This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes.
Article Cite This: ACS Omega 2019, 4, 6931−6938
http://pubs.acs.org/journal/acsodf
Determination of the Binding Constant between OligonucleotideCoupled Magnetic Microspheres and Target DNA Mengting Zhou, Xiaomin Chen, Hao Yang, Xiaoxia Fang, Hongchen Gu, and Hong Xu*
Downloaded via 178.57.67.187 on April 17, 2019 at 22:17:21 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
School of Biomedical Engineering/Med-X Research Institute, Shanghai Jiao Tong University, Shanghai 200030, P. R. China ABSTRACT: Oligonucleotide-coupled magnetic microspheres (PMPs) are commonly used as solid carriers in genetic analysis to specifically recognize, capture, and manipulate target DNA. Determining the binding constant (KA) of nucleic acid hybridization using an assay based on magnetic microspheres (MPs) and evaluating the performance of magnetic microspheres as solid carriers has significance for many applications. In this work, we established a simple doublereciprocal plot method to determine the binding constant of nucleic acid hybridization based on magnetic microspheres. The main experimental parameters were first optimized, and the binding constants between PMPs with single-stranded DNA (ssDNA) and PMPs with double-stranded DNA (dsDNA) were 1.07 ± 0.01 × 108 and 0.77 ± 0.02 × 108 M−1, respectively, through the established double-reciprocal plot method. Oligonucleotidecoupled magnetic microspheres have the same initial effective target binding sites (A0), regardless of whether the target molecules are single-stranded or double-stranded. In addition, the binding constants between PMPs with ssDNA and PMPs with dsDNA were 18.58 and 13.37%, respectively, of the binding constants measured in solution by isothermal titration calorimetry. This finding indicates that the binding constant based on solid phase hybridization is not significantly lower than that of liquid phase hybridization, even in the presence of competing target nucleic acid molecules in solution.
1. INTRODUCTION With the coming of the genomic and postgenomic era, nucleic acid hybridization technology has become an important tool in a variety of biomedical applications, including sample screening for single nucleotide polymorphisms,1−5 gene expression studies,6−10 medical diagnosis,11−15 and food and environmental analysis.16−20 In particular, various molecular diagnostic methods based on solid phase nucleic acid hybridization via specific oligonucleotide probes immobilized on the surface of a solid carrier to identify a target complementary sequence in solution have developed rapidly. These methods have high specificity and sensitivity because they can facilitate the removal of nontarget molecules to greatly reduce the probability of nonspecific adsorption. However, the type and surface properties of solid carriers used in these molecular diagnostic assays would dramatically affect the thermodynamic and kinetic behaviors of the nucleic acid hybridization reaction, thus influencing the biodetection performance.21−23 Compared with planar substrate carriers, magnetic microspheres (MPs) are promising supports because they provide faster reaction kinetics as a result of their uniform dispersion in solution and pseudo-liquid-phase-specific reaction surface area.24,25 In addition, with the benefit of easy manipulation under an external magnetic field, magnetic microsphere carriers are suitable for automated and high throughput biodetection platforms.26−29 It is known that the environment experienced by nucleic acid molecules that are immobilized onto the surface of magnetic microspheres is different from the environment experienced during a similar reaction carried out in solution. © 2019 American Chemical Society
Therefore, the nucleic acid hybridization reaction time of magnetic microsphere carriers is usually prolonged to obtain a higher detection sensitivity and linear range.30,31 However, many factors, such as the physical and chemical properties of magnetic microspheres, the density and length of nucleic acid probes bound on their surfaces, and the hybridization position of oligonucleotide probes corresponding to the target molecules, have very different effects on the hybridization reaction.32−34 However, the binding constant between the oligonucleotide coupled onto the magnetic microspheres (PMPs) and the target nucleic acid molecules is the most important thermodynamic parameter, reflecting the essential component of the solid phase nucleic acid hybridization assay. Moreover, the binding constant also reveals the possibility of the reaction and the hybridization efficiency between the probe and target DNA. Therefore, determining the binding constant between oligonucleotide probes conjugated onto magnetic microspheres and target nucleic acid molecules in solution is critical for guiding the preparation of high-performance magnetic microsphere (MP) carriers. In addition, measuring the binding constant ensures that oligonucleotide probes immobilized on the surface of MPs are optimized and aid in the prediction of the nucleic acid hybridization assay detection performance. Pioneering techniques, including capillary electrophoresis35−37and isothermal titration calorimetry (ITC),38−40 have Received: December 28, 2018 Accepted: April 8, 2019 Published: April 17, 2019 6931
DOI: 10.1021/acsomega.8b03654 ACS Omega 2019, 4, 6931−6938
ACS Omega
Article
Scheme 1. (a) Principles Used To Determine the Binding Constant between PMPs and Target DNAa
a
According to the equation at equilibrium in the reaction system, the KA can be determined from a double-reciprocal plot of 1/[A·B] vs 1/[B]. (b) Schematic illustration of the experimental procedure. First, the carboxyl group-functionalized magnetic microspheres were conjugated with probes through a chemical conjugation method to obtain PMPs. Second, the PMPs were incubated with target DNA at 60 °C for 90 min. Third, the mixture was separated by a magnet. Finally, the fluorescence value of target DNA in the supernatant ([B]) was measured. The amount of target DNA bound to PMPs ([A·B]) was calculated by subtraction.
