Developing and Characterization of Chemically ... - ACS Publications

Subscriber access provided by KEAN UNIV

Article

Developing and Characterization of Chemically modified RNA Aptamers for targeting Wild type and Mutated c-KIT Receptor Tyrosine Kinases Ala'a Said Shraim, Abdelrahim Hunaiti, Abdalla Awidi, Walhan Alshaer, nidaa ababneh, Bashaer Abu-Irmaileh, Fadwa Odeh, and Said Ismail J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.9b00868 • Publication Date (Web): 01 Aug 2019 Downloaded from pubs.acs.org on August 2, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Developing and Characterization of Chemically modified RNA Aptamers for targeting Wild type and Mutated c-KIT Receptor Tyrosine Kinases Ala’a S. Shraim, 1,2* Abdelrahim Hunaiti, 3 Abdalla Awidi, 4 Walhan Alshaer, 4 Nidaa A. Ababneh, 4 Bashaer Abu-Irmaileh, 5 Fadwa Odeh, 6 Said Ismail.7, 8 1Department

of Biological Sciences, School of Science, The University of Jordan, Amman,

Jordan. JO 11942. 2

Department of Medical Laboratory Sciences, Faculty of Allied Medical Sciences, Al-Ahliyya

Amman University, Amman, Jordan, JO 19328. 3

Department of Clinical Laboratory Sciences, School of Science, The University of Jordan,

Amman, Jordan. JO 11942. 4Cell

Therapy Center, The University of Jordan, Amman, Jordan. JO 11942.

5Hamdi

Mango Center for Scientific Research, The University of Jordan, Amman, Jordan. JO

11942. 6

Department of Chemistry, School of Science, The University of Jordan, Amman, Jordan. JO

11942. 7

Department of Biochemistry and Physiology, School of Medicine, The University of Jordan,

Amman, Jordan. JO 11942. 8

Qatar Genome Project, Qatar Foundation, Doha, Qatar.

ACS Paragon Plus Environment

1

Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 68

KEYWORDS c-KIT tyrosine kinase, D816 activation loop mutations, RNA aptamers, enzymatic studies, kinase inhibitor.

ABSTRACT. The c-KIT receptor represents an attractive target for cancer therapy. Aptamers are emerging as a new promising class of nucleic acid therapeutics. In this study, a conventional SELEX approach was applied against the kinase domain of a group of c-KIT proteins (c-KIT WT, c-KIT

D816V,

and c-KIT

D816H)

to select aptamers from a random RNA pool that can bind to the

kinase domain of each target with high affinity and can selectively interfere with their kinase activities. Interestingly, our data indicated that one candidate aptamer, called V15, can specifically inhibit the in vitro kinase activity of mutant c-KIT

D816V

with an IC50 value that is 9

fold more potent than the sunitinib drug tested under the same conditions. Another aptamer, named as H5/V36, showed the potential to distinguish between the c-KIT kinases by modulating the phosphorylation activity of each in a distinct mechanism of action and in a different potency.

INTRODUCTION The c-KIT receptor tyrosine kinase is a member of class III receptor tyrosine kinase (RTK) that catalyzes the transfer of γ- phosphate from ATP to tyrosine residues in polypeptides. Structurally, these receptors are divided into an extracellular ligand binding domain (ECD), a single transmembrane segment, and an intracellular cytoplasmic tail. The intracellular domain composed of a juxta-membrane domain (JMD), a highly conserved intracellular tyrosine kinase domain (KD), and a C-terminal tail.1 The kinase domain has the characteristic bilobed architecture observed in all protein kinases and is comprised of two subdomains which are interrupted by a kinase insert sequence (KID) of 77 amino acids long.2


2

Page 3 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The catalytic site of the c-KIT kinase lies in the cleft between the small and large lobes.3 The large C-lobe includes an activation loop (A-loop; 810-839), which provides a platform for the peptide substrate and whose orientation determines the active or inactive state of the kinase domain.4 The catalytic domain of kinases shows a high degree of sequence homology, especially for kinases that belong to the same family. They share a common ATP binding site with a conserved activation loop and similar three-dimensional structures.5 The c-KIT kinase domain exists in active (PDB ID: 1PKG) and inactive conformations (PDB ID: 1T45) as determined by the X-ray crystallography.6,7 c-KIT receptors are expressed in different types of normal cells such as hematopoietic stem cells from the bone marrow, melanocytes, the differentiated mast cells, the interstitial cells of Cajal (ICC) in the gastrointestinal tract, and the germ cells in the fertility system.8,9,10 Under physiological conditions, the activity of c-KIT protein kinases and the downstream signaling events are stringently regulated. Deregulation of c-KIT activity can result in cancer. More than 500 different mutations of c-KIT have been described in human tumors as reported

by

Sanger

Institute

Catalogue

of

Somatic

Mutations

in

Cancer;

http://www.sanger.ac.uk/genetics/CGP/cosmic/ .10 In some tumors, such as melanoma, thyroid carcinoma, and breast cancer, loss of function mutations of the c-KIT was observed.11 Conversely, in certain cancer types, such as gastrointestinal stromal tumors (GIST) and human mast cell leukemia, the main cause of tumorigenesis is the activating mutations in the c-KIT. Indeed, 75–80% of GIST cases and greater than 90% of all cases of systemic mastocytosis bear gain of function mutations in the c-KIT protein.3,12 The most common mutation was the missense substitution mutation in D816 residue located in the A-loop domain which encoded by exon 17.10 In fact, in the inactive state, D816 residue occurs within an important regulatory α-helix segment and its mutation to a hydrophobic or aromatic residue would eliminate a negative charge from


3


Page 4 of 68

the A-loop region and potentially destabilize this helical segment.6 In consequence, A-loop mutants can become activated more than 100 times faster than wild-type because the active conformation is so energetically favored.13 Thus, substitution of D816 with V816, H816, Y816 or F816 would promote the conformational conversion of c-KIT kinase from inactive DFG-out to active DFG-in conformation, conferring a constitutive activation to the c-KIT kinase.14 Noteworthy, the amino acid sequence similarity of the A-loop in class III RTKs is greater than 70%. Moreover, the protein structure of this region is almost identical between c-KIT, PDGFRA, and FLT3 proteins.15 In addition, the A-loop mutants of the c-KIT kinase have been largely resistant to inhibition by the majority of conventional small-molecule ATP-competitive inhibitors that target the receptor’s inactive conformation.16,17 In a complementary fashion, accumulated shreds of evidence indicated that the frequency of these mutations is increasing after the second line therapy (sunitinib), which also has inadequate activity on the A-loop mutants.18 Recently, an interest has been growing in an effort to discover an approach to only inhibit the mutant therapeutic target, thereby minimizing the risk of potential side effects associated with the inhibition of normal function.19 Thus, the identification of antagonist that more specifically inhibits the activity of oncogenic mutant c-KIT kinase, but not the wild type protein in normal tissues, would be very useful. The future of novel and selective kinase inhibitors rests on the discovery of compounds that bind outside of the ATP site while retaining a high level of potency and efficacy.20 Indeed, the last three decades have witnessed the progression in the development and application of the nucleic acid aptamers in a wide variety of fields, including target analysis, disease therapy, and molecular and cellular engineering.21


4

Page 5 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Aptamers are defined as a short, typically with 25–100 nucleotides, single-stranded oligonucleotides (RNA or DNA) that can fold into specific three-dimensional structures in order to recognize target molecules.22 Recent discoveries reveal that these specific sequences of nucleic acids possess unique binding characteristics to their targets and can be easily synthesized and selected with high specificity and affinity, which make them emerge as a promising innovative tool for therapeutic strategies specifically for cancer therapy. The current study aimed to select chemically modified RNA aptamers, using the systematic evolution of ligands by exponential enrichment (SELEX) technique, targeting the intracellular kinase domain of the wild type and two mutated D816H and D816V c-KIT kinases, in an attempt to identify novel therapeutic aptamers which can bind with high affinity and can functionally discriminate and interfere with the biological activity of the wild type and the mutant drug-resistant variants of cKIT protein. RESULTS AND DISCUSSION The in vitro selection of chemically modified anti c-KIT aptamers. In this study, a branched SELEX-based approach was employed for the enrichment of 2′-fluoropyrimidine modified RNA ligands able to bind to the active kinase domain of the wild type and mutated c-KIT proteins with high affinity and specificity. After thirteen iterative rounds of selection, the enriched RNA aptamers from each final pool were cloned and a total of 194 cloned plasmids were sent for sequencing to Macrogen Incorporation, South Korea. Accordingly, thirty four successful sequences of anti c-KIT

WT

aptamers were identified and grouped into six families based on

sequence similarities in the variable regions. These sequences are listed in Table (S1) according to their abundance. Eighteen different sequences of anti-c-KIT and listed in Table (S2). For anti c-KIT

D816V

D816H

aptamers were identified

aptamers, fifty nine successful sequences were


5


Page 6 of 68

identified and classified into fourteen families with different sequences according to their abundance as shown in Table (S3). Sequences analysis and Secondary structures prediction. Sequences analysis revealed that W3 anti c-KIT

WT

aptamer is the most abundant sequence that constitutes around half of the

input pool that was selected against the wild type form of c-KIT kinase domain. In the same approach, H31 and V5 are the most prevalent sequences against c-KIT

D816H

and c-KIT

D816V

proteins, respectively. There is a general perception that the most abundant sequence of the final round of a selection experiment is the ones with highest target affinity.23,24 However, kinetic analysis of representative aptamers revealed that the aptamers with the highest affinity are not necessarily the ones dominate the clone library. Indeed, an informative study provides convincing pieces of evidence that aptamers with fast association rates dominate the final pool. 25 In fact, the nature of certain protein areas may be particularly well suited for aptamer binding and such hotspot region represents a dominant recognition site for aptamers.26 In supporting fashion, our data indicate that W3, H31, and V5 dominant sequences are unique to their targets suggesting that the substituted point mutation in D816 residue induces different conformational changes that could result in the disappearance of such dominant recognition epitope for which a given aptamer can recognize and bind. Noteworthy, the researchers found that aspartic acids interacted more frequently with the RNA loops in which the nucleotide bases had flipped out to form hydrogen bonds with the protein.27 Moreover, cross-competition between aptamers bound to distinct sites through partial overlap could also possible given that the size of our aptamers is not small compared to small molecules. Overall, the principles that guide the in vitro selection of aptamers are similar to those that govern the natural selection of biopolymers. As described by Ellington and Conrad, it is truly the survival of the “fittest” sequences from the random sequence


