amplification time was set to be 1 h to have a reserve. Prior to the examination with the automated system, the optimum conditions of both hybridization and washing were estimated by manual operation. First, the optimum hybridization temperature was determined. The LAMP product for G590A genotyping was used, and a genotype of the genomic DNA used here was a heterozygous type (590G/A). Three types of probes with different lengths for wildtype detection and four types of probes with different lengths for mutant-type detection were prepared (Table 4). The hybridization was carried out at 35, 45, 50, 55, and 60 °C for 40 min, and washing was carried out at 25 °C for 1 min. As a result, it was indicated that the ∆I values increased in accordance with the increase in the temperature. The results for 55 and 60 °C were almost equal (Figure 4I). The same experiments were performed on the LAMP products for NAT2 T341C and G857A, and almost similar results were obtained (data not shown). Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
9489
Figure 3. (I) Position of the detection sequences FP, FPc, BPc, and BP. (II) Four types of stem-loops in the LAMP products.
Regarding the reason why the hybridization efficiency increases dramatically when the hybridization temperature is raised, it is speculated that the secondary structure of single-stranded portion is broken and the probe is easily hybridized with the single-stranded portion. Second, the relation between the hybridization time and the ∆I value was examined. The temperature of 55 °C was adopted. Consequently, the ∆I values were high enough even for 10 min, though the ∆I values were increased gradually as time was lengthened (Figure 4II). Next, the optimum washing temperature was determined. Genotypes of the genomic DNAs used here were 590G/G, 590A/ A, and 590G/A. The hybridization was carried out at 55 °C for 40 min, and washing was carried out at 40, 45, and 50 °C for 40 min. As a result, the ∆I values on all probes for which the washing was carried out at 40 °C for 40 min were almost the same as those for which the washing was carried out at 25 °C for 1 min (data not shown), indicating that the LAMP products were scarcely removed from the probes at 40 °C. On the other hand, the ∆I values on all probes were close to zero at 50 °C, indicating that most of the LAMP products were removed from the probes (Figure 4III). At 45 °C, the ∆I values on 590-21G and 590-26G probes for target 590G/G and the ∆I value on 590-27A probe for target 590A/A were extremely high. And the ∆I values on 59021G and 590-26G probes for target 590A/A and the ∆I value on 590-27A probe for target 590G/G were close to zero, that is, 9490
Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
nonspecifically hybridized target DNAs were almost entirely removed. Moreover, the ∆I values on 590-21G, 590-26G, and 59027A probes for target 590G/A were also high. These results indicated that the optimum washing temperature was 45 °C and the optimum probes were 590-21G or 590-26G and 590-27A. The result is appropriate, namely, that the longer the probe is, the greater is the hybridization efficiency. However, the longer the probe is, the more difficult it is to detect the single-mismatch target. It is necessary to set a strict condition to detect the singlemismatch target, and selecting the probe with appropriate length is important. Finally, to detect the six SNPs on the same DNA chip substrate simultaneously, the optimum probes for the other five SNPs were selected under the condition that the hybridization was carried out at 55 °C for 40 min and washing was carried out at 45 °C for 40 min. The selected probes are shown in Table 4. The Tm values of all probe sequences were around 65 °C and they were from 16 to 27 bp in length. Simultaneous Genotyping of Six SNPs by the Automated System. The DNA chip with 13 types of immobilized probes (one probe was for control) and the target sample containing six types of LAMP products were prepared. For each probe, two electrodes were assigned. The genotyping of six SNPs was performed with the automated system. In this system, a Peltier element that controls the temperature of the solution on the DNA chip is located directly beneath the DNA chip substrate and the temper-
Figure 4. (I) Results of the examination of hybridization temperature. The graph shows the ∆I values at various conditions. Three types of probes for the wild type (590-17G, 590-21G, 590-26G) and four types of probes for the mutant types (590-19A, 590-21A, 590-23A, 590-27A) were used in this experiment. The hybridization reaction was carried out at 35, 45, 50, 55, and 60 °C for 40 min, and washing was carried out at 25 °C for 1 min. (II) Results of the examination of the relationship between hybridization time and hybridization signal. The graph shows the ∆I values at various conditions. The probes used this experiment were the same as in (I). The hybridization was carried out for 10, 40, and 80 min at 55 °C, and then, washing was carried out at 25 °C for 1 min. (III) Results of the examination of washing temperature. The graph shows the ∆I values at various conditions. The probes used this experiment were the same as (I). The hybridization was carried out at 55 °C for 40 min, and washing was carried out at 40, 45, and 50 °C for 40 min.