Figure 1. (a) SEM image of magnetic microspheres used in the reaction system. Inset: magnetic microspheres dispersed in solution and manipulated under an external magnetic field. (b) ζ potentials of the magnetic microspheres and oligonucleotide-coupled magnetic microspheres.
nucleic acid hybridization. In this paper, we proposed a rapid and simple method to determine the binding capacity of oligonucleotide-coupled magnetic microspheres and target DNA using a double-reciprocal method. As shown in Scheme 1a, aminated probes (A) were immobilized onto carboxylicfunctionalized magnetic microspheres and incubated with fluorescein-labeled single-stranded DNA (ssDNA) or doublestranded DNA (dsDNA) (B) in solution to form a hybrid complex (A·B). According to the equation at equilibrium of the hybridization reaction, the binding constant (KA) can be calculated from a double-reciprocal plot of 1/[A·B] (the equilibrium concentration of the hybrid complex) versus 1/[B] (the equilibrium concentration of the fluorescein-labeled target DNA). Besides, before the establishment of the doublereciprocal binding constant method, the major experimental parameters were optimized.
been widely used to study binding constants of molecule− molecule interactions in solution. Alternatively, surface plasmon resonance technology,41 surface-enhanced Raman scattering,42 and quartz crystal microbalance43,44 are commonly used to study the binding constants between molecules present in solution and molecules bound to solid surfaces, such as planar substrates or membranes. However, the abovementioned methods are not suitable for measuring binding constants between microsphere surface molecules and their ligands present in solution. The double-reciprocal methods used by Dai et al.30 and Huang et al.45 studied the affinity constants between streptavidin-coated microspheres and biotinylated protein or biotinylated DNA, further explored the relationship between the affinity constant and solid phase reaction to provide theoretical guidance for the preparation of high-performance streptavidin-coated microspheres. However, few studies have measured the binding constant between oligonucleotidecoupled magnetic microspheres (PMPs) and target nucleic acid molecules present in solution, which should be an important parameter for evaluating the performance of magnetic microspheres as solid carriers in genetic analysis and understanding the essential characteristics of solid phase
2. RESULTS AND DISCUSSION 2.1. Characterization of Magnetic Microspheres. An scanning electron microscope (SEM) image of the magnetic microspheres we used is shown in Figure 1a. The diameter of magnetic microspheres was approximately 6 μm with regular spherical morphology and uniform size distribution. In 6932
DOI: 10.1021/acsomega.8b03654 ACS Omega 2019, 4, 6931−6938
ACS Omega
Article
Figure 2. (a) Relationship between the number of bound molecules and quantity of PMPs added to the reaction system. Three concentrations of target DNA, 6.34, 9.44, and 12.55 pmol/mL, were chosen. Inset: the relationship between the number of bound molecules and the quantity of MPs without coupled probes as the control group. Three concentrations of target DNA, 6.34, 9.44, and 12.55 pmol/mL, were added to 6 μg PMPs. (b) Kinetics of the binding reaction were determined using 6 μg PMP at a saturation concentration of target DNA added to the reaction of 12.55 pmol/mL.
tration of target DNA in the supernatant ([B]) was obtained from the standard curve of fluorescence intensity plotted against the concentration of target DNA, which was obtained experimentally beforehand. Thus, the concentration of the hybrid complex at equilibrium ([A·B]) in the hybridization reaction system could be calculated by subtraction ([B]0 − [B]). Therefore, the binding constant KA and the concentration of initial effective probe binding sites ([A]0) were obtained from the slope and intercept of the double-reciprocal plot, respectively. Before determining the binding constant of the nucleic acid hybridization reaction with magnetic microspheres as the immobilization carrier, several experimental parameters were optimized. First, the effect of adding varying amounts of PMPs was investigated. Three different concentrations of targets were used to establish a reasonable amount of PMPs to use. Figure 2a shows that the number of targets bound increased with increasing quantities of PMPs for the three target concentrations. In general, with the addition of more PMPs, the gradient increase of binding targets of each group with different dosages of PMPs became increasingly steep. However, when the group of quantity of PMPs was below 6 μg, the change in target binding quantities was not obvious as more targets were added. The variance of targets bound to PMPs at three different target concentrations was within the detection error and thus unable to objectively reflect the actual quantity of hybrid complexes present at different reaction concentrations. In addition, as shown in the inset of Figure 2a, when MPs without probes were used to capture the target sequence, few targets were bound to the MPs, demonstrating that the nonspecific binding of targets to magnetic microspheres was within the detection error tolerance range, and the binding of targets to the PMPs can be regarded as specific binding. Therefore, 6 μg of PMPs was used in the following experiments. Second, the hybridization reaction equilibrium time was studied carefully. Figure 2b shows the kinetics of the binding reaction between the PMPs and the target DNA. The target binding quantity increased rapidly to 80% of the equilibrium state and then slowly increased for 90 min until it reached a plateau. Subsequently, the hybridization reaction equilibrium time used in this study to measure the binding constant was selected to be 90 min. Third, the concentration range of targets added to the hybridization reaction was optimized. As shown in Figure 3a,