6

Page 7 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


pools that extracted in the final enriched pool.28 Finally, in order to gain insight into the conservation of nucleotide sequences, multiple sequence alignments were performed to determine the homologous sequences and to identify the conserved sequences among all listed aptamers (data not shown). Accordingly, a conserved motif consisting of UUU nucleotides was identified in almost all sequences isolated against the c-KIT kinase proteins, which might indicate a structurally important motif that can recognize a particular prominent structural epitope in the c-KIT kinase domain. Moreover, the multiple sequence alignment of variable regions indicated the presence of conserved G20G21, U29, and U45 residues at the same position between all listed anti c-KIT

D816H

aptamers. Additionally, three sequences (termed W9/V22,

W16/V28, and W21/V37) were found to occur in different frequencies in both the wild type and mutated c-KIT

D816V

clones. W38 sequence was also identical to H31 anti c-KIT

D816H

clone

sequence. These shared sequences are most probably bound to the same epitopes existed in the kinase domain of the wild type and mutated c-KIT proteins and hence, may recognize regions outside the mutation site. Moreover, shared H5/V36 homologous sequences were found which could bind to dominant regions structurally shared by both c-KIT D816H and c-KIT D816V mutated proteins but, on the other hand, distinguished from that of the WT protein. Interestingly, H5/V36 sequence contains two copies of UUU conserved motif which might further highlights the importance of this motif in recognizing and binding to the c-KIT kinase domain. Noticeably, the multiple sequence alignment indicated that the location of this structural motif in the primary structure of a given aptamer and the type of flanked sequences are not fixed within the anti cKIT aptamer sequences. A unique UUUU motif was identified in three anti c-KIT

D816V

clones

termed as V15. For further analysis, the two predominant aptamers W3 and V5, the shared anti c-KIT

D816H/V

aptamer (H5/V36), and the unique V15 aptamer were chosen to determine their


7


Page 8 of 68

binding affinities and to assess their potential inhibitory effects. These potential candidates are defined in Table (1). Table 1. Candidate anti c-KIT aptamers Clone ID

Sequence of aptamers from 5′ to 3′

Frequency of sequence

Length nt

W3

GGGAUGGAUCCAAGCUUACUGGAGAAUGAGU GUUUACGCAACUGGUGUGUCGUAUGGACGCA AUUCUCGGGAAGCUUCGAUAGGAAUUCGG

50.0%

91

H5/V36

GGGAUGGAUCCAAGCUUACUGGCUUGCGUUU ACAACGAUCCGGAUCAUUGUCGAUUUCUACU UGUGUGGGAAGCUUCGAUAGGAAUUCGG

19.4%

90

V5

GGGAUGGAUCCAAGCUUACUGGCACGGGCUU GGAUGGUGGGAAAGUGUCCAGACGAAGUUCU CCUUUGGGAAGCUUCGAUAGGAAUUCGG

47.4%

90

V15

GGGAUGGAUCCAAGCUUACUGGAUGACUAUA AAGCGUCUGUGAAGUUUUGGGAGGGUCAAGU GAGGUGGGAAGCUUCGAUAGGAAUUCGG

5.1%

90

The nucleotide sequence of candidate aptamers and their frequency in the final selection pool. The underlined nucleotides represent the conserved UUU motif. To further characterize these candidate aptamers, the secondary structures were predicted using Mfold web server program. In fact, a distinguishing feature of aptamers is their ability to form pronounced secondary structure.29 Based on the secondary structures analysis, different conformations among candidate aptamers have been observed as illustrated in Figure (1) which suggests that these candidate sequences may have different binding properties. However, it is important to keep in mind that the best currently available prediction methods can only give a rough model of the secondary structure.30 In addition, the RNA folding does not always occur on the path towards the lowest free energy structure.31 As demonstrated in Figure (1), the H5/V36 anti c-KIT D816H/V aptamer has distinct predicted secondary structure in its free state, composed of trifoliate stem-loop structures that are connected by a multi-way single-stranded junction. Two stem-loop structures are located at the 5′-fixed sequences while the third stem-tri-loop structure


8

Page 9 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


is located at the variable sequences and contained the detected conserved UUU motif. On the other side, long duplex extended from the junction and ended with a bulge-stem-tetra-loop structure located at the variable sequences and contained the consensus nucleotides. This duplex is formed by sequences common to all library members. The predicted secondary structure of W3 anti c-KIT

WT

aptamer contains one terminal stem-loop structure that located at the 5'-,

3'-fixed sequences and two hairpins bi-forked from a common junction located at the variable sequences. Noteworthy, the highly conserved UUU nucleotides arranged in a tetra-loop structure that extended from a characteristic stem-bulge region. Similar secondary structures were predicted for V5 and V15 anti c-KIT D816V aptamers. These structures composed of 5′- interior loop-stem-apical loop structure and 3′-two successive interior loops-stem-apical loop structures connected by single-stranded junction contained a unique solvent-exposed UGGGA motif that located at the same position in both V5 and V15 predicted secondary structures. The observed mismatch pairs in the secondary structure of V15 aptamer (A18●G42 and C19●U41) have been widely found in RNA architectures. As reported, these mismatch pairs can participate in stacking interactions and provide recognition sites.32 Finally, even though the conserved structural UUU motif occurs at different locations within the primary structures of these candidate aptamers, it is obviously arranged at exposed folding structures such as a terminal loop or interior loop in all predicted secondary structures. This finding strongly suggests that UUU conserved nucleotides are the most likely candidates to interact with the protein target. A prevailing view is that solvent exposure of loop nucleotides could play a role in sequence-specific molecular recognition, particularly via “induced-fit” mechanisms that associated with RNA-protein complexes.33


9


Page 10 of 68

Figure 1. Predicted secondary structures of candidate anti c-KIT aptamers. Numbers are nucleotide positions relative to the 5′-end of the RNA sequence. Blue highlights indicate nucleotides of the flanking fixed regions; Red highlights indicate UUU conserved motif among most of the isolated aptamers.


10

Page 11 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


More importantly, Günter Mayer and his colleagues have identified an RNA aptamer, named C13, that targets the kinase domain of human GRK2 receptor.34 The binding of this aptamer competitively inhibits the binding of ATP molecule and potently inactivates the kinase activity of GRK2 enzyme. Crystallographic analysis of GRK2 complexes with C13.18 variant revealed that the key to the mechanism of inhibition is the positioning of the underlined A51 base in the identified active motif 5′-C47CAUACGG55-3′ that projects deep into the active site and occupies the adenine-binding pocket of the kinase domain.35 Intriguingly, this tetra-loop structure (50UACG53) is detected in the proposed secondary structure of our candidate W3 anti c-KIT

WT

aptamer (35UACG38) as part of the conserved UUU containing stem-tetra-loop structure demonstrated in Figure (1). Equally important, the predicted secondary structure of H5/V36 anti c-KIT

D816H/V

aptamer clarifies the presence of two homologous motifs that exist in the same

consensus UUU containing stem-loop structures which are 5′-28GUUUACAAC36-3′ and 5′-54AUUUCUACUUG64-3′. Most probably, the first motif is the active one because, as illustrated in the proposed secondary structure, the UAC nucleotides in this motif are unpaired in the predicted tri-loop domain. In line with this finding, the structural properties of W3 and H5/V36 aptamers could be consistent with their binding to the same general region of the protein. Indeed, the existence of the ATP-mimicking motif of C13 in our aptamers may pave the way towards the development of other specific aptamers. In the same context, Coulson, et al. (1996) identified by serendipity a 15-mer phosphorothioate (PS) aptamer that significantly reduces the auto-phosphorylation and hence, inhibits the tyrosine kinase activity of the EGFRs highly expressed on A431 cells.36 Site directed mutational study revealed that the 5′-terminal GGAGGG hexamer sequence in this aptamer was essential for the anti-tyrosine kinase activity in A431 cells.37 Sequence analysis of our selected aptamers curiously revealed that this hexamer


11


motif is present in the variable region of our V15 anti c-KIT 51GGAGGG56-3′.