ature of the solution reaches the preset temperature at once. Therefore, hybridization and washing time were reduced to 20 min. The turnaround time from setting the cassette in the system to obtaining the genotyping results took 1 h: hybridization 20 min, washing 20 min, and electrochemical detection 10 min. The total detection time including the former process was about 2 h because amplification from the purified genome took 1 h. The genotyping results of 31 samples with the automated system are shown in Figure 5 as a scatter chart. The distributions of each genotype of the six SNPs were clearly distinguished. The genotyping results were all consistent with those determined by the PCR-RFLP or the PCR direct sequence analysis. Signal-tonoise (S/N) ratios with the system were almost the same as those
with the manual operation: the signal means the Ipa value from hybridization on wild or mutant probes, whereas the noise means the Ipa value from nonhybridization on the control probe. These results indicated that all the processes were efficient in the system. Moreover, we are now developing a fully automated system containing the DNA extraction and amplification. The fully automated system can detect DNAs from samples such as blood and hair roots. Therefore, use of the system will not be restricted to technicians, but anyone will be able to use the system anywhere. And it is also expected to reduce the run-to-run and operator-tooperator variability. The LAMP method is highly advantageous for developing a fully automated system because it amplifies DNA under isothermal Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
9491
Figure 5. Genotyping results with the automated system. This graphs show the genotyping result of 31 samples with the automated system. A target sample containing the six LAMP products was injected into a cassette including the DNA chip. After setting the cassette in the DNA detection system, hybridization reaction, washing, electrochemical detection, and data analysis are performed automatically. Specially designed software for SNP analysis is installed on a computer connected to the system, and SNPs are automatically genotyped using voltammetric results. IW: A average of Ipa values on the wild probe. IM: A average of Ipa values on the mutant probe. IB: A average of Ipa values on the control probe. It is referred to as ∆IW ) IW - IB, ∆IM ) IM - IB. X-axis: ∆IW/IB. Y-axis: ∆IM/IB.
condition; the complex temperature control required by PCR is not needed. And all targets can be amplified at the same temperature (63 °C was adopted in this study). Furthermore, it is reported that the LAMP method has a low susceptibility to amplification inhibitors. However, the LAMP method has a drawback in that the risk of contamination tends to be high because amplification proceeds superexponentially and a large amount of amplification product is obtained. When the LAMP products are contaminated, it is speculated that the amplification reaction from the LAMP product with single-stranded loop proceeds faster than that from the genomic DNA. Therefore, we are developing a completely closed cassette to prevent leakage of the amplification product. Some automated systems based on DNA chip technology have been reported.24-28 Among them, Anderson et al.24 and Liu et al.25 have achieved a fully automated (25) Liu, R. H.; Yang, J.; Lenigk, R.; Bonanno, J.; Grodzinski, P. Anal. Chem. 2004, 76, 1824-1831. (26) Yang, J. M.; Bell, J.; Huang, Y.; Tirado, M.; Thomas, D.; Forster, A. H.; Haigis, R. W.; Swanson, P. D.; Wallace, R. B.; Martinsons, B.; Krihak, M. Biosens. Bioelectron. 2002, 17, 605-18. (27) Liu, R. H.; Nguyen, T.; Schwarzkopf, K.; Fuji, H. S.; Petrova, A.; Siuda, T.; Peyvan, K.; Bizak, M.; Danley, D.; McShea, A. Anal. Chem. 2006, 15, 19801986.
9492 Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
system including the processes before hybridization. Liu et al.25 have developed it based on an electrochemical strategy. This method is a three-component sandwich assay using a DNA capture probe, a signaling probe, and a single-stranded target DNA. This is similar to our method, but it is disadvantageous in that ferrocene modification to the signaling probe is essential. On the other hand, the modification step is unnecessary and the procedures are very simple in the case of our method. Moreover, the Hoechst 33258 is available commercially and is cheap. This method and the automated system are applicable not only in the field of point-of-care diagnosis but also in biological warfare agent detection, food-safety testing, and many other fields. CONCLUSION We have developed a novel technique for simultaneous genotyping of SNPs by combining the LAMP method and the electrochemical DNA chip. The single-stranded DNA was contained in LAMP products and can be fully utilized for detec(28) Tojo, Y.; Asahina, J.; Miyashita, Y.; Takahashi, M.; Matsumoto, N.; Hasegawa, S.; Yohda, M.; Tajima, H. J. Biosci. Bioeng. 2005, 99, 120-124. (29) Nagamine, K.; Hase, T.; Notomi, T. Mol. Cell. Probes 2002, 16, 223-229.
tion. The LAMP products containing the six polymorphisms associated with RA were obtained, respectively, and a sample containing the six products was directly injected into a cassette including the DNA chip. After setting the cassette in an automated system, the process after hybridization was performed by the automated system. The whole analysis takes only 2 h, and the procedure is very simple. For the examination of 31 RA patients, the genotyping results obtained with this method were completely consistent with those determined by the existing methods,
indicating the high accuracy and high reliability of this method and the system. ACKNOWLEDGMENT This study was supported in part by Genesys Technologies, Inc. Received for review July 23, 2007. Accepted September 8, 2007. AC0715468
Analytical Chemistry, Vol. 79, No. 24, December 15, 2007
9493