addition, magnetic microspheres could be homogenously dispersed in solution and manipulated freely under an external magnetic field, displayed in the insert image of Figure 1a, which is convenient for employing the microspheres in automated and high throughput detection platforms.26−29 The 5′-aminated oligonucleotide probes were covalently immobilized onto carboxylic-functionalized magnetic microspheres via the carbodiimide method, and surface densities of 3.71 × 1012 molecules/cm2 were achieved. The ζ potentials of the magnetic microspheres and oligonucleotide-coupled magnetic microspheres were −46.9 and −38.9 mV, respectively, measured by Zetasizer Nano ZS (Malvern, U.K.) (Figure 1b), further indicating that the oligonucleotide probes had been coupled onto the MPs.46 2.2. Determination of the Binding Capability between PMPs and ssDNA. As shown in Scheme 1a, nucleic acid hybridization based on magnetic microspheres can be expressed as eq 1 below A + B ⇔ A·B
(1)
where A is the oligonucleotide binding active site onto the surface of magnetic microspheres, B is the fluorescein-labeled target DNA, and A·B is the hybrid complex. At equilibrium in the hybridization reaction system, the binding constant can be expressed as KA =
[A·B] [A][B]
(2)
where [A] is the equilibrium concentration of the probe binding sites, [B] is the equilibrium concentration of the fluorescein-labeled target DNA, and [A·B] is the equilibrium concentration of the hybrid complex. Considering the conservative total number of probe binding sites and the excess target ligands in the bulk solution, eq 2 can be rearranged to give 1 1 1 1 = + [A·B] [A]0 [A]0 KA [B]
(3)
where [A]0 is the initial effective concentration of the target binding sites onto the surface of magnetic microspheres. According to eq 3, the KA and [A]0 can be determined from a double-reciprocal plot of 1/[A·B] versus 1/[B]. As shown in Scheme 1b, the fluorescence intensity of target DNA in the supernatant was measured at equilibrium, and the concen6933
DOI: 10.1021/acsomega.8b03654 ACS Omega 2019, 4, 6931−6938
ACS Omega
Article
Figure 3. (a) Saturation amount of target DNA binding with PMPs was determined using 6 μg PMPs at 60 °C. Curve was obtained by plotting the quantity of target bound against the initial concentration of target DNA added to the reaction. (b) Isothermal binding curve of PMPs and target DNA fitted by a Langmuir isotherm adsorption model. Curve was obtained by plotting the quantity of target bound against the target DNA equilibrium concentration in the reaction system.
Figure 4. (a) Determination of the binding constant between PMPs and ssDNA using a double-reciprocal plot of 1/[A·B] vs 1/[B]. [A]0 and KA can be obtained from the intercept and slope of the curve, respectively. This experiment was repeated three times. (1), (2), and (3) represent the results of the three replicate experiments. (b) Determination of the binding constant between probes and target ssDNA in solution by ITC experiments using a VP-ITC instrument.
Table 1. Calculated Values for KA and A0 probe
target
PMPs
ssDNA
PMPs
dsDNA
probe
ssDNA
A0 (fmol) KA (108 M−1) A0 (fmol) KA (108 M−1) KA (108 M−1)
first experiment
second experiment
third experiment
mean
SD
CV (%)
216.92 1.08 208.76 0.78 5.25
217.39 1.06 215.52 0.75 5.91
205.33 1.08 207.90 0.79 6.13
213.21 1.07 210.73 0.77 5.76
6.83 0.01 4.17 0.02 0.46
3.20 1.08 1.98 2.69 7.95
the number of targets bound to 6 μg of PMPs increased with increasing addition of targets in the range of 6.25−18.69 pmol/ mL and then saturated within the concentration range of 18.69−20.93 pmol/mL. Thus, the concentration range of target ssDNA selected for the following study according to experimental principles was 6.28−11.36 pmol/mL, within the unsaturated range. If the binding target concentration reaches saturation, a variable amount of hybrid complex products will not be obtained as the concentration of target ssDNA increases, and the requirements of eq 3 will not be met. Conversely, if the concentration of target ssDNA was too low,
the concentration of the hybrid complex was also too low to exceed the detection error range. Afterward, we transformed the obtained data into an isothermal adsorption curve as shown in Figure 3b. The isothermal binding curve of PMPs and target nucleic acid molecules was fitted with a Langmuir isotherm model, and the results fit well with R2 = 0.999, indicating that the binding sites of probes on the magnetic microspheres matched a uniform monolayer bonding state for the target DNA. After the main experiment parameters were optimized, the KA of nucleic acid hybridization based on magnetic micro6934
DOI: 10.1021/acsomega.8b03654 ACS Omega 2019, 4, 6931−6938
ACS Omega
Article
spheres could be determined from a double-reciprocal plot of 1/[A·B] versus 1/[B] according to eq 3 mentioned above. The experiment was repeated in triplicate, and the three resulting straight lines are in accordance with eq 3 and have good correlation, as shown in Figure 4a. The average KA between PMPs and ssDNA was calculated to be 1.07 ± 0.01 × 108 M−1 with a coefficient of variation (CV) of 1.08%, as shown in Table 1. The results were essentially in agreement with other methods used to measure the DNA-binding constant.47,48 From the intercept of the linear equation, the average initial effective probe binding site (A0) was calculated to be 213.21 fmol (6 μg PMPs), suggesting that the molecular binding ratio of target DNA and probes coupled to magnetic microspheres was 0.6 mol/mol, since the 338.85 fmol probe was immobilized on the beads. To differentiate between DNA hybridization at solid interfaces and in solution, we used isothermal titration calorimetry to measure the binding constant between the probes and the target single-stranded DNA in solution. The binding constant was 5.76 ± 0.46 × 108 M−1 (Figure 4b), which was