Page 12 of 68

D816V

candidate aptamer 5′-

Noticeably, this hexamer motif is repeated twice in the variable region of our

examined H30 anti c-KIT

D816H

selected aptamer (see Table S2). On the other hand, the

structural analysis of V5 aptamer revealed that it has two repeated GGC motifs that were previously identified in the ODN1 aptamer described by Bergan et al. (1994). As indicated in this study, ODN1 aptamer shows high specificity as it potently inhibits the kinase activity of p210bcr-abl PTK and, to a lesser extent, the PDGF receptor.38 In the same approach, only one quadruplex structure is predicted in our V5 anti c-KIT

D816V

aptamer. It has been shown that G-

rich oligodeoxynucleotides, especially those forming G-quadruplex structures, are known to bind and/or interfere with the functions of DNA polymerases and transcription factors.37 However, the binding specificity between quadruplexes and binding proteins will be affected by the loops and the surrounding sequences.39 In summary, hence aptamers that inhibit the kinase activity might employ versatile motifs for kinase recognition and specificity, elucidating these motifs will not only clarify the aptamers mode of action but, may also reveal new unresolved inhibitory entities that may serve as scaffolds for the identification of novel kinase inhibitors. In vitro characterization of candidate aptamers Qualitative assessment of aptamer-kinase interaction using EMSA. Polyacrylamide gel electrophoresis (PAGE) under native conditions is a well-established and versatile method for probing nucleic acid conformation and nucleic acid–protein interactions.40 Commonly in EMSA, the binding is detected through the appearance of one or more protein–nucleic acid complexes and a corresponding reduction of the intensity of the free nucleic acid band.41 Accordingly and as shown in the EMSA results, Figures 2, it is clear at the first glance that the addition of our candidate aptamers to a given c-KIT kinase target, under the in vitro binding conditions, results


12

Page 13 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in an observed reduction in the intensity of unbound aptamers in a concentration dependent manner. Luckily, a characteristic discrete stable band with decreased gel mobility was also detected with the mutant forms of c-KIT protein as demonstrated in Figures 2 which represents the corresponding bound aptamer when compared with the free aptamer. On the other hand, the retardation pattern in the c-KIT

WT

is not exactly as predicted and the exact location of the

resulting complex was not detected. Nevertheless, the EMSA results can still point out clearly whether a given candidate aptamer is interacting with the c-KIT

WT

or not. Additionally, the

observed faint RNA smear in Figure 2 (wells 1 and 2) that appears between the wells and unbound RNA aptamers could indeed represent a newly released RNA from the RNA-c-KIT WT complex which occurs as a result of the dissociation of the complex during gel running.42 This supports our conclusion that the resulting RNA-c-KIT WT complex is most likely retarded in the gel wells. As a negative control, we used the chemically modified RNA transcript of our previously published anti-EpCAM DNA aptamer (Ep-1) which shares the same length and the same fixed regions.43 By comparing the EMSA results of our candidate aptamers with the negative control, clearly, no specific interaction was detected between the negative sequence and the target proteins as demonstrated by the absence of the characteristic shifted band and the uniformed un-effected intensity of the migrated RNA band when compared with the free RNA. In addition, the migratory manner of RNA negative sequence is almost the same regardless the presence or absence of different ratios and even types of a given c-KIT protein. The observed smear that extends from a given well till the detected RNA band could reflect a sort of nonspecific, weak, and random interactions that can be predicted between protein and any nucleic acid.


13


Page 14 of 68

Figure 2. EMSA of the selected aptamers with the c-KIT kinases using different aptamer:protein mixture ratios. (1) 2:1 ratio; (2) 1:1 ratio; (3) 0.5:1 ratio; (4) 0.25:1 ratio; (F) Free aptamer, 1:0 ratio; (U) Un-bound aptamer; (B) Bound aptamer, (NS) negative sequence, and (Wt.) Free wild type protein, (Mut.V) Free Mutant c-KIT D816V protein, (Mut.H) Free Mutant cKIT D816H protein, 400 nM


14

Page 15 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In view of that, our optimized EMSA method was succeeded in studying the interaction between the c-KIT protein targets and the candidate aptamers even, in assessing the characteristic conformation of each aptamer. Indeed, the two observed distinct bands, corresponding to the aptamer-protein complex and the unbound aptamer, reflect a strong interaction between the target protein and a given aptamer with an association constant value (ka) larger than the dissociation constant (kd).42 However, these results reflect a rough qualitative estimate of the binding affinity of each aptamer to a given protein target. A good rule of thumb is that equilibrium dissociation constant values greater than 1–3 μM cannot accurately be determined by a standard gel mobility shift assay.44 The binding affinity of candidate aptamers. In order to use aptamers in research and clinical applications, a thorough understanding of aptamer-target binding is necessary. In our experiment, the equilibrium dissociation constant (KD) was used to quantitatively evaluate the c‐KIT binding affinity of our candidate aptamers. As indicated in Figure (3) and summarized in Table (2), apparently, all aptamers show relatively compatible binding affinities toward the tested kinases with dissociation constant values in the nanomolar range. When we considered the measured apparent affinities of each candidate aptamer toward all tested kinases, we found that aptamer V5 binds to mutant c-KIT D816V kinase with KD app value that is approximately two times lower than the c-KIT WT and mutant c-KIT D816H kinases. Noteworthy, the sequence of V5 aptamer appeared only with the mutant c-KIT

D816V

during the SELEX experiment and showed the highest

frequency compared to other anti c-KIT D816V aptamers. These results are in full agreement with the widely-held view that the dominant sequence prevailed in the final pool of SELEX experiment is the ones with the highest target affinity.23,24 Indeed, the difference in affinities between c-KIT

D816V

and c-KIT

WT

kinases observed with using V5 aptamer indicates that it


15


Page 16 of 68

derives part of its binding energy from epitopes specific to the mutated D816V activation loop domain. Most probably, D816 site might be located at the center of the epitope or the epitope itself might surround the D816 residue. Likewise, aptamer H5/V36, which was only detected with both mutant proteins during the SELEX, shows similar higher binding affinities toward the mutant (c-KIT

D816H

and c-KIT

D816V)

kinases compared to the wild type c-KIT kinase. This

result may suggest that H5/V36 aptamer has the ability to bind to common regions structurally shared by both mutated proteins and distinguished from that of the wild type kinase. In contrary, W3 anti c-KIT WT aptamer, despite being the most abundant sequence, did not exhibit the highest binding affinity to the wild type c-KIT kinase compared to the mutant forms. Most notably, many studies reported that the examined selected aptamers with the highest copy number in the final SELEX pool were not necessarily the tightest binder.

25,45,46

Consistent with these reports,

our data demonstrated that the multiplicity of our candidate aptamers did not always correlate with the determined KD values. Table 2. The apparent dissociation constant (KD app) values for candidate aptamers c-KIT Kinases

c-KIT WT

c-KIT D816V

c-KIT D816H

H5/V36

W3

V15

V5

KD app

KD app

KD app

KD app

±SEM

±SEM

±SEM

±SEM

61.2

41.2

40.1

57.1

±8.27

±2.4

±6.9

±4.9

42.2

29.0

45.4

30.1

±5.7

±5.46

±5.4

±1.7

46.0

32.6

31.5

55.1

±7.06

±5.6

±6.4

±17.4

Results represent the mean of three independent experiments (± SEM).


16

Page 17 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In another aspect, the binding curves of all our candidate aptamers suggest that the binding does not fit a 1:1 binding model. Indeed, the presence of obvious steep Hill slopes (h >>1) complicate the interpretation of our binding results. Early in 1994, Jellinek and collaborators observed similar binding pattern with their high affinity RNA aptamers selected against the VEGF.47 They speculated that this type of binding could be explained using a model of which a given RNA aptamer represents assemblies of at least two conformationally related species that bind to their target with different affinities.47 Noticeably, in our EMSA results (Figures 2) we observed that V5 and H5/V36 aptamers have three characteristic migratory bands (one major and two minor bands). Therefore, these results more likely represent conformationally distinct species of an RNA aptamer that, as they postulated, may exhibit different binding affinities toward a given target. Additionally, it was suggested that generally, the steep Hill slope may indicate that the inhibitor is forming aggregates in the aqueous solution.48 Such suggestion seems plausible based on the published data that RNA aptamers can form dimers and higher order of aggregates.47 In another perspective, it was documented that tight-binding inhibitors also display steep Hill slopes due to the fact that they are titrating the target protein.48 Additionally, this characteristic sigmoidal binding curve was observed in several studies employed filter binding assays to determine the binding affinities of their selected aptamers. Such as the binding curve of K61 aptamer selected against cytohesin-1 and 2,49 the binding curves of the selected aptamers 12.01 and M302 that recognize the drug-resistant HIV-1 reverse transcriptase,50 and many others.51,52,53


17


Page 18 of 68

Figure 3: Binding curves of candidate aptamers to c-KIT kinases. The data was fitted to one site specific binding with Hill slope using nonlinear regression analysis, Graphpad prism 6 software. Each data point represents the mean of three independent experiments ± SD. The most prevailing view implies that the sigmoidal binding curve is considered an evidence for positive cooperativity in the binding reaction. This means that the binding of one aptamer molecule to a given target influences the affinity of subsequent aptamers to the same target.54 In the same approach, Ozer and White proposed a model of density-dependent cooperative (DDC) binding which relates the cooperative binding to both the target concentration and the target surface density on the immobilizing substrate.55 According to this model, the target immobilization might increase the surface density of target molecules to the point where one ligand could concurrently interact non-specifically with multiple targets. The latter explanation


18

Page 19 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


seems more plausible to explain the cooperative binding effects observed in the binding curves of our candidate aptamers. The inhibitory potency of candidate aptamers on the activity of recombinant c-KIT kinases. Standard analyses of enzyme kinetics generally preferred to read the reaction at the initial linear phase of the enzymatic reaction when 10% or less of the substrate has been depleted which represents the first requirement for steady state conditions.56 Under our experimental conditions, the reaction progress curves (data not shown) revealed that the period of time over which the product concentration increases linearly is 30 minutes, after that the enzyme progression is decreased. This time interval represents the initial velocity period for all tested kinases. It is also important to ascertain that the enzyme concentration chosen should result in a low ATP to ADP conversion percentage to maintain proper kinetics for the enzyme reaction.57 Thus, 75 ng of c-KIT

WT,

10 ng of mutant c-KIT

D816H

kinase, and 6 ng of mutant c-KIT D816V

kinase were used per reaction to maintain the initial velocity conditions over the 30 minutes reaction time. Additionally, our enzymatic screen is designed to run under pseudo-first order kinetics by running the assay under conditions where poly (Glu:Tyr) peptide substrate is set at the saturation level (200 µg/ml), well above its predetermined apparent Km value (Kmapp) (Figure S1). The Kmapp value for the synthetic poly (Glu:Tyr) peptide was estimated to be 6 µg/ml and to our knowledge, it is reported here for the first time. The second substrate (ATP) is set at its measured Kmapp value for the c-KIT

WT

kinase and above the measured Kmapp values for the c-

KIT D816H and c-KIT D816V kinases (Figure S2). The Kmapp values for ATP were estimated for the three active c-KIT kinases which are 51.1 µM for c-KIT D816H,

and 26.4 µM for mutant c-KIT

D816V

WT

kinase, 20.6 µM for mutant c-KIT

kinases as indicated in Figure S2. These values are

close to the Km values documented in the literature which are 42.5 µM, 22 µM and 17 µM for the