consistent with prior studies that used the same method to analyze the probe to target singlestranded DNA binding in solution by ITC.49,50 It was obviously different from the previous research results30,45 that showed a sharp decrease in affinity constants by 7−8 orders of magnitude between streptavidin-coated microspheres and biotin ligands in solution. In our study, the binding constant between PMPs and ssDNA did not decrease significantly and retained 18.58% of the binding constant in solution. This may be because of the fact that in the nucleic acid hybridization assay, based on magnetic microspheres, the conformations of the probes that covalently immobilized on the microspheres do not change much and the probes could be freely stretched in the solution. However, the accessibility of the immobilized probes to target DNA is slightly reduced relative to liquid phase hybridization due to steric effects. Therefore, the binding constant measured by the nucleic acid hybridization assay based on magnetic microspheres is on the same order of magnitude as that of liquid hybridization, that is, the nucleic acid hybridization assay can be considered a pseudo-liquid-phase hybridization assay. Conversely, compared to streptavidin in solution that maintains its natural protein conformation, the conformation of immobilized streptavidin on the surface of microspheres is susceptible to change, causing an obvious decrease in affinity activity. 2.3. Determination of the Binding Capability of PMPs and dsDNA. Although single-stranded DNA is the most ideal target molecule model to investigate the binding constant of nucleic acid hybridization reactions, double-stranded DNA is the most commonly used target molecule in practical biomedical applications. Therefore, the KA between oligonucleotide-coupled magnetic microspheres and fluoresceinlabeled double-stranded DNA was also measured using the same methods we proposed above. First, 111 bp doublestranded DNA was generated via the polymerase chain reaction (PCR) and a strand in the obtained double-stranded DNA was labeled with Cy5 during the amplification step using the Cy5-labeled primer. As shown in Figure 5a, only one bright band at the 111 bp position on a 2% agarose gel indicated that dsDNA amplification products were in the absence of primer dimers. The concentration of the polymerase chain reaction (PCR) products was quantified by fluorescence spectroscopy, and a series of fluorescently labeled dsDNA ranging from 5.80 to 9.48 pmol/mL was added to the hybridization solution. In
Figure 5. (a) Agarose gel of symmetrical PCR products. Lane M is a molecular weight marker (50, 100, 150, 200, 300, 400, 500 bp from bottom to top) and lane 1 is the dsDNA amplification product. (b) Determination of the binding constant between PMPs and dsDNA using a double-reciprocal plot of 1/[A·B] vs 1/[B]. [A]0 and KA can be obtained from the intercept and slope of the curve, respectively. This experiment was repeated three times. (1), (2), and (3) represent the results of the three replicate experiments.
Figure 5b, with ssDNA processing, the experiment of determining the KA between oligonucleotide-coupled magnetic microspheres and fluorescein-labeled double-stranded DNA was repeated in triplicate, and the three straight lines are in accordance with eq 3 and have good correlation. The KA between PMPs and dsDNA was calculated to be 0.77 ± 0.02 × 108 M−1 with a CV of 2.69%, and the A0 was 210.73 fmol (Table 1). The initial effective target binding sites of PMPs and dsDNA were consistent with the result of PMPs and ssDNA, which showed that oligonucleotide-coupled magnetic microspheres have the same initial effective target binding sites, regardless of whether the target molecules are single-stranded or double-stranded. Interestingly, compared with the KA between PMPs and ssDNA, the binding constant between PMPs and dsDNA remains approximately 71.96% that of ssDNA hybridization, suggesting that the binding constant based on solid phase hybridization does not decrease significantly, even if there are competing complementary sequences of target DNA in the solution.51 In other words, the effect of competitive hybridization side reactions on solid phase hybridization is not significant, it is possible that Cy5labeled dsDNA performed a melting/reannealing step before hybridization to enable separation of the complementary strands of the target dsDNA. This result provides both theoretical and practical information for the development of high-sensitivity molecular detection methods based on solid phase hybridization.
3. CONCLUSIONS A double-reciprocal plot method to determine the binding constant between oligonucleotide probes coupled onto magnetic microspheres and target DNA was established, the benefits of this method are: it does not require elaborate instrumentation and has simple operation. The binding constants between PMPs with ssDNA and PMPs with dsDNA were measured in our study to be 1.07 ± 0.01 × 108 and 0.77 ± 0.02 × 108 M−1, respectively. These results were 18.58 and 13.37% of the binding constant in solution (5.76 ± 0.46 × 108 M−1), respectively, indicating that the nucleic acid hybridization assay based on magnetic microspheres has high affinity and the magnetic microspheres can be 6935
DOI: 10.1021/acsomega.8b03654 ACS Omega 2019, 4, 6931−6938
ACS Omega
Article
Table 2. Sequences and Modifications of Target ssDNA, Primers, and Probe name
sequence (5′−3′)
target ssDNA
ACACCGCAGCATGTCAAGATCACAGATTTTGGGCGGGCCAAACTGCTGGGTG CGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCTTTAGGT CAGC ACACCGCAGCATGTCAAGATC
forward primer reverse primer probe
length (nt)
Tm (°C)a
GC content (%)a
5′-Cy5
111
79.30
52.30
5′-Cy5
23
60.40
52.20
24
60.00
54.20
31
72.02
58.06
modification
GCTGACCTAAAGCCACCTCCTTAC TCCGCACCCAGCAGTTTGGCCCGCC
5′-amino, poly-dT6
a
Tm values and CG contents were provided by Sangon (Shanghai, China).
used as prospective solid carriers. In addition, the initial effective binding sites of oligonucleotide-coupled magnetic microspheres to target DNA do not change, regardless of whether the target molecules are single- or double-stranded DNA. This attribute could be related to the density of the oligonucleotide probe immobilized onto the surface of magnetic microspheres. This method can be used to easily guide the preparation of high-performance magnetic microsphere (MP) carriers and evaluate the detection performance of nucleic acid hybridization assays based on magnetic microspheres. Thus, this study provides theoretical and practical information on the development of solid phase nucleic acid hybridization assays for biomedical applications.
size analyzer (Malvern, U.K.), and the microstructure and morphology were observed by a Zeiss Ultra Plus field emission scanning electron microscope (Oberkochen, Germany). The quantities of oligonucleotide probes before and after immobilization were measured by a Qubit Fluorometer (CA). The fluorescence intensity values of target DNA added to the reaction and the remaining nucleic acids in the supernatant was measured using a SpectraMax i3x Multi-Mode microplate reader (CA). The binding constant of the hybridization reaction in solution was measured by isothermal titration calorimetry using a MicroCal VP-ITC instrument (Malvern, U.K.). The target DNA and PMPs were incubated in an FZ-B molecular hybridization oven (Taicang, China). PCRs were performed on a ProFlex PCR System cycler (CA). 4.3. Immobilization of Probes onto Magnetic Microspheres. Before immobilization, 10 μL of 50 mg/mL magnetic microspheres were washed twice with MES buffer (0.01 M, pH 4.5). The microspheres were incubated with 50 μL oligonucleotide probes and 150 μL EDC buffer diluted to a final concentration of 50 mg/mL in MES buffer (0.1 M, pH 4.5) for 1 h at room temperature. After incubation, unbound probes were removed by washing four times with boric acid buffer (0.01 M, pH 9.5) containing 0.5% (w/v) SDS. Magnetic microspheres were blocked in PBS buffer (0.01 M, pH 7.4, 0.5% (w/v) BSA) overnight at 4 °C and then stored in water for further analysis. To calculate the surface densities of oligonucleotide-coupled magnetic microspheres, the quantity of oligonucleotide probes before and after immobilization were measured using a Qubit Fluorometer and ssDNA Assay Kit. 4.4. Binding Capability of PMPs and Target ssDNA. A schematic of the experimental procedure is shown in Scheme 1b. Five microliters of 1 mg/mL PMPs were added to 50 μL hybridization solution (0.02 M Tris−HCl, pH 7.0, 0.02 M NaCl, 0.1% Tween-20). Then, 40 μL fluorescein-labeled target ssDNA was added to the solution at concentrations ranging from 3.83 to 14.36 pM for a total volume of 100 μL. The mixture was separated by a magnetic plate after incubation for 90 min at 60 °C. Finally, a fluorescence spectrometer was used to measure the fluorescence intensity of the supernatant at an excitation wavelength of 631 nm and an emission wavelength of 665 nm. The experiment was repeated in triplicate. A series of experiments have previously been carried out to optimize the quantities of PMPs and target ssDNA added to the reaction system and measure the reaction equilibrium time. 4.5. Binding Capability of PMPs and Target dsDNA. Cy5-labeled target double-stranded DNA was obtained by the polymerase chain reaction (PCR). PCR was carried out in 50 μL reactions containing 2× PCR Master Mix, 50 units/mL of Taq DNA polymerase, 400 μM dATP, 400 μM dGTP, 400 μM dCTP, 400 μM dTTP, 3 mM MgCl2, 200 nM forward primer,
4. MATERIALS AND METHODS 4.1. Reagents. The target 111 bp fragment was an internal sequence of the human epidermal growth factor receptor gene (GenBank accession no. NC_000007.14). The target singlestranded DNA, oligonucleotide probe, and forward and reverse primers were synthesized and purified by Sangon (Shanghai, China), and detailed information is listed in Table 2. The fluorescent dye, Cy5, is covalently attached to the amino group at the 5′ end of the forward primer. Cy5 was naturally introduced into the 5′-terminal of the amplified PCR products, in which a strand of the amplified double-chain products was labeled with Cy5, and the base sequence of the labeling chain is identical to that of the single-stranded DNA labeled with Cy5. The carboxylic-group-functionalized magnetic microspheres (8 × 106 particles/mg) with a diameter of 6 μm were purchased from Bangs Laboratories, Inc. (IN). Tween-20 was provided by Bio Basic Inc. (BC, Canada). 