19


active c-KIT

WT,

c-KIT

D816H

and, c-KIT

D816V

Page 20 of 68

recombinant kinases, respectively.58 Finally, the

IC50 values were determined using the antagonist dose-response curve and the aptamer concentration that provokes a response halfway between the baseline and maximum response is the IC50 value. Our data demonstrate that H5/V36 aptamer stood out as the most effective aptamer that inhibits over 82% of c-KIT WT phosphotransferase activity, in vitro, at a concentration of 10 μM with an estimated IC50 value of 867.1 nM (Figure 4-A). Whereas, V15 aptamer showed almost two and a half times lower potency, compared to H5/V36 aptamer, with an estimated IC50 value of 2.18 μM. Similar inhibition approach was observed toward the c-KIT D816H kinase activity. As shown in Table 3, the measured IC50 values of H5/V36 and V15 aptamers are 635.7 nM and 1,651 µM, respectively. In order to test the in vitro effect of our candidate aptamers on the mutant c-KIT

D816V

kinase, we analyzed the enzymatic activity at different aptamer

concentrations. As anticipated in Figure 4-C, the kinase activity of D816V A-loop mutant is markedly inhibited in dose-dependent manner by pre-incubation of the kinase with V15 aptamer with an IC50 value equals 134.2 nM. We observed striking differences in the response of V15 aptamer toward the A-loop mutants and the c-KIT kinase with a wild type catalytic domain. The c-KIT kinase activity of the A-loop mutant D816V was, on average, 16-fold more sensitive to inhibition by V15 than the wild type c-KIT and 12-fold more than the mutant D816H. These data demonstrate that this aptamer doses not only potently inhibit the kinase activity of the mutant cKIT D816V kinase, but also it shows significant differential specificity between the wild type and mutated c-KIT kinases and even between the two A-loop mutants. Indeed, the weak activity of V15 aptamer against c-KIT

WT

kinase is pointing to a potential safety margin for inhibiting

mutant c-KIT over the endogenous c-KIT

WT

signaling and other members of class III RTKs.


20

Page 21 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Additionally, V15 aptamer was 9 fold more potent than the sunitinib drug; the FDA approved multi-targeted RTK inhibitor when it was tested under the same experimental conditions (Figure 4-D). For H5/V36 aptamer, Figure 4-A indicates that the enzymatic activity was reduced to 50% at an aptamer concentration of 2.6 µM. The most abundant V5 aptamer showed reduced effect on the mutated c-KIT

D816V

kinase with only partial inhibition being observed through the highest

concentration of aptamer used as indicated in Figure 4-D. Sequences analysis demonstrated that V5 and V15 anti c-KIT

D816V

aptamers have homologous conserved motif 5′-UGGGA-3′ that

located at the same characterized interior junctional loop in the predicted secondary structures (Figure 1). It is interesting to note that V15 aptamer has evolved additional 5′-UUU-3′ nucleotides that preceding this examined motif. Such finding could provide a possible interpretation for the markedly different potencies of V5 and V15 aptamers against the c-KIT D816V

kinase. Finally, W3 aptamer showed low or no biochemical detectable effect on all tested

c-KIT kinases. It should be mentioned that some aptamers do not affect the known functions of their target proteins. A research group from Ellington’s laboratory reported HIV-1 RT (Drugresistant variants of HIV-1 reverse transcriptase) binding aptamers which did not exhibit detectable inhibition of either the polymerase or RNase activities of the protein.50 However, few studies report such ‘inactive aptamers’ since it is usually the inhibitory aptamers which are chosen for further characterization.26 In the end, the presence of “promiscuous” inhibitors or “aggregating” compounds in a chemical library has become a recent area of research. These compounds can cause false positives that can be frequently recognized by steep concentration response curves. The exact mechanism of these false positives is not known but it is possible that these compounds induce the formation of compound-enzyme clusters, which reduce the enzyme activity.56 Our data revealed that the same non-specific behavior has been observed at the highest


21


Page 22 of 68

concentration (10 µM) of some aptamers and even the negative sequence as depicted in Figure (4-B, F). As we previously mentioned, it was reported that RNA aptamers can actually form dimers and higher order of aggregates at the higher concentrations.47 Table 3. The measured IC50 (nM) values of candidate aptamers against different c-KIT kinases. Aptamer

c-KIT WT kinase c-KIT D816H kinase c-KIT D816V kinase

W3 Aptamer

No inhibition

*Ambiguous

*Ambiguous

V5 Aptamer

No inhibition

*Ambiguous

> 5,000

V15 Aptamer

2,187

1,651

134.2

H5/V36 Aptamer

867.1

635.7

2,624

Negative sequence

> 10,000

*Ambiguous

>10,000

234.0

1,111

1,226

Sunitinib

*Ambiguous: means that GraphPad Prism was unable to find a unique fit to these data.

Identifying the modes of c-KIT kinase inhibition. According to the results described above, V15 and H5/V36 aptamers can inhibit the phosphotransferase activities of our tested kinases. Therefore, their modes of action (MOAs) were examined by measuring the velocity of a given tested kinase (in RLU/minute) as a function of ATP concentrations under two fixed concentrations of these aptamers. As shown in Figure (5-A), H5/V36 aptamer has resulted in a decrease of the apparent affinity of c-KIT WT kinase to its ATP substrate (Kmapp values increase), which is as expected by a competitive mechanism of inhibition.


22

Page 23 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Antagonist inhibition curves of candidate aptamers against all tested c-KIT kinases. Each data point represents the average percentage of inhibition from two independent experiments performed in triplicate. Error bars depict the standard deviation of the mean. Maximum enzyme activity control sample (0% inhibition) contains all the kinase reaction components except the aptamer. For sunitinib, the final DMSO concentration was 1.5 %. Data fitting was performed using the three-parameter dose-response equation, GraphPad Prism 6 software.


23


Page 24 of 68

In addition, the pattern of straight lines with intersecting Y-axis intercepts observed in the Lineweaver–Burk plot Figure (5-B) represents the characteristic signature of a competitive inhibitor as they do not affect the apparent value of Vmax. The apparent dissociation constant (Ki) value for a competitive inhibitor can be calculated using the Cheng and Prusoff equation.59 Accordingly, the calculated Ki value of aptamer H5/V36 for the wild type c-KIT is 490.1 nM. As we detailed in previous section, the identified ATP-mimicking motif 50UACG53 was detected in the proposed secondary structure of our candidate H5/V36 (31UACA34) and W3 (35UACG38) aptamers.35 This finding is interesting, because it is presumed that H5/V36 aptamer is most likely adopted the same mechanism of action and the A32 base located at the terminal tri-loop structure could extend into the active site of the wild type c-KIT kinase and competitively block ATP binding. Moreover, in an excellent agreement with the previously reported data,34 W3 anti c-KIT WT

aptamer, which has the same tetraloop active motif (35UACG38) as C13 aptamer, showed no

apparent inhibitory effect on the phosphotransferase activity of the c-KIT

WT

enzyme when it

was tested under the same experimental conditions (Figure 4-B). The first facile explanation for this apparent discrepancy in the inhibitory effects between H5/V36 and W3 aptamers is that A34:U30 Watson-Crick base pair in H5/V36 (Figure 1) replaces the G38:U33 Wobble base pair in the stem region of the active hairpin structure in W3 aptamer which may affect the overall aptamer conformation, stability, and binding. This combined with the fact that G38 has an additional free functional carbonyl group which can be involved in hydrogen bond interactions with the kinase surface. Additionally, we cannot rule out that both aptamers have other distinct secondary sub-structures that render them to exhibit a unique pattern of interactions with the kinase domain and these are the key determinants of the aptamer functionality.


24

Page 25 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. The modes of action (MOAs) of aptamer "H5/V36" against tested kinases. Panels A, C, and E: Enzyme activity was determined at various ATP concentrations in the presence or absence of the aptamer. Each data point represents the average enzyme activity at each ATP concentration obtained from two independent experiments performed in triplicates. Panels B, D, and F: The Lineweaver-Burk plot of data by using the apparent Km and the apparent Vmax values obtained for each inhibitor concentration. The x-axis values represent (1/Km) and the Y-axis values represent (1/Vmax)(1+Km/[ATP minimum]). All data analyses were conducted using GraphPad Prism 6 Software.


25


Page 26 of 68

On the basis of this approach, H5/V36 aptamer could belong to type I kinase inhibitors that target the active form of c-KIT

WT

kinase characterized by an open conformation of the A-loop

and referred to as “DFG in” conformation.60 In a complementary fashion, due to the conserved nature of the ATP-binding domain among protein kinases, the selectivity of H5/V36 aptamer has been verified against other kinases. This is necessary in order to assess that it does not inhibit other non-target kinases, resulting in undesirable adverse effects. As clearly demonstrated in the selectivity assay (Figure 6), H5/V36 aptamer showed high selectivity against the tested kinases belonging to the same subfamily (as with PDGFRβ kinase) or to another kinase family (JNK3 kinase) despite its presumed interaction with the ATP binding site. This finding is consistent with the high selectivity profile reported for the anti-GRK2 aptamer against a panel of kinases belonging to distinct kinase groups.34 However, an important point to bear in mind is that a given mode of inhibition does not necessarily tell us where on the enzyme surface an aptamer can bind. Indeed, all we know from the kinetic data is that H5/V36 aptamer binds to the free c-KIT

WT

enzyme and blocks the ATP binding. It is also possible for the aptamer to bind at a distinct site that is distal from the substrate binding site and to induce a conformational change that closes down the active site so that substrate can no longer bind. In case of D816H mutant, H5/V36 aptamer apparently inhibits the enzymatic reaction without affecting the affinity towards the ATP substrate as demonstrated in Figure (5-C). The figure clarifies that the binding of H5/V36 aptamer lead to a decrease in Vmax value without affecting the apparent Km value for the ATP substrate. Accordingly, H5/V36 aptamer apparently inhibits the activity of mutant c-KIT