1-Ethyl-3-[3dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Medpe (Shanghai, China). Sodium chloride, dibasic sodium phosphate, potassium chloride, and potassium dihydrogen phosphate for the phosphate-buffered saline (PBS) buffer (0.01 M, pH 7.5) were provided by Shanghai Chemical Reagent Company (Shanghai, China). Sodium dodecyl sulfate (SDS), 2-[4-morpholino]ethanesulfonic acid (MES) and (hydroxymethyl) aminomethane (Tris) were purchased from Shanghai Chemical Reagent Company (Shanghai, China). Bovine serum albumin (BSA) was obtained from Genview (FL). The Qubit ssDNA Assay Kit was obtained from Life Technologies (CA). The 2× PCR Master Mix was provided by Promega (WI), and the template plasmid was synthesized by Thermo Fisher Scientific (MA). All chemicals were used as received, and all aqueous solutions were prepared in Millipore purified water. 4.2. Apparatuses. The ζ potentials of the magnetic microspheres were measured by a Malvern Nano ZSP particle 6936
DOI: 10.1021/acsomega.8b03654 ACS Omega 2019, 4, 6931−6938
ACS Omega
Article
(2) Li, S.; Liu, H.; Jia, Y.; Mou, X.; Deng, Y.; Lin, L.; Liu, B.; He, N. An automatic high-throughput single nucleotide polymorphism genotyping approach based on universal tagged arrays and magnetic nanoparticles. J. Biomed. Nanotechnol. 2013, 9, 689−698. (3) Armstrong, B.; Stewart, M.; Mazumder, A. Suspension arrays for high throughput, multiplexed single nucleotide polymorphism genotyping. Cytometry, Part A 2015, 40, 102−108. (4) Bi, S.; Zhang, Z.; Dong, Y.; Wang, Z. Chemiluminescence resonance energy transfer imaging on magnetic particles for singlenucleotide polymorphism detection based on ligation chain reaction. Biosens. Bioelectron. 2015, 65, 139−144. (5) Huang, C. J.; Lin, Z. E.; Yang, Y. S.; Chan, H. W.; Chen, W. Y. Neutralized chimeric DNA probe for detection of single nucleotide polymorphism on surface plasmon resonance biosensor. Biosens. Bioelectron. 2018, 99, 170−175. (6) Gravallese, E. M.; Darling, J. M.; Ladd, A. L.; MS, J. N. K. M.; Glimcher, L. H. In Situ Hybridization Studies of Stromelysin and Collagenase Messenger RNA Expression in Rheumatoid Synovium. Arthritis Rheum. 1991, 34, 1076−1084. (7) Ohnishi, M.; Sasaki, N.; Kishimoto, T.; Watanabe, H.; Takagi, M.; Mizutani, S.; Kishii, N.; Yasuda, A. A new microcolumn-type microchip for examining the expression of chimeric fusion genes using a nucleic acid sandwich hybridization technique. J. Chromatogr. B 2014, 970, 60−67. (8) Sykacek, P.; Kreil, D. P.; Meadows, L. A.; Auburn, R. P.; Fischer, B.; Russell, S.; Micklem, G. The impact of quantitative optimization of hybridization conditions on gene expression analysis. BMC Bioinf. 2011, 12, No. 73. (9) Wu, T. C.; Mann, R. B.; Charache, P.; Hayward, S. D.; Staal, S.; Lambe, B. C.; Ambinder, R. F. Detection of EBV gene expression in Reed-Sternberg cells of Hodgkin’s disease. Int. J. Cancer 1990, 46, 801−804. (10) Edgar, R.; Domrachev, M.; Lash, A. E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002, 30, 207−210. (11) Subramanian, S.; Lui, W. O.; Lee, C. H.; Espinosa, I.; Nielsen, T. O.; Heinrich, M. C.; Corless, C. L.; Fire, A. Z.; Rijn, M. V. D. MicroRNA expression signature of human sarcomas. Oncogene 2008, 27, 2015−2026. (12) Zhou, X.; Zhu, W.; Li, H.; Wen, W.; Cheng, W.; Wang, F.; Wu, Y.; Qi, L.; Fan, Y.; Chen, Y.; et al. Diagnostic value of a plasma microRNA signature in gastric cancer: a microRNA expression analysis. Sci. Rep. 2015, 5, No. 11251. (13) Ok, C. Y.; Papathomas, T. G.; Medeiros, L. J.; Young, K. H. EBV-positive diffuse large B-cell lymphoma of the elderly. Blood 2013, 122, 328−340. (14) Machado, A.; Almeida, C.; Salgueiro, D.; Henriques, A.; Vaneechoutte, M.; Haesebrouck, F.; Vieira, M. J.; Rodrigues, L.; Azevedo, N. F.; Cerca, N. Fluorescence in situ Hybridization method using Peptide Nucleic Acid probes for rapid detection of Lactobacillus and Gardnerella spp. BMC Microbiol. 2013, 13, 82−94. (15) Iranifam, M. Analytical applications of chemiluminescencedetection systems assisted by magnetic microparticles and nanoparticles. TrAC, Trends Anal. Chem. 2013, 51, 51−70. (16) Machado, A.; Almeida, C.; Carvalho, A.; Boyen, F.; Haesebrouck, F.; Rodrigues, L.; Cerca, N.; Azevedo, N. F. Fluorescence in situ hybridization method using a peptide nucleic acid probe for identification of Lactobacillus spp. in milk samples. Int. J. Food Microbiol. 2013, 162, 64−70. (17) Zhang, X.; Ke, L.; Shan, W.; Shuai, J.; Fang, W. Peptide nucleic acid fluorescence in-situ hybridization for identification of Vibrio spp. in aquatic products and environments. Int. J. Food Microbiol. 2015, 206, 39−44. (18) Machado, A.; Cerca, N. Multiplex Peptide Nucleic Acid Fluorescence In Situ Hybridization (PNA-FISH) for Diagnosis of Bacterial Vaginosis. In Diagnostic Bacteriology; Bishop-Lilly, K., Ed.; Methods in Molecular Biology; Humana Press: New York, NY, 2017; Vol. 1616, pp 209−219.
200 nM reverse primer, and 5 ng of template plasmid. The amplification conditions were: initial denaturation at 95 °C for 5 min, followed by 35 three-step cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, with a final extension step at 72 °C for 5 min. The amplification products were analyzed by 2% agarose gel electrophoresis to confirm the approximate size of the product. The concentration of the PCR product was obtained from the standard curve of fluorescence intensity plotted against the concentration of Cy5-labeled ssDNA. Fluorescein-labeled dsDNA were routinely denatured at 95 °C for 15 min and cooled on ice immediately to separate the complementary strands of the target dsDNA. A series of denatured dsDNA ranging from 5.80 to 9.48 pmol/mL was added to the solution. The binding capacity of PMPs and dsDNA was detected using the same methods as described in Section 4.4 for the binding capability of PMPs and target ssDNA. 4.6. Binding Capability of Probes and Target ssDNA in Solution. The binding constant between target ssDNA and probes in solution was determined by isothermal titration calorimetry. All samples were dialyzed against a buffer solution with the appropriate pH that was degassed prior to the experiment. The samples were thermostatted, and the instrument was stabilized for 1 h to ensure thermal equilibrium. In total, 230 μL target ssDNA solution was titrated into 40 μL probe solution with 18 successive 2 μL of injections and a time interval of 200 s between each injection. The concentrations of target ssDNA and probe were 13.67 and 80.01 μM, respectively. The experiments were performed at 60 °C with stirring at 750 rpm.
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Tel: +86-21-62933743. Fax: +86-21-62932907. ORCID
Hong Xu: 0000-0002-2787-5806 Author Contributions
M.Z. performed the experiments, organized the data and wrote the draft; X.C. and H.Y. contributed to the experiments, including immobilization of the probes onto the surface of the magnetic microspheres and the ITC experiments. X.F. revised the manuscript, H.X. and H.G. proposed the project concept, and H.X. designed and oversaw the project, wrote the manuscript, and acquired the funding. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS The authors acknowledge financial support for this work from the National Natural Science Foundation of China (21874091), The Key Research and Development Program of Zhejiang province (2017C03005), and SJTU Funding (YG2015ZD11).
■
REFERENCES
(1) Østergaard, M. E.; Kumar, P.; Baral, B.; Guenther, D. C.; Anderson, B. A.; Ytreberg, F. M.; Deobald, L.; Paszczynski, A. J.; Sharma, P. K.; Hrdlicka, P. J. C5-functionalized DNA, LNA, and α-LLNA: positional control of polarity-sensitive fluorophores leads to improved SNP-typing. Chem. − Eur. J. 2015, 17, 3157−3165. 6937
DOI: 10.1021/acsomega.8b03654 ACS Omega 2019, 4, 6931−6938
ACS Omega
Article
contactless conductivity detection. Electrophoresis 2006, 27, 4025− 4028. (38) Gourishankar, A.; Shukla, S.; Ganesh, K. N.; Sastry, M. Isothermal Titration Calorimetry Studies on the Binding of DNA Bases and PNA Base Monomers to Gold Nanoparticles. J. Am. Chem. Soc. 2004, 126, 13186−13187. (39) Pozharski, E.; Macdonald, R. C. Thermodynamics of Cationic Lipid-DNA Complex Formation as Studied by Isothermal Titration Calorimetry. Biophys. J. 2002, 83, 556−565. (40) Timmer, C. M.; Michmerhuizen, N. L.; Witte, A. B.; Van, W. M.; Zhou, D.; Sinniah, K. An isothermal titration and differential scanning calorimetry study of the G-quadruplex DNA-insulin interaction. J. Phys. Chem. B 2014, 118, 1784−1790. (41) Lan, Y.-C.; Tsai, W.-C. Study of the Interaction of Methylene Violet with Calf Thymus DNA Using an SPR-Based DNA Sensor. Anal. Lett. 2011, 44, 717−726. (42) Murza, A.; Alvarez-Méndez, S.; Sanchez-Cortes, S.; GarciaRamos, J. V. Interaction of antitumoral 9-aminoacridine drug with DNA and dextran sulfate studied by fluorescence and surfaceenhanced Raman spectroscopy. Biopolymers 2003, 72, 174−184. (43) Furusawa, H.; Nakayama, H.; Funasaki, M.; Okahata, Y. Kinetic characterization of small DNA-binding molecules interacting with a DNA strand on a quartz crystal microbalance. Anal. Biochem. 2016, 492, 34−42. (44) Matsuno, H.; Niikura, K.; Okahata, Y. Direct monitoring kinetic studies of DNA polymerase reactions on a DNA-immobilized quartz-crystal microbalance. Chemistry 2015, 7, 3305−3312. (45) Huang, S. C.; Stump, M. D.; Weiss, R.; Caldwell, K. D. Binding of biotinylated DNA to streptavidin-coated polystyrene latex: effects of chain length and particle size. Anal. Biochem. 1996, 237, 115−122. (46) Haddad, Y.; Xhaxhiu, K.; Kopel, P.; Hynek, D.; Zitka, O.; Adam, V. The Isolation of DNA by Polycharged Magnetic Particles: An Analysis of the Interaction by Zeta Potential and Particle Size. Int. J. Mol. Sci. 2016, 17, 550−561. (47) Möhrle, B. P.; Kumpf, M.; Gauglitz, G. Determination of affinity constants of locked nucleic acid (LNA) and DNA duplex formation using label free sensor technology. Analyst 2005, 130, 1634−1638. (48) Kaur, H.; Arora, A.; Gogoi, K.; Solanke, P.; Gunjal, A. D.; Kumar, V. A.; Maiti, S. Effects for the incorporation of five-atom thioacetamido nucleic acid (TANA) backbone on hybridization thermodynamics and kinetics of DNA duplexes. J. Phys. Chem. B 2009, 113, 2944−2951. (49) Goobes, R.; Kahana, N.; Cohen, O.; Minsky, A. Metabolic Buffering Exerted by Macromolecular Crowding on DNA−DNA Interactions: Origin and Physiological Significance. Biochemistry 2003, 42, 2431−2440. (50) Kumar, S.; Xue, L.; Arya, D. P. Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes. J. Am. Chem. Soc. 2011, 133, 7361−7375. (51) Tomlinson, J.; Harrison, C.; Boonham, N.; Goodchild, S. A.; Weller, S. A. Influence of the length of target DNA overhang proximal to the array surface on discrimination of single-base mismatches on a 25-mer oligonucleotide array. BMC Res. Notes 2014, 7, No. 251.