D816H

kinase in a purely non-competitive manner with respect to ATP substrate. The apparent dissociation constant (Ki value) of non-competitive inhibitor equals to its observed IC50 value according to Cheng and Prusoff equation.61


26

Page 27 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Antagonist inhibition curves of Aptamer "H5/V36" against both PDGFRβ and JNK3 kinases. Panel A: Data fitting was performed using the three-parameter dose-response equation, GraphPad Prism 6 software; each data point represents the average percentage of inhibition from two independent experiments performed in triplicate. Error bars depict standard deviation of the mean. Panel B: Average inhibition percentages of aptamer H5/V36 against all tested kinases at 5 µM final concentration. Data obtained from IC50 experiments. So, the Ki value of H5/V36 aptamer with mutant c-KIT D816H kinase equals 635.7 nM. On the other hand, the same assay was performed with V15 aptamer and indicated that the presence of V15 decreases both the apparent affinity of c-KIT

D816H

kinase for the ATP substrate (Kmapp

values increase) and the reaction velocity as demonstrated in Figure (7-A). This finding is in agreement with the mixed mechanism of inhibition.59 The same mixed type of inhibition was observed with mutant c-KIT D816V enzyme in the presence of both V15 and H5/V36 aptamers as shown in Figures 5-E and 7-C. According to this type of inhibition, the aptamer binds with unequal affinity to both free enzyme and the enzyme-ATP complex. The pattern of the straight lines in the Lineweaver–Burk plots and the position of the intersection points above the x-axis


27


Page 28 of 68

and left to the y-axis indicate that both aptamers bind to the free enzyme with less affinity than enzyme-ATP complex.59 In summary, H5/V36 aptamer can functionally distinguish between the c-KIT and c-KIT

D816V

WT,

c-KIT D816H

kinases by modulating the phosphorylation activity of each in a distinct

mechanism of action and in different potency. Structurally, the D816 residue is located at the Aloop of the c-KIT kinase domain and hence substituting the acidic aspartic acid residue with Valine or Histidine can eliminate a negative charge from the loop region.14 Moreover, the conformational conversion of the kinase domain from inactive DFG-out to active DFG-in conformation pushes the D816 approaching to the negatively charged D572, thus causing an electrostatic repulsion between them.14 Thus, in the light of these observations, the most likely explanation is that D816 missense mutations induced conformational changes that may cause structural distortion and direct effects on aptamer binding such as steric or electrostatic hindrance that could occlude the entrance to the catalytic site and hence, may impede the aptamer’s active motif from extending deep in the active site and competitively hindering the ATP binding. Nevertheless, the aptamer still can bind to the adjacent or distant sites and affects the enzyme activity with lower potency in an ATP non-competitive manner. Basically, the binding events of noncompetitive inhibitors occur exclusively at a site distinct from the precise active site occupied by the substrate.62 Taken together, H5/V36 aptamer could most likely belong to the type V bivalent kinase inhibitors which targeting two sites on the protein kinase surface including the catalytic site and another distinct allosteric site on the c-KIT kinase domain that remote from the ATP binding pocket.63 Thus, H5/V36 aptamer may perturb the kinase activity of c-KIT kinase by mediating both orthosteric and allosteric effects. Indeed, the preparation of bivalent inhibitors serves as a strategy to increase potency and selectivity and has been applied to several kinases.64


28

Page 29 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In the same approach, H5/V36 aptamer could also be considered as type V bi-substrate inhibitor that competitively targets the ATP binding site and non-competitively targets the peptide substrate binding site. It is worth to mention here that we found a DNA sequence (called V10) almost similar to the H5/V36 RNA aptamer when we examined the sequences of DNA aptamers that were previously selected by our laboratory colleagues, independently, against the c-KIT D816V

kinase using the SELEX technique (un-published data).

In another aspect, the inhibition curves shown in Figure 4-C demonstrate that V15 aptamer exhibits potent inhibition against c-KIT D816V kinase activity, mild inhibition against c-KIT D816H kinase activity, and weak potency against the wild type c-KIT kinase phosphotransferase activity. Our results indicated that V15 aptamer has an unequal affinity for both free enzymes (cKIT D816H and c-KIT D816V) and the enzyme-ATP complex (Figure 7). Accordingly, we suppose that V15 aptamer is an allosteric inhibitor that decreases the kinase activity by binding to an allosteric site other than the active site on the target kinase. It remains unclear how the binding of V15 aptamer to this site inhibits the kinase activity. One possibility is that V15 binding could induce a conformational change in the target enzyme that can affect the formation of the usual enzyme-substrate complex and hence modulate the kinase activity.62 Currently, the literature describing RNA aptamers affecting the activities of proteins by an allosteric regulation remains limited and hence, a clear demonstration of the allosteric regulation of protein function by an RNA aptamer would be of high interest.26 Another possible scenario is that V15 aptamer could bind to an allosteric site in close proximity to the catalytic domain, thereby allowing for steric interference with the access of substrates to the catalytic site. Indeed, the shape and the considerable large size of our nucleotide aptamer (~29 kDa) relative to the c-KIT kinase domain (~73 kDa) are most likely able to produce an extensive shielding of protein surfaces and long


29


Page 30 of 68

range steric interference with the binding events even at sites distant from the identified aptamer binding region.

Figure (7): The mode of action (MOA) of Aptamer "V15" against mutated c-KIT D816V and c-KIT

D816H

kinases. Panels A and C: Enzyme activity was determined at various ATP

concentrations in the presence or absence of the aptamer. Each data point represents the average enzyme activity at each ATP concentration obtained from two independent experiments performed in triplicates. Panels B and D: The Lineweaver-Burk plot of data by using the apparent Km and apparent Vmax values obtained for each inhibitor concentration. The x-axis values represent (-1/Km) and the Y-axis values represent (1/Vmax)(1+Km/[ATP minimum]). All data analyses were conducted using GraphPad Prism 6 Software.


30

Page 31 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


This effect was suggested to be caused by either the large electro-negativity of the aptamer or the steric hindrance of access to a key contact surface.24,26 It is worth pointing out that the identified occluded allosteric pocket in the active conformation of kinases could be exposed in the oncogenic mutants which may explain the significant specificity of V15 aptamer toward the A-loop activating mutants65. Our data, on the other hand, were in contrary to a study demonstrated that 5′GGAGGG3′ hexamer motif is essential for the anti-EGFR tyrosine kinase activity expressed in the A431 epidermoid cancer cells.37 Our findings revealed that this motif was not related to the potent inhibitory activity of V15 aptamer as this hexamer motif is repeated twice in the variable region of our selected H30 anti c-KIT

D816H

aptamer that was used as a

control in the in vitro kinase assays (Figure S3). As anticipated, H30 aptamer shows mild inhibitory potencies of no more than 50% even at the highest concentration used. Taken as a whole, there is a clear need to better define the detailed molecular and structural characterization of the binding motif of V15 aptamer on the mutant c-KIT

D816V

kinase which will provide the

means for the development of highly specific anticancer ligands targeting the D816V activating loop mutation in the c-KIT kinase. Indeed, our results provide a proof-of-concept example in isolating specific and functional RNA aptamers against protein targets with a single amino acid mutation. To the best of our knowledge, only two aptamers have been previously characterized in the literatures that can distinguish a mutant protein with a single amino acid substitution from the wild type protein.66,67 Aptamer stability in human serum. Serum stability of RNA aptamers is limited by the endonuclease cleavage. Generally, aptamer stability is directly related to the structure and chemical composition of their molecules. For example, it is expected that tightly folded


31


Page 32 of 68

molecules are more resistant to degradation by nucleases because of limited solvent exposure. In serum, the reported half-lives for 2′-hydroxy (RNA) nucleic acids are in the order of seconds.68 To determine the stability of H5/V36 aptamer, the RNA aptamer was incubated in fresh human serum (total 80 % human serum) for a total of 4 days at 37° C. Then, serum-RNA samples at the indicated time-points were resolved on a 3% agarose gel electrophoresis (Figure 8). The results clearly demonstrate that our synthesized aptamer was stable for up to 4 days in fresh human serum, indicating that 2′-fluoro-ribose modification is able to provide resistance against nucleases for further use in therapeutic applications.

Figure 8. The stability of modified H5/V36 RNA aptamers against serum nucleases. Aptamer was incubated with fresh human serum for up to 96 hours at 37º C and visualized using 3% agarose gel electrophoresis. The inhibitory effect of aptamers on the viability of H526 SCLC cells. Human Small Cell Lung Cancer (SCLC) is an aggressive disease representing approximately 20% of lung cancers. The molecular abnormalities underlying SCLC are not well understood.69 One feature of SCLC is coexpression of the c-KIT RTK with its ligand stem cell factor (SCF). At least 70% of SCLC tumors and tumor derived cell lines co-express the genes for SCF and c-KIT RTK.70 The expression of wild type c-KIT receptors in NCI-H526 human SCLC cell line was previously confirmed by Krystal, et al. (2000).71 Upon stimulation with rhSCF, the c-KIT