(19) Böhme, K.; Cremonesi, P.; Severgnini, M.; Villa, T. G.; Fernándezno, I. C.; Barrosvelázquez, J.; Castiglioni, B.; Calomata, P. Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes. BioMed. Res. Int. 2014, 2014, No. 156323. (20) Van Nostrand, J. D.; Yin, H.; Wu, L.; Yuan, T.; Zhou, J. Hybridization of Environmental Microbial Community Nucleic Acids by GeoChip. Microb. Environ. Genomics 2016, 1399, 183−196. (21) Watterson, J.; Piunno, P. A. E.; Krull, U. J. Practical physical aspects of interfacial nucleic acid oligomer hybridisation for biosensor design. Anal. Chim. Acta 2002, 469, 115−127. (22) Algar, W. R.; Krull, U. J. Interfacial Chemistry and the Design of Solid-Phase Nucleic Acid Hybridization Assays Using Immobilized Quantum Dots as Donors in Fluorescence Resonance Energy Transfer. Sensors 2011, 11, 6214−6236. (23) Rao, A. N.; Grainger, D. W. Biophysical Properties of Nucleic Acids at Surfaces Relevant to Microarray Performance. Biomater. Sci. 2014, 2, 436−471. (24) Son, A.; Dosev, D.; Nichkova, M.; Ma, Z.; Kennedy, I. M.; Scow, K. M.; Hristova, K. R. Quantitative DNA hybridization in solution using magnetic/luminescent core−shell nanoparticles. Anal. Biochem. 2007, 370, 186−194. (25) Jennings, T. L.; Rahman, K. S.; Fournier-Bidoz, S.; Chan, W. C. Effects of Microbead Surface Chemistry on DNA Loading and Hybridization Efficiency. Anal. Chem. 2008, 80, 2849−2856. (26) Fuentes, M.; Mateo, C.; Rodriguez, A.; Casqueiro, M.; Tercero, J. C.; Riese, H. H.; Fernández-Lafuente, R.; Guisán, J. M. Detecting minimal traces of DNA using DNA covalently attached to superparamagnetic nanoparticles and direct PCR−ELISA. Biosens. Bioelectron. 2006, 21, 1574−1580. (27) Berensmeier, S. Magnetic particles for the separation and purification of nucleic acids. Appl. Microbiol. Biotechnol. 2006, 73, 495−504. (28) Peterson, R. D.; Chen, W.; Cunningham, B. T.; Andrade, J. E. Enhanced sandwich immunoassay using antibody-functionalized magnetic iron-oxide nanoparticles for extraction and detection of soluble transferrin receptor on a photonic crystal biosensor. Biosens. Bioelectron. 2015, 74, 815−822. (29) Gao, Y.; Pallister, J.; Lapierre, F.; Crameri, G.; Wang, L. F.; Zhu, Y. A rapid assay for Hendra virus IgG antibody detection and its titre estimation using magnetic nanoparticles and phycoerythrin. J. Virol. Methods 2015, 222, 170−177. (30) Dai, X.; Xu, H.; Zhang, X.; Zhu, W.; Gu, H.; Wei, M. Determination of the affinity constant of streptavidin-coupled magnetic particles and a biotinylated antibody for high performance of magnetic solid carrier in immunoassays. Mater. Sci. Eng., C 2014, 34, 422−428. (31) Levicky, R.; Horgan, A. Physicochemical Perspectives on DNA Microarray and Biosensor Technologies. Trends Biotechnol. 2005, 23, 143−149. (32) Martins, S. A.; Prazeres, D. M.; Fonseca, L. P.; Monteiro, G. A. Application of central composite design for DNA hybridization onto magnetic microparticles. Anal. Biochem. 2009, 391, 17−23. (33) Martins, S. A.; Prazeres, D. M.; Fonseca, L. P.; Monteiro, G. A. The role of probe-probe interactions on the hybridization of doublestranded DNA targets onto DNA-modified magnetic microparticles. Anal. Bioanal. Chem. 2009, 394, 1711−1716. (34) Zhang, L.; Hurek, T.; Reinhold-Hurek, B. Position of the fluorescent label is a crucial factor determining signal intensity in microarray hybridizations. Nucleic Acids Res. 2005, 33, No. e166. (35) Hamdan, I. I.; Skellern, G. G.; Waigh, R. D. Use of capillary electrophoresis in the study of ligand-DNA interactions. Nucleic Acids Res. 1998, 26, 3053−3058. (36) Weiss, D. J.; Lunte, C. E. Detection of a urinary biomaker for oxidative DNA damage 8-hydroxydeoxyguanosine by capillary electrophoresis with electrochemical detection. Electrophoresis 2015, 21, 2080−2085. (37) Xu, Y.; Li, S. F. Y. Carbon nanotube-enhanced separation of DNA fragments by a portable capillary electrophoresis system with 6938
DOI: 10.1021/acsomega.8b03654 ACS Omega 2019, 4, 6931−6938