32

Page 33 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


tyrosine kinase undergoes a rapid increase in its degree of tyrosine phosphorylation.70 Several studies have demonstrated that the activation of c-KIT can lead to enhanced proliferation, inhibition of apoptosis, and enhanced motility of SCLC cells.72 To examine the inhibitory effect of our candidate aptamers on the receptor activity, H526 cells were made quiescent by overnight incubation in serum-free medium then the cells were incubated with 200 nM of each aptamer in complex with lipofectamine (Invitrogen, USA) or with lipofectamine vehicle alone for 6 hours followed by the addition of rhSCF growth factor or serum-containing medium. The cellular metabolism was assessed over a period of 72 hours by using the MTT (Promega, USA) colorimetric dye reduction method.73 It was reported that MTT assay correlates very well with viable SCLC cell number under the conditions used.70,74 Our data demonstrated that after three days, the W3 and H5/V36 aptamers have significantly decreased the metabolic activity and so, the viability of H526 treated cells stimulated by rhSCF, as the only exogenous growth factor, compared to cells treated with the negative sequence control. As anticipated, the metabolic activity was reduced of about 60% by comparison with cells mock treated or treated with the negative sequence (NS) (Figure 9-A). No effect was observed in the presence of V5 and V15 aptamers. However, to be clinically relevant, inhibition of the metabolic activity should extend to the cellular activity in the presence of a complex mix of growth factors found in the serum. As illustrated in Figure (9-B), the inhibitory effect was statistically significant in serum-containing medium when cells were treated with W3, H5/V36 and V5 aptamers for three days. The inhibition potency was also no more than 40 % at 200 nM final aptamer concentration whereas no effect was observed in the presence of the NS and V15 aptamer. This moderate inhibition potency could be probably consistent with the previously published findings showing that the growth of SCLC cells in serum-free medium was only


33


Page 34 of 68

slightly increased upon SCF stimulation and the H526 has a very low level of basal PI3K-Akt activation.72,75,76 In contrary, it was reported that sunitinib (SU11248) potently inhibits the SCFdependent proliferation of H526 cells in vitro after 72 hours. But, its potency was reduced dramatically in the presence of complete serum.69 Indeed, the ability of H5/V36 aptamer to inhibit the metabolic activity of H526 SCLC cells is expected as these cells showed high expression of wild type c-KIT protein which is potently inhibited by H5/V36 aptamer as revealed from our in vitro cell-free biochemical kinase assay. Among the main intracellular effectors of c-KIT that mediate the induction of cell growth and resistance to apoptosis are the extracellular-signal regulated kinase 1/2 (ERK1/2) and AKT. Thus, a good correlation can be mediated between the ability of H5/V36 aptamer to competitively bind the ATP binding pocket and its ability to inhibit receptor activation and hence subsequent signaling pathways that promote cell growth. Unexpectedly, W3 aptamer also shows significant inhibition in the metabolic activity of rhSCF and FBS stimulated cells. A plausible explanation for this unexpected result is that W3 aptamer may bind to the ATP binding pocket through the identified active motif only when the c-KIT WT kinase domain is in the inactive un-phosphorylated conformation. Subsequently, activation by the growth factors induces conformational changes in the kinase domain that could result in the disappearance of the epitope for W3 aptamer binding. Noteworthy, similar approach was reported for type II kinase inhibitors, such as imatinib (STI-571), that binds to the ATP binding pocket as well as the adjacent hydrophobic pocket created by the DFG-out inactive conformation. This pocket, referred to as the allosteric binding site, is not present in the activated kinase.77 Therefore, such inhibitors often show greatly enhanced potency in cell-based assays in which the kinase is in the non-activated form before stimulation, rather than in the biochemical


34

Page 35 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


assays in which highly activated (phosphorylated) kinases are used.78 To our surprise, V5 aptamer strongly inhibits the viability of H526 cells that is reduced to about 60% by comparison with cells treated with the negative sequence.

Figure 9. Cell viability assays. Cell viability was assessed using MTT assay. NCI-H526 (3,0000 cells cells/well in 96-well plates) cells were mock treated or treated with 200 nM final concentration of each candidate aptamer in complex with lipofectamine for 6 hours and then stimulated with A. rhSCF (100 ng/mL) or with B. 5% FBS for 72 hours. The cell viability was expressed as percent of metabolically active cells present after treatment with respect to untreated cells containing only the vehicle. The results from two independent experiments are shown. Data points represent the mean of eight replicates ± SD. P values were determined using two-tailed Student’s t test.*P < 0.05 and **P < 0.01 were regarded as statistically significant when compared with the negative sequence control.


35


Page 36 of 68

This inhibitory effect was only observed when the cells were stimulated with 5% serum but not with SCF as the sole exogenous growth factor. A similar observation was reported by Bergan, et al. (1995), in this study they identified 21-mer oligodeoxynucleotide 1 (ODN1; also called BCRAS) that can inhibit p210bcr-abl kinase activity in a sequence-specific manner that depends on repeated GGC motifs. Using K562 chronic myelogenous leukemia-derived cell line, they showed that additional ODN (termed BCR-SCR) that did not inhibit p210bcr-abl kinase in vitro still appeared to alter the cell kinase activity.79 We postulate that V5 aptamer most likely inhibits specific downstream effectors that are only activated and/or sustained active by the complex growth factors existing in the serum. Moreover, it is worth pointing out that the time course of Akt activation in H526 SCLC is growth factor dependent. As demonstrated, the rhSCF induced Akt phosphorylation that peaked at 5 to 10 minutes, then began fading between 15 to 30 minutes and returned back to baseline by 60 minutes after stimulation. The kinetics of 10% FCSmediated activation of Akt phosphorylation was delayed and could be barely detected prior to 30 minutes, peaked at 1 hour after stimulation and markedly prolonged for at least 6 hours after FCS stimulation.72 Interestingly, mass spectra analysis for the fully activated form of the wild type cKIT kinase revealed that the A-loop tyrosine (Y823) is not phosphorylated until very late in the activation reaction (>90% completion), indicating that the A-loop phosphorylation is not required for c-KIT activation and for the kinase activity.13 On the basis of these findings, it reasonable to speculate that one possible interpretation of disparate differences between the biochemical and cellular assays is that our candidate V5 aptamer could bind to a characteristic epitope around or near Y823 in the activation loop domain. In an excellent agreement with our data anticipated from the in vitro biochemical kinase assays, it was reported that the kinase activity of the wild type c-KIT and mutated c-KIT

D816V

kinase are unaffected by the Y823F


36

Page 37 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mutation. As illustrated, the Y823 is not involved in the regulation of the kinase activity of both wild type and D816V mutated c-KIT kinase.80,81 Such data could provide a reasonable explanation of the un-detected inhibition of our tested c-KIT kinases in the biochemical kinase activity when incubated with V5 aptamer (Figure 4-D). On the other hand, at the cellular level, the role of the activation loop tyrosine Y823 in the c-KIT kinase is related to the downstream signaling rather than the kinase activity. As elucidated, the Ba/F3 cell expressing the Y823F mutant of c-KIT showed almost a 60% reduction in cell survival compared with cells expressing the wild type c-KIT.80 So, the observed reduction in the H526 cell viability is likely to be attributed to a potential functional effect of V5 aptamer binding to the A-loop in a way that blocking the Y823 residue and hence affects the subsequent downstream signaling pathways related to cell viability and probably to the cell migration. As proposed by Agarwal, et al. (2013), the Y823 in the c-KIT kinase appears to be a good target for cancer therapy. Thus, a therapy targeting Y823 so that its phosphorylation is prevented, presumably by an aptamer, could in combination with chemotherapy, provide an improved treatment option for tumors caused by cKIT mutations80. Finally, under our experimental conditions, no apparent inhibitory effect was observed in the presence of 200 nM of V15 aptamer. These results are also in concordance with our previous biochemical assays. After trying to place it in the context of other findings, our results illustrate that this aptamer most probably binds specifically or with higher affinity to the mutant rather than to the c-KIT WT expressed in the H526 SCLC cells.

CONCLUSIONS In the present work, we have successfully selected RNA aptamers that showed high affinity to their respective recombinant proteins with KD values in the nanomolar range. Two of the selected


37


Page 38 of 68

aptamers (H5/V36 and V15) can potently inhibit the in vitro kinase activity of their respective targets in different modalities. The V15 aptamer was effectively able to functionally inhibit the activation loop mutants of c-KIT kinase more potently than the wild type c-KIT in a noncompetitive mechanism of action. Presumably, it interacts with less conserved structural aspects to their target kinase and hence it could possess a much greater potential for selectivity than the small molecule inhibitors of ATP binding. Thus, the inhibitory properties of V15 demonstrate its potential usefulness as a lead compound for the design of anticancer drugs. The H5/V36 competitive inhibitor possesses high selectivity toward wild type c-KIT kinase as compared to other kinases and thus represents a promising candidate for functional interference and analysis of endogenous wild type c-KIT function inside the cells and living organisms. Taken together, our results suggest that these RNA aptamers may serve as a platform for the future development of novel aptamer-based targeted cancer therapies. Additionally, the potential of both aptamers to inhibit the kinase activity of their respective targets revealed the possibility of using these aptamers as specific enzymatic inhibitors for laboratory use. To the best of our knowledge, the selected aptamers described in this study are the first RNA aptamers developed against the kinase domain of the wild type and the mutated D816H/ D816V c-KIT proteins. We believe that our RNA aptamers could serve as useful tools to define new functional sites on the c-KIT kinase that can be used to guide the rational chemical synthesis of small molecule drugs. A study demonstrated that aptamers can be converted into small molecule inhibitors using the so-called aptamer-displacement assays for rapidly identifying alternative small-molecule target sites in proteins.82 These strategies have been developed to enable the conversion of an aptamer/protein complex into a small organic inhibitor by screening small-molecule libraries for compounds that can displace the aptamer from its target and adopt its inhibitory activity.81


38

Page 39 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


EXPERIMENTAL SECTION Pool Design and synthesis. The initial 90 nucleotides (nt) long single stranded DNA (ssDNA) pool was purchased from Midland (Midland certified company, USA). The design of the oligonucleotides was comprised of a central variable region of 45 nucleotides length flanked by two fixed-sequence regions at both ends allowing primer annealing and PCR amplification. 5’-GGGATGGATCCAAGCTTACTGG(45N)GGGAAGCTTCGATAGGAATTCGG-3’. N is one of four nucleotides; A, T, C or G. The initial 2′-fluoro-pyrimidine-modified random RNA pool was synthesized as previously described by Ababneh, et al., (2013).83 The in vitro selection process (SELEX). The 2′-fluoro-modified random RNA pool was heated in folding buffer (4.2 mM Na2HPO4, 2 mM KH2PO4, 140 mM NaCl, 10 mM KCL, and 5 mM MgCl2) at 70º C for 10 minutes. Then, the mixture was rapidly cooled in ice for 10 minutes to ensure proper folding of RNA ligands into their 3D structures, after which the pool was equilibrated at room temperature (RT) for additional 10 minutes. In the first three rounds of the SELEX, a negative pre-selection step was performed by mixing one microgram of the RNA pool with the MagneGST™ Glutathione Particles (Promega, USA) at RT for 20 minutes. After that, the flow-through of unbound sequences was incubated with an equimolar mixture of the active GST-tagged c-KIT recombinant proteins (Millipore, USA): wild type c-KIT (c-KIT WT) and two mutated proteins; c-KIT

D816H

and c-KIT

D816V

for 1 hour at 37°C. For partitioning purpose, the

equilibrated GST magnetic beads (Promega, USA) were added and incubated with the mixture for 20 minutes at RT. Then, the magnetic stand separator was used to separate the beads with bound protein-RNA complexes and the supernatant containing the unbound RNA sequences was carefully aspirated and discarded. The beads were then washed with the folding buffer to remove any nonspecific binders and to enhance partition efficiency. After proper washing, the RNA


39


Page 40 of 68

sequences bound to the GST-tagged c-KIT proteins and beads were eluted by mixing with an appropriate volume of Glutathione containing elution buffer at room temperature for 15 minutes. The recovered RNA aptamers were reverse-transcribed into cDNA for further amplification by PCR and the PCR products were purified by PAGE using the ‘crush and soak’ method. Finally, the purified PCR products were in vitro transcribed to produce the second pool of 2’-F-modified RNA molecules for the second round of SELEX. After the fourth round of selection, the obtained RNA pool was split and incubated with each variant of c-KIT proteins individually for the remaining cycles of selection. Thirteen rounds of iterative selection and amplification have been performed for the selection of RNA aptamers against c-KIT D816V

WT,

c-KIT

D816H,

and c-KIT

proteins. At the end of the selection experiment, the ‘winning’ RNA sequences with

enhanced binding to the corresponding target were isolated from the evolved last pool, reversetranscribed into cDNA, and amplified by PCR. The double stranded PCR products were purified using QIAquick PCR purification kit (Qiagen, USA) and cloned into pGEM-T plasmid using pGEM®-T Easy vector system (Promega, USA). The Escherichia coli competent cells were then transformed and plated in selective media. The positive transforming colonies were isolated and the plasmids of individual clones were extracted and purified using PureYield™ Plasmid Miniprep System (Promega, USA). The eluate containing the purified plasmid DNA was collected and stored at -20°C for sequencing and characterization. DNA Sequencing and Sequences analysis. The extracted DNA plasmids were sent to Macrogen Inc., South Korea, to perform Sanger sequencing by “ABI Prism 3700XL” capillary sequencer instrument (Applied Biosystems, USA). The sequencing reactions were performed using the pUC/M13 forward universal sequencing primer. Each sequence was named as KIT (WX/HX/VX) based on their protein target and the sequencing serial number. Where, W stands


40

Page 41 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for c-KIT

WT,

H for c-KIT

D816H,

and V for c-KIT

D816V

proteins. Sequences analysis and

alignment were carried out using the software CLC Main Workbench (Version 7.8.1) from the website www.qiagenbioinformatics.com. Putative Quadruplex forming G Rich Sequences (QGRS) of candidate aptamers were predicted using QGRS Mapper software 3 from the website http://bioinformatics.ramapo.edu/QGRS/index.php.84 Synthesis of 2′-fluoro-pyrimidine-modified RNA aptamers. The initial ssDNA sequences of candidate aptamers were purchased from the Midland Certified Reagent Company (0.2 µM scale, Reverse Phase (RP)-HPLC; Midland, Texas. USA) and amplified by PCR using the following designed forward primer (APT-FT7: 5’-GCTAATACGACTCACTATAGGGATGGATCCAAGCTTACTGG-3’) and the reverse primer (APT-R: 5’-CCGAATTCCTATCGAAGCTTCCC-3’). The forward primer (APT-FT7) contains a T7 promoter sequence (underlined) for the in vitro transcription. The PCR mix contained thirty nanograms of the initial ssDNA template, 1X GoTaq reaction buffer, 200 μM of each dNTPs mix, 1 μM of each aptamer, 2.5 mM MgCl2 and 2.5 U of Taq DNA polymerase (Promega, USA). The PCR program starts by heating up to 95°C for 5 minutes as an initial denaturation step. Then, the cycling begins with a short denaturation step for 1 minute at 95°C; primers annealing for 1 minute at 55°C followed by 1 minute extension step at 72°C. These cycles were repeated fourteen times, followed by a final elongation step of 10 minutes at 72°C. The resulting 109 bp PCR products were purified by using the MinElute PCR purification system (Qiagen, Germany). Then, the eluted DNA fragments were loaded in 2% low-melting point agarose gel to be further purified using MinElute gel extraction system (Qiagen, Germany). Following the PCR purification, double stranded T7-DNA fragments were in vitro transcribed into 2′-fluoro-pyrimidine-modified RNA aptamers using the DuraScribe® T7 Transcription Kit


41


Page 42 of 68

(Epicentre-Lucigen, Wisconsin, USA) which produces DuraScript® RNA transcripts that are resistant to RNase A degradation. According to the manufacturer's protocol, each in vitro transcription reaction was carried out in 20-μl reaction volume and incubated at 37 ºC for overnight. The resulting RNA transcripts were treated with DNase I for subsequent degradation of the remaining DNA template at 37° C for 30 minutes. Then, the RNA transcripts were purified using miRNeasy Mini kit (Qiagen, Germany) which combines both phenol/guanidine and silica membrane–based purification systems. Finally, the purified RNA aptamers were analyzed using 4% agarose gel to assess the purity, length of the transcript and the extent of DNase I treatment. This was performed by mixing equal volume of purified RNA aptamers with 2X RNA loading dye (New England BioLabs, UK) and heated at 70°C for 10 minutes before loading in the gel. Gel electrophoresis was run at a constant voltage of 70 volts for 30 minutes. The purity of synthesized RNA aptamers was further evaluated using a NanoDrop spectrophotometer (ThermoFischer Scientific, USA) by measuring the absorbance of a given RNA aptamer at 260 nm, 280 nm, and 230 nm wavelengths in OD unit. Then, the OD260/OD280 and OD260/OD230 ratios were calculated. The purity ratios for “pure” RNA aptamer were ~2.0 for OD260/OD280 and in the range of 2.0-2.2 for the OD260/OD230 ratio which indicate that the synthesized RNA aptamer is free from proteins and other contaminants e.g. phenol and guanidine reagents that were used in the purification kit. The purity of all tested aptamers is > 95% purity. Secondary structures prediction. The secondary structures of the candidate RNA aptamers were predicted using the Mfold web server program which is free available at the website http://unafold.rna.albany.edu/?q=mfold/RNA-Folding-Form2.3 (version 2.3 energies). The most likely structure was chosen on the basis of the lowest predicted free energy of formation (ΔG;


42

Page 43 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


kcal/mol) using the default settings except for the temperature (25° C). The Structure Display and Free Energy Determination application was also used that takes into consideration the folding conditions which are the temperature (25° C) and the ionic conditions particularly Na+ and

Mg+2

concentrations

that

were

set

at

140

mM

Na+

and

5

mM

Mg+2

(http://unafold.rna.albany.edu/?q=mfold/Structure-display-and-free-energy-determination). Electrophoresis mobility shift assay (EMSA). Typically, 7% w/v mini non-denaturing polyacrylamide gel (19:1 acrylamide: bisacrylamide; EuroClone, Europe) of 1.00 mm thickness was prepared in 0.5 X TBE buffer and 2.5 mM MgCl2 final concentrations. Following polymerization, the gel was placed into the electrophoresis tank filled with pre-chilled 0.5 X TBE running buffer supplemented with 2.5 mM MgCl2. The gel was pre-run at constant 80 volts in the refrigerator for at least 45 minutes. Aptamer-protein mixtures were prepared by mixing 400 nM fixed concentration of folded aptamers with various concentrations of purified recombinant proteins to get different ratios of aptamer-protein mixture in a reaction buffer supplemented with 2.5 mM MgCl2 final concentration. Binding reactions were incubated for 1 hour at 37° C. At the end of the incubation time, each sample was mixed with 6X Blue/Orange loading dye (Promega Corporation, USA) and immediately loaded in the gel. Finally, the gel was run under constant voltage 80 volts for 60 minutes in the refrigerator. After that, the RNA aptamers in the gel were stained using SYBR® Green II RNA Gel Stain (Invitrogen, USA). The RNA/SYBR Green II complexes were then illuminated and the resulting fluorescence was visualized using SYBER GREEN filter of ChemiDoc™ MP Imaging System (Biorad, USA). Measurement of the binding affinity of RNA aptamers. The extent of affinity between an aptamer and its target is estimated by means of the equilibrium dissociation constant (KD). To do so, a series of aptamer concentrations ranges from 20 to 150 nM were prepared in binding buffer


43


Page 44 of 68

(4.2 mM Na2HPO4, 2 mM KH2PO4, 140 mM NaCl, 10 mM KCl and 2.5 mM MgCl2) and mixed with fixed concentration of diluted protein (10 nM) in a final volume of 40 µl binding reaction. Then, the binding reactions were incubated for 1 hour at 37 °C. For separation of aptamerprotein complexes from unbound aptamers, 5 µl of the pre-equilibrated GST magnetic beads (Promega, USA) were added at RT with gentle mixing on a rotating platform for 30 minutes. Unbound aptamers in the supernatant were carefully collected and transferred to a new tube. Then, the beads were washed once again using 100 µl binding buffer and the resulting supernatant was also collected and combined in the same tube. This washing step was performed to remove any residual un-bound aptamers. Finally, the concentration of unbound aptamers from each binding reaction was quantified using the QuantiFluor® RNA system (Promega Corporation, Madison, USA). Control experiments in the absence of protein were performed at each aptamer concentration to calculate the non-specific binding signal attributed to aptamers that may non-specifically adhere directly to the beads. For aptamer quantification, a standard curve was prepared using the same binding buffer. For measurement, unknown samples, blank, and standard samples were transferred to a 96 wells solid-black NBS™ microplate (Corning®, USA). Then, diluted QuantiFluor® RNA dye (Promega Corporation, Madison, USA) was added to each well and mixed briefly according to the manufacturer’s instructions. Finally, the fluorescence was measured using the GloMax®-Multi+ Detection Systems (Promega Corporation, Madison, USA). Calculations and Data analysis. The concentrations of the unbound aptamers in all washing collections were calculated using the prepared standard curve. For affinity measurement, the concentration of bound aptamers in each reaction mixture was calculated by subtracting the


44

Page 45 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


measured concentration of un-bound aptamers from the concentration of the total aptamers used in each reaction mixture. As illustrated in the following formula: [Total bound aptamers] = [Total aptamers] – [Unbound aptamers] Then, the concentration of the aptamer-protein complexes which represents the specific binding was calculated by subtracting the total concentration of aptamers bound to the beads from the concentration of aptamers non-specifically bound to the beads at that particular concentration using the following formula: [Aptamer-Protein complexes] = [Total bound aptamers] – [Non-specifically bound aptamers] For each candidate aptamer, three independent experiments were performed. After that, the KD value was determined by plotting the calculated concentrations of aptamer–protein complexes on the Y-axis versus the concentrations of total aptamers on X-axis and fitting the data using one site saturation binding curve with the following Hill equation: [TA] = ([T total] X [A]h) / (Khd + [A]h) Where, [T total] is the apparent total concentration of the protein Target, [TA] is the calculated concentration of Aptamer–Target complexes at a given concentration of Aptamers used in the binding reaction [A], and “h” is the Hill slope.85 All data analyses were conducted using GraphPad Prism 6 (GraphPad Software, San Diego, CA, USA). The biochemical in vitro kinase assay. In our characterization experiment, the ADP-Glo™ Kinase assay kit (Promega, USA) was used. The luminescence signal, represented as relative luminescence unit (RLU), was measured using the GloMax®-Multi-Detection System (Promega Corporation, Madison, USA) and an integration time of 0.5 second per well. In 384 wells solidwhite NBS™ (Corning®, USA) microplate, 1.5 µl of the diluted recombinant kinase enzyme was pre-incubated with 1.5 µl of the folded aptamer for 30 minutes in the binding buffer at RT. Then, 2.5 X ATP/ poly(Glu:Tyr) peptide mixture was prepared in the kinase buffer (12.5 mM


45


Page 46 of 68

Tris, pH 7.5; 6.25 mM MgCl2; 31.25 µg/ml BSA and 125 μM DTT). The kinase reaction was started by adding 2 µl of 2.5 X ATP/ poly (Glu:Tyr) peptide mixture into each well to get a 5 µl kinase reaction volumes. The reactions were allowed to proceed at 25° C for 30 minutes. For each kinase assay, the background (blank) signal was determined by enzyme-free reaction and then subtracting this signal from all measured values. All kinase reactions were conducted in the initial velocity region of the enzymatic reaction in which less than 10% of the substrate has been converted to product.56 The IC50 values determination. The IC50 value of each candidate aptamer was determined by using antagonist dose response experiment, in which the activity of a given tested kinase is determined in the presence or absence of different aptamer concentrations that are equally spaced on the log scale. Therefore, tenfold dilutions of a given aptamer were prepared in folding buffer and mixed with equal volume of tested kinase enzyme using the pre-determined optimized enzyme concentration for the steady state condition. Accordingly, 75 ng of c-KIT WT, 6 ng of cKIT

D816V,

and 10 ng of c-KIT

D816H

recombinant active enzymes were used (SignalChem,

Lifescience, Canada). The final prepared concentrations of a given aptamer were ranged from 0.01 to 10 µM in the reaction wells. Finally, the kinase reactions were initiated using 50 µM ATP and 200 µg/ml poly (Glu:Tyr) peptide as the final concentrations. Then, the reactions were allowed to proceed for 30 minutes at 25° C. The maximum enzyme activity control (0% inhibition) was prepared by mixing all components of the kinase reaction except the aptamer. The luminescent signal (RLU) for each reaction well was measured and the percentage of inhibition (%) was calculated. The data were plotted in the antagonist-dose response curve, where the percentage of inhibition was plotted at the Y-axis versus the logarithm of each aptamer concentration at the X-axis. The aptamer antagonist-dose response curves were analyzed by


46

Page 47 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fitting data to a three-parameter logistic equation “dose–response curve with standard slope” from which the apparent IC50 values were deduced. All data analyses were conducted using GraphPad Prism 6 (GraphPad Software, San Diego, CA, USA). All experiments were performed at least twice, and figures are representative of the results obtained. Values are expressed as means of triplicate determinations ± standard deviations (SD). Identification of the mechanism of action. The enzyme activity of the analyzed kinase was measured at different ATP concentrations in the presence or absence of the aptamer. Two different aptamer concentrations were used and serial dilutions of 2.5 X ATP were prepared in kinase buffer that contains fixed 2.5 X poly (Glu:Tyr) peptide concentration. This will result in variable concentrations of ATP substrate ranged from 0.5 to 100 µM in tested wells combined with fixed 200 µg/ml poly (Glu:Tyr) peptide final concentration. The measured kinase activity at a given ATP concentration in RLU/minute was plotted at the Y-axis versus the ATP concentrations at the X-axis. Data were fitted to the Henri-Michaelis-Menten equation using non-linear regression analysis. Finally, to create a Lineweaver-Burk line corresponding to the nonlinear regression fit, we followed the GraphPad curve fitting guide by using the predetermined Kmapp and Vmaxapp values (GraphPad Software, San Diego, CA, USA). Selectivity determination. The selectivity of a given candidate aptamer was determined by measuring its IC50 value against PDGFRβ tyrosine kinase as well as against JNK3 serinethreonine kinase. The antagonist dose-response experiments were performed as described above. For PDGFR β kinase assay, we followed the manufacturer’s protocol by using 10 ng of active kinase enzyme, 25 µM ATP, and 200 µg/ml poly (Glu:Tyr) peptide. While for JNK3 kinase, 4 ng of the active enzyme, 1 µM ATP, and 200 µg/ml of p38 peptide were used to perform the assay. Both kinase reaction mixes were incubated for 60 minutes at 25° C.


47


Page 48 of 68

Aptamer stability assay. To investigate the stability of our synthesized 2′-fluoro-pyrimidinemodified RNA aptamers against nucleases, fresh human serum was mixed with a given aptamer for different time intervals extending up to 4 days. For each time point, 10 μg of aptamer was folded in 10 μl folding buffer and then incubated with 40 μl of fresh human serum at 37° C for the defined time point. After that, 25 μl aliquot was taken and treated with 1.5 mAU of proteinase K (Qiagen, Germany) followed by incubation at 56° C for 10 minutes.86 The samples were then stored at −20° C. Later, the stability of the treated aptamer was analyzed on 3% agarose gel stained with ethidium bromide by mixing 10 μl of each time point sample with 10 μl of 2X denaturing RNA loading dye (New England BioLabs, UK), heated for 10 minutes at 70°C, and then rapidly cooled on ice for 2 minutes. The gel electrophoresis was run at 70 volts for 25 minutes and the intensity of each band was visualized using Image Lab™ Software, ChemiDoc™ MP Imaging System (BioRad, USA). Cell viability assay. NCI-H256 cells human SCLC cell line (obtained from American Type Culture Collection, ATCC; Manassas, VA) were cultured in RPMI 1640 supplemented with 10% FBS and maintained in a humidified chamber at 37°C and 5% CO2. Then, cells were splitted in 96-well plates at density 3 x104 cells/well in 60 µl serum free RPMI 1640 medium for overnight. The number of cells plated was adjusted so that untreated cells were in the exponential growth phase at the time of treatment. On the next day, the cells were treated dropwise with 40 µl of aptamer-lipid complexes and incubated for 6 hours at 37° C and 5% CO2 before ligand stimulation. Subsequently, cells were stimulated either with 100 µl of RPMI 1640 medium supplemented with 200 ng/ml rhSCF (R&D Systems) or with 100 µl of RPMI 1640 medium supplemented with 10% FBS and incubated for 72 hours at 37°C. After that, the number of


48

Page 49 of 68 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


metabolically active cells present after 3 days was assessed by using CellTiter 96 NonRadioactive Cell Proliferation assay (Promega, USA). Preparation of aptamer-lipid complexes. The candidate aptamers were first diluted to 8 µM in folding buffer, folded, and then mixed with equal volume of serum free RPMI 1640 medium. The Lipofectamine™ 3000 Reagent (Invitrogen, USA) was also diluted by mixing 0.25 µl with 4.75 µl in serum free RPMI 1640 medium to get 5 µl diluted Lipofectamine for each well. A master mix of diluted Lipofectamine was prepared and mixed thoroughly by vortexing for 2-3 seconds. In PCR tubes, 5 µl of the diluted Lipofectamine Reagent was transferred to each tube and then, 5 µl of diluted aptamer was added to each tube in 1:1 ratio and incubated for 10–15 minutes at RT as recommended by the manufacture’s protocol. After incubation, 30 µl of serum free RPMI 1640 medium was added to each well, mixed, and then 40 µl aptamer-lipid complexes was added dropwise onto the cells. Mock control was prepared by mixing all the above ingredients except the aptamer. The treated cells were incubated for 3 days at 37°C and 5% CO2. Four replicate wells were performed per each candidate aptamer and the data were expressed as the percentage of metabolically active cells to the untreated control cells containing only the Lipofectamine vehicle. Assays were repeated twice and statistically analyzed using Student’s two tailed t test on the GraphPad Prism 6 (GraphPad Software, San Diego, CA, USA). Data of P value

Developing and Characterization of Chemically ... - ACS Publications

Recommend Documents